ID: 968448946

View in Genome Browser
Species Human (GRCh38)
Location 4:666195-666217
Sequence GGCTGTACACAGTGCTGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968448946_968448958 14 Left 968448946 4:666195-666217 CCGGCTCAGCACTGTGTACAGCC 0: 1
1: 0
2: 1
3: 19
4: 189
Right 968448958 4:666232-666254 CCTCTCCCCAGCTGCAGTAAGGG 0: 1
1: 0
2: 0
3: 23
4: 222
968448946_968448956 13 Left 968448946 4:666195-666217 CCGGCTCAGCACTGTGTACAGCC 0: 1
1: 0
2: 1
3: 19
4: 189
Right 968448956 4:666231-666253 GCCTCTCCCCAGCTGCAGTAAGG 0: 1
1: 0
2: 4
3: 19
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968448946 Original CRISPR GGCTGTACACAGTGCTGAGC CGG (reversed) Intronic
900293827 1:1938728-1938750 GGCTGACCACAGGGCTGGGCTGG - Intronic
900324594 1:2102203-2102225 GGCAGGACACAGGGCTGAACTGG - Intronic
900540239 1:3199105-3199127 GGCTGGAGAGAGTGCTGTGCGGG + Intronic
901586241 1:10295686-10295708 GCCAGGACATAGTGCTGAGCGGG + Exonic
901678012 1:10898176-10898198 GGCTGTATCCTGGGCTGAGCTGG - Intergenic
901764412 1:11490792-11490814 GGCTGCTTACAGAGCTGAGCTGG - Intronic
902365726 1:15972730-15972752 GGAAGTACACAGTCCAGAGCTGG - Intronic
904772540 1:32888358-32888380 GGGTATATTCAGTGCTGAGCAGG + Intronic
905972309 1:42151359-42151381 GGCTGAACTCAATGCTGGGCTGG - Intergenic
907404657 1:54246556-54246578 TGCAGTACGCAGCGCTGAGCTGG + Intronic
907784647 1:57599741-57599763 GGCTGTACATAGCCCTGAGGAGG + Intronic
911343893 1:96673787-96673809 GGCAGGACCCAGTGCTGTGCTGG - Intergenic
912873019 1:113327525-113327547 GGCAGGACCCAGTGCTGTGCTGG - Intergenic
912875151 1:113350209-113350231 ACCTGGACACAGTGCTGAACTGG + Intergenic
915047774 1:153032957-153032979 AGCTGTACACAGAGATGAGTTGG + Intergenic
916134272 1:161637718-161637740 TGCTGAAAACAGTCCTGAGCAGG + Intronic
916811813 1:168312616-168312638 GCATGTACACAGTGCTGAGAAGG - Intronic
916818394 1:168374910-168374932 GGCTGCACACAGTGCCCAGCTGG + Intergenic
917852922 1:179080784-179080806 CGATGTACACAGTGCTGGGCTGG + Intergenic
918520430 1:185408797-185408819 GGGTTTACTCAGTGCTGTGCAGG - Intergenic
923390240 1:233507625-233507647 TGCTGAACACAGTGCAGAGGTGG + Intergenic
924287203 1:242499962-242499984 GGCTGACCACAGTGCTTACCTGG + Intronic
1063169691 10:3496459-3496481 CGCTGGACACGGGGCTGAGCTGG - Intergenic
1065201582 10:23317486-23317508 GGCTGTACACTCTACTAAGCTGG - Exonic
1067299997 10:44999682-44999704 TGCTGAAAACAGTGCTCAGCAGG - Exonic
1068749417 10:60574246-60574268 TGCTTTACCCAGGGCTGAGCAGG + Intronic
1074544043 10:114388596-114388618 GGCTGGACACAGTACTGACGAGG - Intronic
1075774666 10:124974385-124974407 GACTGTTCACATTGGTGAGCTGG + Exonic
1076648794 10:131972824-131972846 GGCTGGACACTCAGCTGAGCGGG - Intronic
1077647043 11:3934452-3934474 GGCTGTACAAAGTGCTATGGAGG - Intronic
1079080904 11:17413114-17413136 GGCTGAGCACAGTGCTGTGTGGG + Intronic
1079391210 11:20023539-20023561 GGCAGTACAGAGGGGTGAGCCGG + Intronic
1083272168 11:61578077-61578099 GGCTGGACAGAGTGTGGAGCTGG + Intronic
1085430867 11:76446130-76446152 GGCTCTACTCTGTGCTAAGCAGG + Intronic
1088154457 11:106786344-106786366 GACTCTACACAGTGCTCAGCTGG + Intronic
1091216964 11:133908016-133908038 CACTGCACAGAGTGCTGAGCCGG + Intergenic
1092830825 12:12442853-12442875 GCCTGCACACAGGGCTGGGCAGG + Intronic
1093065542 12:14654394-14654416 GGCTGTACAGAGAGCTCATCAGG - Intronic
1095885455 12:47184288-47184310 GGCTGGAGACAGTGGTGTGCTGG + Intronic
1099501151 12:83415496-83415518 GACTGTCCCCAGTCCTGAGCTGG - Intergenic
1102677490 12:114668534-114668556 GGCTGGACACAAGTCTGAGCAGG + Intergenic
1107885914 13:44874021-44874043 GGCTTGCCACAGTGCTCAGCAGG - Intergenic
1110456093 13:75691880-75691902 GGGTGAACACAGTGCAGACCTGG + Intronic
1114151848 14:20049383-20049405 GGCTGTAGAAAGTGATGAGGAGG - Intergenic
1114372522 14:22105840-22105862 GCCTTTACACAGTGCTGTTCAGG + Intergenic
1114752617 14:25222559-25222581 GGCTGTAAATTGTGCTGTGCAGG - Intergenic
1115310712 14:31975213-31975235 GGCTGTACACTCTGTGGAGCCGG - Intergenic
1115381516 14:32745622-32745644 GGCGGGACCCAGTGCTGTGCTGG - Intronic
1119935817 14:78591470-78591492 GGCCACACACAGGGCTGAGCTGG - Intronic
1120252473 14:82075756-82075778 TGCTGTCCAAGGTGCTGAGCAGG - Intergenic
1121606870 14:95247000-95247022 TGCTGTTCACAGTACTGATCAGG + Intronic
1122588413 14:102827064-102827086 GGCTGTACACATTCCTCAGCAGG - Intronic
1122893555 14:104744134-104744156 GGCTGGACACAGGGCAGTGCTGG + Intronic
1125530791 15:40412227-40412249 GGCAGAACACAATGGTGAGCTGG + Intronic
1125771623 15:42171322-42171344 GGCTGCACACACTCATGAGCTGG - Intronic
1127933144 15:63610929-63610951 GGCTGTACCCAGTGTTCAGGAGG + Intronic
1128664819 15:69530428-69530450 GGCTGTACACTGTGCAATGCCGG - Intergenic
1129252652 15:74317473-74317495 CCCTGTGCAGAGTGCTGAGCTGG + Intronic
1130675700 15:85950112-85950134 GGGTGTCTACAGTGCTGAGATGG + Intergenic
1130984772 15:88837576-88837598 GGCTTTAAAAACTGCTGAGCTGG + Intronic
1132976922 16:2715640-2715662 CGCTGTCCACGGTGCTGAACCGG + Intronic
1135388250 16:22064350-22064372 GTTTGTACACAGAACTGAGCTGG - Intronic
1136479124 16:30530764-30530786 GGCCAGACACAGGGCTGAGCTGG + Intronic
1136482743 16:30552830-30552852 GGCCAGACACAGGGCTGAGCTGG + Intronic
1137710176 16:50561246-50561268 GGTTGGACACAATGCTGCGCTGG + Intronic
1138507083 16:57483835-57483857 TGCTGGACACCGTGCTTAGCTGG - Intronic
1139325670 16:66150912-66150934 GGCCTAGCACAGTGCTGAGCAGG - Intergenic
1139357129 16:66373041-66373063 GCCTGATCACAGTGGTGAGCAGG - Intronic
1140520049 16:75573078-75573100 AGCTATACACAGCACTGAGCAGG - Intronic
1140729541 16:77843668-77843690 GGCTGTATTCAGTGCAGACCTGG + Intronic
1141998078 16:87647717-87647739 GGCTGTGCACAGCGGTGAGGAGG - Intronic
1142165423 16:88584573-88584595 GGCTGTACATATTGGTGTGCTGG - Intronic
1142189392 16:88710868-88710890 GGCTGCACACAGGGCTCGGCTGG + Intronic
1142468841 17:151156-151178 AGCTATTCACAGTGCTGAGGTGG + Intronic
1143408143 17:6691629-6691651 AGCTGGAGACTGTGCTGAGCTGG + Intronic
1145788004 17:27606559-27606581 GGCTGAACCCAGTGGTGTGCTGG + Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147473269 17:40684647-40684669 GCCTGCTCACAGGGCTGAGCTGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151318185 17:73336769-73336791 GCCTGTACACAGTGCACAGAGGG + Exonic
1151574670 17:74946737-74946759 GGCAGTACTCAGTGCTGAAGGGG - Exonic
1151895064 17:76974644-76974666 GGCTGTACACTCTACAGAGCAGG + Intergenic
1153583145 18:6595683-6595705 GGCTGTTTACTGTGCTGAGAAGG - Intergenic
1157197736 18:45633087-45633109 TGCTTGACACAGTGCTAAGCAGG + Intronic
1163275861 19:16283835-16283857 GGCTGGACGCAGGGCCGAGCAGG + Intergenic
1164979667 19:32604262-32604284 GGCTGTAGACTGTGCTGAACAGG - Exonic
1165906994 19:39200224-39200246 TGCTGTACACAGCCCTGAGCTGG - Intronic
1168425772 19:56237311-56237333 AGCTGTGCACATTGCTGAGGAGG + Intronic
1168557269 19:57353533-57353555 GGCTGGACACAGTGGTGAGAGGG + Intronic
925314337 2:2909615-2909637 GGGTGTGCAGAGTGCAGAGCAGG + Intergenic
926114615 2:10204538-10204560 GGCTGGGCACAGCGCTGAGCAGG - Intronic
926171981 2:10558353-10558375 TGCTGTGCACAGCGCTGTGCTGG + Intergenic
927504403 2:23603712-23603734 GGCTGGACACAATGCTGGACTGG - Intronic
928142846 2:28745568-28745590 TGCTGTGCTCATTGCTGAGCAGG + Intergenic
930895255 2:56439071-56439093 GGCTGTACACAATGCGTGGCTGG + Intergenic
935787569 2:106562861-106562883 GGCTGGGTGCAGTGCTGAGCTGG - Intergenic
937877663 2:126837478-126837500 GGCCCTACACTGTGCTGGGCTGG + Intergenic
937884307 2:126889581-126889603 GGCTCTGCAGGGTGCTGAGCAGG + Intergenic
938104347 2:128520016-128520038 GGCTGAGCACAGAGCAGAGCAGG + Intergenic
940895754 2:159080784-159080806 GGCTGTACACAGAGCTGCTCTGG - Intronic
941821196 2:169845010-169845032 GCCTGTACACTGTGCTTAGAGGG - Intronic
947990832 2:234486143-234486165 AGCTCTACACAGCCCTGAGCTGG - Intergenic
948165630 2:235859777-235859799 AACTGTACACAGTGCTGTGAAGG - Intronic
948460944 2:238129685-238129707 CGCTGGACACAGCGCTGGGCCGG - Intronic
948633338 2:239316634-239316656 GGCTGTCCACAGGAATGAGCAGG + Intronic
948747472 2:240106994-240107016 GACTGGACACCGAGCTGAGCGGG - Intergenic
1169795043 20:9453084-9453106 GGCACTACCCACTGCTGAGCAGG + Intronic
1170786169 20:19469479-19469501 GCCTGCCCACAGTGCTAAGCAGG + Intronic
1173579467 20:44137077-44137099 TGCTGGGCACAATGCTGAGCTGG - Intronic
1174770352 20:53293656-53293678 GCATGTACCCAGTGCTGTGCTGG + Intronic
1175234632 20:57501617-57501639 GGCTGTCCACAGTGCTCATAGGG - Intronic
1175571725 20:60028133-60028155 TGCTGAACAAGGTGCTGAGCAGG + Intronic
1175859305 20:62141937-62141959 AGGTGCTCACAGTGCTGAGCTGG - Intronic
1179906857 21:44427081-44427103 GGCCGTACACAGTGCAGGCCGGG + Exonic
1180796247 22:18607145-18607167 AGCTGGACACAGTGCCGAGCTGG + Exonic
1181225475 22:21388126-21388148 AGCTGGACACAGTGCCGAGCTGG - Exonic
1181253158 22:21546687-21546709 AGCTGGACACAGTGCCGAGCTGG + Exonic
1184354380 22:43969233-43969255 GGGTCTGCACAGTGCTGGGCTGG - Intronic
1184782824 22:46657652-46657674 GGCTGGACACAGGGCTGCTCTGG - Intronic
1185189395 22:49424802-49424824 GGCTCCACACAGCCCTGAGCGGG - Intronic
950263700 3:11560019-11560041 GGCTGTGCACAGGGCAGATCGGG - Intronic
953796060 3:45986781-45986803 AGCTGAACACAGGCCTGAGCAGG + Intronic
954318293 3:49813171-49813193 GGGTGGACACAGTGATCAGCAGG + Intronic
954425487 3:50440812-50440834 GGCAGTAGACAGAGCTGTGCAGG + Intronic
954456629 3:50603152-50603174 GGCTGGACACACAGCTGAGTGGG - Intergenic
957196323 3:77072703-77072725 GTATATACCCAGTGCTGAGCAGG + Intronic
959946070 3:112126579-112126601 GGCTTTACACAGTGGGGAGGCGG - Intronic
960158459 3:114322124-114322146 GCATGTACACAGTGCAGATCAGG - Intergenic
960518921 3:118632479-118632501 GGCTGTGAGCAGTGCTGTGCTGG - Intergenic
964848749 3:161071132-161071154 GGCTGTGAGCAGTGCTGAGATGG + Exonic
968448946 4:666195-666217 GGCTGTACACAGTGCTGAGCCGG - Intronic
969673047 4:8600273-8600295 GGCTGTAAAATGTGGTGAGCAGG + Intronic
982719843 4:158848178-158848200 GGCAATACCCAGTGCTGTGCTGG + Intronic
985621452 5:958314-958336 GGGTGTCCTCAGGGCTGAGCAGG - Intergenic
987246870 5:16058066-16058088 CACTGTACACAGTGTTGATCAGG + Intergenic
992998834 5:82359338-82359360 GGCTGTAGCCTTTGCTGAGCAGG + Intronic
994506604 5:100650345-100650367 GGCTAAACACAGTGGTGTGCTGG - Intergenic
998497577 5:142603975-142603997 GTCTGGAAACAGTGCTGAGTGGG + Intronic
1003937618 6:10991990-10992012 GTCTGTACACAGTGATGATTTGG + Intronic
1004321159 6:14632748-14632770 GGCAGGACACAGAGCTGAGGAGG + Intergenic
1005375839 6:25181354-25181376 GGCTGTACACTGTGCTGGGCGGG - Intergenic
1007382346 6:41498929-41498951 GGGTGTACACAGGGCAGAGCTGG - Intergenic
1007480761 6:42148352-42148374 AACAGTACAGAGTGCTGAGCTGG - Intergenic
1011749652 6:90442401-90442423 TTCTGTGCACAGTCCTGAGCTGG + Intergenic
1018002013 6:159587701-159587723 TGCTGTGCTCAGTGCGGAGCTGG - Intergenic
1018207033 6:161445729-161445751 GACTGCACAGAGTGATGAGCTGG + Intronic
1019287715 7:231893-231915 GGCGGTCCTCTGTGCTGAGCAGG + Intronic
1019438624 7:1035077-1035099 GACTGTGAACAGTGCTGGGCTGG + Intronic
1019438635 7:1035225-1035247 GACTGTGAACAGTGCTGGGCTGG + Intronic
1020877626 7:13717886-13717908 GATTGTACAAGGTGCTGAGCTGG + Intergenic
1021584430 7:22192980-22193002 GCATGTAGGCAGTGCTGAGCTGG - Intronic
1023637598 7:42228118-42228140 GGCTGCAGACAGCGCTGCGCGGG - Intronic
1024574997 7:50756028-50756050 CGCTGACCACAATGCTGAGCAGG - Intronic
1026287664 7:68977444-68977466 GGCTGGACAGAGTGCAGAGGGGG + Intergenic
1026805164 7:73424744-73424766 GGCTGCACAGAGTGCTGTGGGGG - Intergenic
1027863362 7:83614283-83614305 GGCTGTCCATAGTGCTGAACGGG - Intronic
1028839316 7:95410427-95410449 AGCTGTCCACAGTACAGAGCTGG + Intronic
1033599959 7:142882223-142882245 GGGTGGATACAGTGCTGTGCAGG + Intronic
1034979052 7:155464373-155464395 GGGTGTGCACACGGCTGAGCTGG + Exonic
1035911897 8:3576432-3576454 CGTGGTACACAGTGCTGAGGAGG - Intronic
1037889285 8:22614988-22615010 GGCTGTACCAAGTGGTGAGTGGG + Exonic
1038408519 8:27340728-27340750 GGCTGCAGGCAGGGCTGAGCTGG + Intronic
1038487094 8:27943676-27943698 GGCTGCAGACAGTGGTGTGCTGG - Intronic
1039429741 8:37516519-37516541 GTCTGTTCACATTGCTGAGCTGG + Intergenic
1039475530 8:37837597-37837619 GGCAGGGCACAGTGCTGGGCTGG - Intronic
1040864494 8:52034440-52034462 GGCAGTACACATTGCTCAGAAGG - Intergenic
1040898550 8:52393102-52393124 GGGTGGACAAAGTTCTGAGCAGG + Intronic
1044172424 8:89071733-89071755 GGCTGTAGAGAATGCTGTGCAGG + Intergenic
1047521577 8:125599145-125599167 TTCTGGACACAGCGCTGAGCTGG + Intergenic
1047760613 8:127951326-127951348 GGCTGTGGACACTGCTGTGCAGG - Intergenic
1048375414 8:133818636-133818658 TGCCCTATACAGTGCTGAGCTGG - Intergenic
1048610161 8:136013966-136013988 GGCCGTTCACAGTGCTTAGTAGG + Intergenic
1048722232 8:137339013-137339035 TGCTGTACCCAGTGCTGGGATGG + Intergenic
1048950790 8:139495334-139495356 GGCTGTGCACCTTGCTGAGCAGG - Intergenic
1049000238 8:139821316-139821338 GAATGTGCACAGTGCTGAGAAGG + Intronic
1049999043 9:1056739-1056761 GGATGGACTCAGTGCAGAGCAGG + Exonic
1050451513 9:5786533-5786555 GCCTGGACCCTGTGCTGAGCTGG - Exonic
1052437017 9:28443354-28443376 GGCTGCACACTCTGTTGAGCTGG + Intronic
1056806514 9:89733149-89733171 GGCTCTACACAGAGCAGAGGAGG + Intergenic
1057743176 9:97730234-97730256 GGCTACAGACTGTGCTGAGCTGG + Intergenic
1059257054 9:112940441-112940463 GGCTCTGCAGAGTGCTGTGCTGG + Intergenic
1060244270 9:121930960-121930982 GGCTGTACACAGTGAGGAGATGG + Intronic
1061740029 9:132695837-132695859 TGCTGTTCACACTGCTGATCTGG + Intergenic
1062102072 9:134733607-134733629 GGTTTTCCACAATGCTGAGCAGG - Intronic
1062323022 9:135999567-135999589 GGCTGCTCAGATTGCTGAGCAGG - Intergenic
1185696734 X:2200597-2200619 GGCTCTGCCCAGTGCTGAGTTGG - Intergenic
1187959819 X:24557911-24557933 GACTGTGCACCGTGCAGAGCAGG - Intergenic
1188210727 X:27419988-27420010 GGCTACACCCAGTGCTGTGCTGG + Intergenic
1188388544 X:29591585-29591607 GTCTCTCCACAGGGCTGAGCAGG + Intronic
1189382822 X:40513877-40513899 GGCTGTACATTTTTCTGAGCAGG - Intergenic
1189854328 X:45208876-45208898 GGCAAGACCCAGTGCTGAGCTGG - Intergenic
1190148125 X:47917095-47917117 GGCAGAACACAGTGCAGAACAGG + Exonic
1192157730 X:68758962-68758984 GGCTGACCACAGAACTGAGCTGG - Intergenic
1192172787 X:68867338-68867360 GGTGGTTCACAGTGCTGATCGGG + Intergenic
1193985013 X:88229437-88229459 GGCAAAACCCAGTGCTGAGCTGG + Intergenic
1196495452 X:116318735-116318757 GGCGAGACCCAGTGCTGAGCTGG + Intergenic
1198102056 X:133430614-133430636 GGCAGTACACAGTGCACAGAGGG - Intergenic
1199861238 X:151801776-151801798 GGCTGCACACTGTGTGGAGCTGG - Intergenic
1202016979 Y:20419937-20419959 GGCTGAACACAGTGCTGTCCTGG - Intergenic