ID: 968448025

View in Genome Browser
Species Human (GRCh38)
Location 4:662272-662294
Sequence GCAGGCCCTCCTGGTACCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968448020_968448025 -4 Left 968448020 4:662253-662275 CCAGAATCACCAGGGTTGTGCAG 0: 1
1: 0
2: 0
3: 2
4: 95
Right 968448025 4:662272-662294 GCAGGCCCTCCTGGTACCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968448025 Original CRISPR GCAGGCCCTCCTGGTACCAA GGG Intronic
900236109 1:1591754-1591776 GCAGGCCCTCCTGCTGTCAATGG + Intergenic
900652309 1:3735708-3735730 GCTGGCACTCCTGGGGCCAAGGG + Exonic
902387358 1:16083487-16083509 CCAGCCCCTCCTGGGGCCAAGGG - Intergenic
903144574 1:21362699-21362721 TCAGGCCCTCATAGTGCCAAGGG + Intergenic
906295251 1:44645544-44645566 GCAGGCCTTCCTGCTAGCAAAGG - Intronic
906510630 1:46408631-46408653 GGAAGCCTTCCTGGTACCCATGG + Intronic
908070464 1:60454682-60454704 GCAGGAGCTCTTGGTACCTAGGG - Intergenic
911858562 1:102914738-102914760 GCTGGACCTCCAGGTGCCAAGGG - Exonic
913282978 1:117203098-117203120 GCCTCCCCTCCTGGTACCAGAGG - Intronic
920071969 1:203308509-203308531 CCAGACCCTCCTGGGACCCAGGG - Exonic
920549031 1:206842832-206842854 GCAGGCCATCCTGGGAGTAAAGG + Exonic
921116744 1:212099062-212099084 GTAGGCACTCCTGGTCCCCAGGG - Intronic
923438195 1:233989109-233989131 CCAGGACTTCCTGGTACCAGAGG + Intronic
924724590 1:246657429-246657451 GCAGGCCCTGCTGAAACAAAAGG + Intronic
1063381258 10:5587672-5587694 GCAGCCCCACCTGGTCCCAGGGG - Intergenic
1064312409 10:14223262-14223284 ACAGGCATTCCTGGTCCCAATGG - Intronic
1065141961 10:22726697-22726719 GCAGGCCATCCAGGTACCTGTGG + Intergenic
1073459924 10:103660556-103660578 GCAGGCCCTGCTGTCACCATGGG - Intronic
1075247749 10:120838982-120839004 GCTGCCTCTCCTTGTACCAAGGG + Intergenic
1081805335 11:45886892-45886914 CCAGCCCCTCCTGGGAGCAAGGG + Intronic
1084309882 11:68310933-68310955 GCAGGCCCTGCAGGTGCCGAAGG + Intergenic
1084588847 11:70078790-70078812 GCAGGGCCTCCTGGGACCCCAGG + Intronic
1088566617 11:111179174-111179196 GAAGTCCCTCATGGAACCAAGGG - Intergenic
1088757156 11:112894852-112894874 GGGGGCCTTCCTGGTACCCAGGG + Intergenic
1088994915 11:114987763-114987785 GCAACCTCTCCTGGTGCCAAGGG + Intergenic
1095985073 12:47994001-47994023 CCAGGCCTTCCTGGTGTCAAAGG - Exonic
1096630329 12:52922325-52922347 GCAGGCACTCCCTGTACCATAGG + Intronic
1097877649 12:64658283-64658305 GAAGATCCTCCTGGTGCCAAAGG + Intronic
1101700496 12:107169365-107169387 GCAGGCCCTCCAGGCACACAGGG + Intergenic
1101735338 12:107458954-107458976 GCAGGCCCCCCTGTTCTCAAAGG - Intronic
1103321082 12:120093280-120093302 GCAGGCCCTCCCGGACCCATGGG - Exonic
1103412520 12:120722627-120722649 GCAGGCCCACCTGGTGCCAGAGG + Exonic
1107677896 13:42816139-42816161 GCAGGCGCTCCTGGACCCCAGGG + Intergenic
1113422026 13:110178213-110178235 GCAGGCCCTCCTGGAATAAAAGG - Exonic
1114084398 14:19228982-19229004 GCAGGTCCTCCTGCTCCCAGAGG - Intergenic
1118008605 14:61587763-61587785 GCAGGTACTCCAGGTAGCAAAGG + Intronic
1118008633 14:61588020-61588042 GCAGGTACTCCAGGTAACAAAGG - Intronic
1119787209 14:77322567-77322589 ACAGGGACTCCTGGTGCCAAGGG - Intronic
1202896003 14_GL000194v1_random:10826-10848 GCAGGTCCTCCTGCTCCCAGAGG - Intergenic
1123694767 15:22870874-22870896 ACAGACCCTCCTGCTACCACAGG + Intronic
1124828054 15:33119337-33119359 GCAGGCACCCATGGTGCCAAAGG + Intronic
1130554199 15:84911310-84911332 GAGCTCCCTCCTGGTACCAATGG - Intronic
1131201546 15:90401115-90401137 ACAGGCCCTCCAGGTTCCACTGG - Intronic
1133025457 16:2987270-2987292 CCAGCCCCTCCTGGTACCTCTGG - Intergenic
1141523651 16:84597921-84597943 GAAAGGCCTCCTGGTACCCAGGG - Intronic
1141860681 16:86714186-86714208 ACAAGCCCTCCTGGTTCCACTGG + Intergenic
1142172160 16:88628514-88628536 GCAGGCCTTCCTGCTCCCCACGG - Intronic
1142186500 16:88697359-88697381 GCAGGGCCGCCTGGTCCCACCGG - Exonic
1142425531 16:90000436-90000458 GCTGGCCCACCTGGAAACAACGG - Intergenic
1147970429 17:44216681-44216703 GCATGTCTTCCTGGGACCAACGG + Exonic
1148441145 17:47712108-47712130 CCAAGACCTCCTGCTACCAAGGG - Intergenic
1148795591 17:50195239-50195261 GGCGGCCCTCCTGGTCCCAAGGG - Exonic
1151686083 17:75647430-75647452 CCAGGCCCCCCTGGTCCCAGGGG - Exonic
1152557294 17:81059821-81059843 GCAGACCCTCATGCGACCAAGGG - Intronic
1152816643 17:82412031-82412053 GAAGACCCTCCTGGGACCACTGG + Intronic
1157507421 18:48238619-48238641 GTAGGCGCTCCTGGTCCCCAGGG + Intronic
1160031214 18:75261537-75261559 GCAGCCCCTGCTGGAAGCAATGG - Intronic
1160039827 18:75335317-75335339 GCAGAGCCTCCTGGAACCACGGG - Intergenic
1160058320 18:75507191-75507213 TCAGGCCCTCATGATAACAAAGG - Intergenic
1161256628 19:3313524-3313546 GCAGTCCCTCCTGCTACCTGCGG + Intergenic
1161843461 19:6696333-6696355 CCATGCCCTCCTGGGACCCATGG + Intronic
1161853383 19:6750461-6750483 ACAGGCCCTCCTGGGACCCTGGG - Intronic
1162344252 19:10110507-10110529 GCAGGCCATCCTGGAAGCCAAGG + Exonic
1166445301 19:42853460-42853482 GCAGGGCTTACTGGGACCAAGGG - Intronic
926306476 2:11640576-11640598 GCAGCCCCTCCTAGTACACATGG + Exonic
927277343 2:21273128-21273150 GCAGGTCCTCCTGCTCCCTAAGG + Intergenic
930021887 2:47006682-47006704 AGAGGGCCACCTGGTACCAAAGG - Exonic
933801163 2:85961414-85961436 TCAGGCCCTCCTTGGCCCAAAGG + Intergenic
936377694 2:111956288-111956310 ATAGGCAATCCTGGTACCAAGGG - Intronic
937870097 2:126780477-126780499 GCAGGCCCTCCTATTGGCAAGGG - Intergenic
938492189 2:131767117-131767139 GCAGGTCCTCCTGCTCCCAGAGG + Exonic
938495378 2:131795226-131795248 GCAGGTCCTCCTGCTCCCAGAGG - Exonic
939624734 2:144462872-144462894 GCAGGCCCTGTTGGAACTAATGG - Intronic
939699281 2:145370085-145370107 GCAGGCCCTCCAGCAACCTACGG + Intergenic
943523954 2:188993376-188993398 GCAGGGTCTCCTGGTTCAAATGG + Exonic
943529162 2:189057327-189057349 GCAGGAACTCCTGGCCCCAAGGG - Exonic
945378699 2:209112536-209112558 GTATTCCCTCCTGGTACAAAAGG - Intergenic
947139828 2:227010483-227010505 CCAGGGCCTCCTGGTCCCATTGG - Exonic
947387270 2:229604013-229604035 GCTGGCCCTCCTGGTCCCTGTGG - Intronic
947712021 2:232321794-232321816 CCAGGCCCCCCTGGAAACAAAGG - Intronic
948798517 2:240419472-240419494 GCTGGTCCTCCTGGTGCCCAGGG + Intergenic
948892793 2:240915460-240915482 CCAGGCCCTCCTGGATCCCAGGG - Intergenic
1170135816 20:13072540-13072562 GCAAGCCCTCCTGATGCCAGGGG + Intronic
1175026475 20:55907778-55907800 GCATGGCCTCCTGGAAGCAATGG + Intergenic
1176709478 21:10136925-10136947 GCAGGTCCTCCTGCTCCCAGAGG + Intergenic
1177507837 21:22040822-22040844 GCAGGCCCTCAGGGTACCTGAGG + Intergenic
1178380144 21:32100770-32100792 GCAGGCCCTCCTTGGAAAAATGG - Intergenic
1179443227 21:41410813-41410835 GCAGGCACTCCTGGTCCCCAGGG + Intergenic
1179525911 21:41975733-41975755 GCAGGTCCACCTGGGCCCAAAGG + Intergenic
1180293574 22:10864220-10864242 GCAGGTCCTCCTGCTCCCAGAGG + Intergenic
1180496379 22:15893635-15893657 GCAGGTCCTCCTGCTCCCAGAGG + Intergenic
1183654225 22:39175692-39175714 GGAGCCCCTCCTGGTGCCAATGG + Intergenic
1184452613 22:44591881-44591903 GCAGGGCCTCCTGGTGCCAGGGG - Intergenic
1184923692 22:47623279-47623301 TCAGTCCCTCCAGGTACCAGAGG + Intergenic
950578821 3:13849983-13850005 GGAGACCCTCCTGGGAGCAAAGG + Intronic
951569706 3:24049059-24049081 GCTGGGACTCCTGGTACCATGGG + Intergenic
954143357 3:48621657-48621679 CCAGCCCCACCTGGTACCAGAGG + Exonic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
960670153 3:120147910-120147932 TCTGGCCCTCATGGTGCCAAAGG - Intergenic
962444481 3:135452493-135452515 GCAGGACCTCCTGGAATCCAAGG + Intergenic
963831356 3:150012929-150012951 GCGGGGCTTCCTGATACCAAGGG + Intronic
967171092 3:186824441-186824463 GCAGGAGCTCCTGGTGCCACAGG - Intergenic
967720027 3:192806280-192806302 GTAGGAGCTCCTGGGACCAAGGG - Intronic
968446085 4:653078-653100 CCAGGCTCTCCTGTTGCCAAGGG - Intronic
968448025 4:662272-662294 GCAGGCCCTCCTGGTACCAAGGG + Intronic
968516953 4:1019456-1019478 ACAGGGCCTCCCGGGACCAAGGG - Intronic
969454527 4:7293786-7293808 GCATGCCCTACTGTGACCAAAGG - Intronic
969478196 4:7433007-7433029 GCAGGCTCTCATGGGACCACCGG + Exonic
974472061 4:62331424-62331446 GTAGGCACTCCTGGTCCCCAGGG + Intergenic
975931811 4:79533635-79533657 GCAGGCCTTCATGGTGCTAAAGG - Intergenic
980519377 4:133910627-133910649 GTAGGCACTCTTGGTCCCAAGGG - Intergenic
981910908 4:149980802-149980824 TCAGCCCCTCCTGTTTCCAAGGG + Intergenic
982124923 4:152176146-152176168 CCAGGCCCTGCTGGTAGCAAAGG - Intergenic
984720658 4:182970056-182970078 AGAAGCCCTCCTGGTACCACGGG - Intergenic
985110131 4:186539854-186539876 TCAGTCCCTGCTGATACCAAGGG - Intronic
985588350 5:752179-752201 GCAGGCCCTCCTGGGTGCCACGG - Intronic
985603022 5:844634-844656 GCAGGCCCTCCTGGGTGCCACGG - Intronic
987208909 5:15658498-15658520 GCAGCTCCTCCTGCTACAAAGGG - Intronic
987995402 5:25270733-25270755 GCAGGCCCTACTTCTAACAATGG - Intergenic
988652485 5:33167436-33167458 GTAGGCACTCCTGGTACCTAGGG - Intergenic
989797707 5:45496446-45496468 GCAGTTCCTCCTTGTACCACTGG + Intronic
992481272 5:77154591-77154613 GCATGCCATCCTTGTACCACAGG + Intergenic
993679295 5:90855493-90855515 GAAGGCATTCCTGGTACCAAAGG - Intronic
998368781 5:141647982-141648004 GCAGTTCCTCCTGGTAGTAATGG + Exonic
1002332558 5:178454710-178454732 GCAGGCCTTCCTGGTTGCACAGG - Intronic
1002783701 6:385479-385501 GCAGCTCCTCCTGGTTCCAGTGG - Intergenic
1003271679 6:4613276-4613298 GCAGGCCCTCCTTTTATCACAGG + Intergenic
1006297557 6:33176728-33176750 GAAGGTCCCCCTGGAACCAAAGG - Exonic
1009360392 6:62803563-62803585 GTAGGCACTCCTGGTCCCCAGGG - Intergenic
1017077975 6:150637035-150637057 ACAGACCCTCTTGGGACCAAGGG - Intronic
1017693935 6:156995102-156995124 GAGGGCCCTACTGGTACCAGAGG + Intronic
1020455774 7:8372270-8372292 GTAGGCCCTCCTAGTCCCCAGGG - Intergenic
1023837424 7:44076566-44076588 GCAGTCCTTCCCGGTACCACCGG + Intronic
1024629826 7:51237996-51238018 GCATGCCCCTCAGGTACCAAAGG + Intronic
1028830246 7:95320031-95320053 GCATGCCCTCAAGGAACCAAAGG + Intronic
1031964085 7:128014877-128014899 GCAGGCTCTTCTGCTACCAATGG - Intronic
1032098081 7:128949500-128949522 CCAGGCCCTCCCAGTGCCAATGG - Intronic
1039967015 8:42290884-42290906 GCAGCCCCTCCTGGTCTCAGGGG + Intronic
1041254941 8:55971989-55972011 CCAGGCCCTCCTGTCACCGAGGG - Intronic
1041382258 8:57261782-57261804 GCGGGCCGTCCTGGTCCCCAGGG + Intergenic
1043931717 8:86099014-86099036 CCAGGCCCTCCAGGTAGCCATGG - Exonic
1048848940 8:138626215-138626237 GAAGGCCCTCCTGGCCCCCAAGG - Exonic
1049240728 8:141536223-141536245 GCTGGCCTGCCTGGCACCAAGGG + Intergenic
1049247509 8:141570641-141570663 GGAGGCCCTACTTGCACCAAGGG + Intergenic
1049705848 8:144041607-144041629 GGAGGCCATCCTGGTGGCAAAGG - Intronic
1053015020 9:34656975-34656997 TCAGGTCCTCCTGGTCCCAGAGG - Intronic
1054327462 9:63720363-63720385 GCAGGTCCTCCTGCTCCCAGAGG + Intergenic
1055355166 9:75429955-75429977 GAAGGCAGTCCTGGTACCAGAGG - Intergenic
1057153526 9:92817559-92817581 TCAGGCACTCCTGGTCCAAAGGG - Intergenic
1058282052 9:103127888-103127910 CCAGGCCCTCCTGTTAACATGGG - Intergenic
1059336693 9:113573507-113573529 CCAGGCCCTCCTGCTTCCAAAGG + Intronic
1059433942 9:114265437-114265459 TCAGGCCCCCCAGGCACCAAGGG + Exonic
1060740094 9:126092252-126092274 GCCAGCCCTCCTTGCACCAAAGG - Intergenic
1061485663 9:130919390-130919412 GCCGGCCCTCCTTGTCCCAGAGG - Intronic
1061790336 9:133055777-133055799 CCAGGCCCTCCTGGGGCCACTGG - Intronic
1062129140 9:134883334-134883356 GCAGGACCACCTGGGCCCAACGG + Exonic
1202794237 9_KI270719v1_random:105892-105914 GCAGGTCCTCCTGCTCCCAGAGG + Intergenic
1189743592 X:44146675-44146697 TCAGGACCACCTGGGACCAAGGG + Intergenic
1192264934 X:69531512-69531534 ACAGGCCCTGCTGGCACTAAAGG - Exonic
1192312399 X:70027865-70027887 GCAGGACCTCCTGGACCCAATGG + Exonic
1193203004 X:78714667-78714689 GGAGGCACTCCTGGTACCCAGGG + Intergenic
1195797332 X:108665512-108665534 CCAGGCCCTCCTGGACCAAAAGG + Exonic
1196971088 X:121109623-121109645 GTAGGCACTCCTGGTCCCCAGGG + Intergenic
1201149080 Y:11085533-11085555 GCAGGTCCTCCTGCTCCCAGAGG - Intergenic
1201533003 Y:15012929-15012951 GCAGGTCCTCCTTGTACCTCTGG + Intergenic
1202035356 Y:20628096-20628118 GCAGGTCCTCCTTGTACCTCTGG + Intergenic