ID: 968450918

View in Genome Browser
Species Human (GRCh38)
Location 4:675554-675576
Sequence ACCCCAGAGCAAGCCAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 309}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968450918_968450927 11 Left 968450918 4:675554-675576 CCTCTCCTGGCTTGCTCTGGGGT 0: 1
1: 1
2: 2
3: 32
4: 309
Right 968450927 4:675588-675610 GCCTCTCTGGCTGAGAAACTAGG 0: 1
1: 0
2: 0
3: 19
4: 160
968450918_968450929 21 Left 968450918 4:675554-675576 CCTCTCCTGGCTTGCTCTGGGGT 0: 1
1: 1
2: 2
3: 32
4: 309
Right 968450929 4:675598-675620 CTGAGAAACTAGGAAGTCACTGG 0: 1
1: 0
2: 2
3: 26
4: 259
968450918_968450924 -2 Left 968450918 4:675554-675576 CCTCTCCTGGCTTGCTCTGGGGT 0: 1
1: 1
2: 2
3: 32
4: 309
Right 968450924 4:675575-675597 GTCCAGGGCCTGGGCCTCTCTGG 0: 1
1: 0
2: 2
3: 37
4: 398
968450918_968450930 22 Left 968450918 4:675554-675576 CCTCTCCTGGCTTGCTCTGGGGT 0: 1
1: 1
2: 2
3: 32
4: 309
Right 968450930 4:675599-675621 TGAGAAACTAGGAAGTCACTGGG 0: 1
1: 0
2: 1
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968450918 Original CRISPR ACCCCAGAGCAAGCCAGGAG AGG (reversed) Intronic
900249682 1:1661289-1661311 ACCCCAGAGCCCACGAGGAGGGG + Intronic
900260719 1:1727196-1727218 ACCCCAGAGCCCACGAGGAGGGG + Intronic
900921908 1:5678086-5678108 AGCCCAGAGGAAGTCAGGATGGG + Intergenic
901059892 1:6467182-6467204 AACCCAGCCCAAGCCAGGGGTGG + Exonic
901703629 1:11058704-11058726 ACCCCCGAGCAAGGCAGGTAGGG - Intronic
901735424 1:11309317-11309339 ACACAAGATCAAGCCAGGAAGGG + Intergenic
902043176 1:13506969-13506991 GCCCCAGGGGAACCCAGGAGGGG - Intronic
902222616 1:14976604-14976626 GCCCCAGAGGAGGCCGGGAGGGG + Intronic
902336447 1:15757611-15757633 GCCCCAGAGCCACCCTGGAGGGG + Intronic
903229154 1:21911444-21911466 GCCCCAGAGCAGGCAGGGAGTGG + Intronic
903626079 1:24731106-24731128 CCCCCAGAGCATGCAAGGGGTGG - Intergenic
903682524 1:25106776-25106798 ACCCCAGGGCAAGCTAGGGGTGG + Intergenic
903692445 1:25184011-25184033 ACTCCAGAACCAGCCAGCAGAGG + Intergenic
903745160 1:25581821-25581843 CCCCCAGAGCCAGGCAGGAGGGG + Intergenic
904585712 1:31579524-31579546 AGCCCAGCCCAAGCCAGGAGGGG - Intronic
904657496 1:32060231-32060253 AACACAGAGAAACCCAGGAGAGG + Intronic
905054229 1:35079345-35079367 ACCGCAGAGCACGACGGGAGAGG + Intronic
905366291 1:37453428-37453450 AAGCCAGAGCCAGCCAGAAGTGG + Intergenic
905382006 1:37569242-37569264 AGCCCAGAACAATCCAGGGGAGG - Exonic
905410515 1:37765142-37765164 ACCCCAGAGCCAGCGGGGGGCGG + Intergenic
905838537 1:41152273-41152295 ACCCCAGAGCAACACAGCGGTGG - Intronic
905897563 1:41558571-41558593 CCCCAAGAGCAGGCCAGGAGGGG - Intronic
906251305 1:44312881-44312903 ACCCCAGAGTCAGCCAGCATAGG + Intronic
906312430 1:44763398-44763420 ACCCCTGAGCACTCCAGGAAGGG - Intronic
906517587 1:46448657-46448679 TCCCCCGAGCAGGCGAGGAGAGG + Intergenic
906606291 1:47174748-47174770 CCCCCAGCCCAAGCCAGGACAGG + Intergenic
906798813 1:48718657-48718679 ACCTCAGAGCACTCCAGGTGGGG - Intronic
907434890 1:54439182-54439204 AACCCAGACCTAGCCAGGACTGG - Intergenic
908480653 1:64535798-64535820 GGCCCAGAGGAAGCCAGGGGAGG - Intronic
912302443 1:108532043-108532065 AACCCCTAGCAAGGCAGGAGGGG + Intergenic
912585601 1:110762191-110762213 ACCCCAAAGCCGGCCAGGTGTGG + Intergenic
913659602 1:120994553-120994575 ACCCCAGAGCATCCAGGGAGAGG + Intergenic
914010963 1:143777677-143777699 ACCCCAGAGCATCCAGGGAGAGG + Intergenic
914166868 1:145183435-145183457 ACCCCAGAGCATCCAGGGAGAGG - Intergenic
914649584 1:149686337-149686359 ACCCCAGAGCATCCAGGGAGAGG + Intergenic
914671854 1:149876829-149876851 ACCCAAGAGGAGGCCAGGCGCGG + Intronic
915277911 1:154802366-154802388 ACTCCAGAGCCAGGAAGGAGGGG + Intronic
915395313 1:155579015-155579037 ACCCAAGAGGAGGCCAGGTGTGG + Intergenic
915996929 1:160572955-160572977 GCCCCAGCCCAATCCAGGAGGGG - Intronic
916470523 1:165118487-165118509 CCCCCACAGCATGCCAGGAAGGG + Intergenic
916900323 1:169215269-169215291 ACCCCAGACTCAGCCAGTAGAGG - Intronic
917437000 1:175031941-175031963 GCCCCAGGGCAAGGCATGAGAGG - Intergenic
920315005 1:205070704-205070726 ACCCCATGGCAGGCCAGGCGCGG + Intronic
920907489 1:210185453-210185475 ACCCAAGATAAAGCTAGGAGGGG - Intergenic
921255587 1:213336293-213336315 ATCCCAGAGCTAGACAGTAGTGG + Intergenic
923255460 1:232217910-232217932 CCCCCAGAGCAAGTAAGAAGAGG - Intergenic
923944299 1:238865147-238865169 ACCCCAGACTCAGCCAGCAGAGG - Intergenic
924588744 1:245382856-245382878 AAACCAGTGCTAGCCAGGAGTGG - Intronic
1062922655 10:1291824-1291846 GGCCTAGAGAAAGCCAGGAGAGG + Intronic
1065650248 10:27881355-27881377 AACCCAAAGAAGGCCAGGAGTGG + Intronic
1067191136 10:44069144-44069166 ATCCCAGAGCAAGACAGCAGAGG - Intergenic
1067444327 10:46331128-46331150 GCTCCTGAGCAAGTCAGGAGAGG + Intergenic
1067833133 10:49621680-49621702 GCCACAGAGCAGGCCAGAAGGGG - Intronic
1067935882 10:50611810-50611832 ACTCCTGAGGAAACCAGGAGGGG - Intronic
1069822256 10:71235255-71235277 ACCACAGAGAAAGACAGGAGGGG + Intronic
1070157156 10:73842352-73842374 AGCCCAGCTCCAGCCAGGAGGGG + Intronic
1070920570 10:80183043-80183065 TCCCCAGCCCATGCCAGGAGGGG - Intronic
1073469953 10:103716242-103716264 ACCCCAGGGCAGGCCAAAAGGGG - Intronic
1075696546 10:124440128-124440150 ACCACAGTGCAGGCCAGGTGTGG + Intergenic
1075862522 10:125689364-125689386 ACCCAAGAGGAGGCCAGAAGGGG + Intergenic
1075871502 10:125774840-125774862 ACCGCAGAGAAAGCCATGGGAGG + Intronic
1076993371 11:287277-287299 CTGCCAGAGCAAGCCAGGCGGGG + Intergenic
1078062857 11:8059679-8059701 ACAGCAGAGCAAGGCAGGAGAGG + Intronic
1078222518 11:9363779-9363801 ACCCAGGAGGAACCCAGGAGGGG + Intergenic
1078469133 11:11573083-11573105 AACCCAGGGCCAGCAAGGAGTGG + Intronic
1079922538 11:26450484-26450506 ACCACAGAGCAAGCCATGTATGG + Intronic
1080260691 11:30346765-30346787 AGCCCAATGCAGGCCAGGAGTGG + Intergenic
1080282279 11:30570879-30570901 AGCCCACAGCAAGACAGGAAAGG + Intronic
1080753904 11:35176951-35176973 AACCCAGAGGAAGCCATTAGGGG + Intronic
1081965290 11:47165590-47165612 ACCCCACAGCAAGACTGGGGAGG + Intronic
1082626385 11:55491834-55491856 ACCCCATAGGAAAGCAGGAGAGG - Intergenic
1083281943 11:61632362-61632384 ACCCCAGAGCCCGGCAGGAGAGG + Intergenic
1083572888 11:63769357-63769379 TCCCCCGAGCCAGCCAGGGGTGG + Intergenic
1083727434 11:64635990-64636012 AGTCCTGGGCAAGCCAGGAGAGG - Intronic
1083951804 11:65960694-65960716 ACCCCAGTGCAGGCCGGGCGCGG - Intergenic
1084116453 11:67045479-67045501 TCCCCAGAGCATCCTAGGAGGGG + Intronic
1084140365 11:67224062-67224084 TCCCCATGGCAAGGCAGGAGAGG - Intronic
1084576190 11:69989469-69989491 ATTCCAGAACCAGCCAGGAGAGG + Intergenic
1084732453 11:71082174-71082196 TCCACAGTGCCAGCCAGGAGTGG - Intronic
1084962206 11:72722763-72722785 AGGCCAGAGCAAGCTGGGAGGGG + Intronic
1085035939 11:73300076-73300098 ACCCCACACCCAGCCAGGTGTGG + Intergenic
1085045919 11:73353277-73353299 ACGTCAGTGCCAGCCAGGAGCGG - Intronic
1085400111 11:76230749-76230771 TGCCCAGTGCAAGTCAGGAGTGG - Intergenic
1087013524 11:93534928-93534950 TTCCCATAGCAAGCCAGGAGAGG + Intronic
1089009028 11:115118076-115118098 ACCCCAGAGCCTCCCAGGAAAGG + Intergenic
1089197481 11:116702926-116702948 ACTCCAGGGCAATGCAGGAGGGG - Intergenic
1090245175 11:125211103-125211125 ACTCCAGTGCAAGGAAGGAGAGG - Intronic
1090436390 11:126690146-126690168 ACTACAGATAAAGCCAGGAGAGG - Intronic
1091803443 12:3339703-3339725 AACCCAGGGCAAGGCAGGAAGGG + Intergenic
1091803464 12:3339787-3339809 AACCCAGGGCAAGGCAGGAAGGG + Intergenic
1091839395 12:3608816-3608838 TCCCCAGAGGAAGGGAGGAGAGG + Intronic
1095741517 12:45611495-45611517 ACCACAGAGCAAGCCAGAGGAGG - Intergenic
1096368456 12:51048212-51048234 GCTCCAGCACAAGCCAGGAGAGG - Intronic
1096789141 12:54034244-54034266 ACCCCACCCCAAGCCAGGAAGGG - Intronic
1098891943 12:76018128-76018150 ACCACAGGGCAGGCCAGGAGCGG - Intergenic
1099730042 12:86489114-86489136 ACCCCAGACTCAGCCAGCAGAGG + Intronic
1101883450 12:108641573-108641595 ACCCCTGGTCCAGCCAGGAGAGG - Intergenic
1101889876 12:108703743-108703765 TCCCCAGCAGAAGCCAGGAGAGG + Intronic
1102050852 12:109861033-109861055 ACCCCAGAGCAGGCTAGAGGTGG + Intronic
1104896885 12:132169032-132169054 ACGCCAGGGCCAGCCGGGAGGGG - Intergenic
1106242346 13:27921665-27921687 ACCCCAGGCGCAGCCAGGAGGGG + Intronic
1106488135 13:30190715-30190737 AAGCCAGAGCAGGCCAGGGGTGG + Intergenic
1108169347 13:47725236-47725258 ACACCAGAGGTAGCCAGGAGGGG + Intergenic
1110357868 13:74589251-74589273 ACACCAGAGGAGCCCAGGAGTGG - Intergenic
1111400870 13:87733196-87733218 AACCCAATGGAAGCCAGGAGAGG + Intergenic
1112079919 13:95958758-95958780 ACCCGAAAGCAAGAAAGGAGAGG + Intronic
1117968107 14:61226409-61226431 GCCCCAGAGAAAGTCAAGAGAGG + Intronic
1118734463 14:68691600-68691622 AGCCCACAGCACCCCAGGAGGGG - Intronic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1123710994 15:22987604-22987626 ACCCCAGAGGGGGCCAGGCGCGG + Intronic
1124423155 15:29539640-29539662 AACCCAGAACAAGGCAGGATTGG - Intronic
1124594534 15:31081980-31082002 GCCCCAGAGCCTGGCAGGAGGGG - Intronic
1127282872 15:57506598-57506620 TCCCCAGAGCCAGCCAGGGAAGG - Intronic
1127474432 15:59319611-59319633 ACCCCAGAGACAGCCAGGCACGG + Intronic
1128249406 15:66153935-66153957 AACCCAGAGCCAGCCAGTGGGGG - Intronic
1129419778 15:75415439-75415461 ACCCAAGAGAAAGCCTGAAGGGG + Intronic
1129602793 15:77010013-77010035 ACCCTGTAGCCAGCCAGGAGGGG - Intronic
1130003335 15:80067220-80067242 ACTCCATAGGAAGGCAGGAGGGG - Intronic
1130103129 15:80909087-80909109 ATCCCAGAGCAAACTAGGAGAGG - Exonic
1131629036 15:94156677-94156699 ACCCCAGAGAAATCCAGGGAAGG - Intergenic
1133567147 16:7006603-7006625 ACCCGAAACCAAGCCAGGTGTGG - Intronic
1137915412 16:52424624-52424646 CCCCAAAAGCCAGCCAGGAGTGG - Intergenic
1138563549 16:57816351-57816373 CCTCAAGAGGAAGCCAGGAGGGG - Intronic
1139607513 16:68030301-68030323 ACCCCACCGGAGGCCAGGAGTGG + Intronic
1139806732 16:69572050-69572072 ACCCAAGCGCAGGCCAGGTGCGG - Intronic
1142195948 16:88739376-88739398 ACACCAGGGAAAGCCAGGTGTGG + Intronic
1144753849 17:17667933-17667955 CCCCAGGAGCAAGCCAGGAAGGG + Intergenic
1145798022 17:27667169-27667191 CCCCCAGAGCATTCAAGGAGAGG - Intergenic
1147261425 17:39211574-39211596 ACCCAAGAGCTGGCCAGGTGTGG - Exonic
1148146181 17:45366478-45366500 CACCCAGAGCAGGCCAGGGGTGG - Intergenic
1148168797 17:45502515-45502537 AACCCAAAACAAGCCAGGCGTGG + Intergenic
1148280022 17:46340504-46340526 AACCCAAAACAAGCCAGGCGCGG - Intronic
1148302239 17:46558348-46558370 AACCCAAAACAAGCCAGGCGCGG - Intronic
1148667770 17:49387605-49387627 ACACCACAGCAAGCCAGGAGGGG - Intronic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1149095611 17:52837112-52837134 ACTCCAGACCAAAGCAGGAGTGG - Intergenic
1149476794 17:56967722-56967744 ACCCTAGAGTAGGCCAGGTGCGG - Intergenic
1149668145 17:58380886-58380908 GCCCCAGGGCAAGCCAGTTGTGG - Intronic
1149893331 17:60409470-60409492 ACCCCAGAGCAAGCAATCAGAGG + Intronic
1149894978 17:60422299-60422321 AGCGCACAGCAGGCCAGGAGAGG - Intronic
1150399990 17:64848969-64848991 AACCCAAAACAAGCCAGGCGTGG + Intergenic
1151035366 17:70792622-70792644 GACCCAGAGCAGGCCAGGTGCGG - Intergenic
1151246158 17:72796524-72796546 AGCCCAGGGCATGCCAGGTGAGG + Intronic
1151884169 17:76913688-76913710 AGCCAAGAGCAAGCCAGATGTGG + Intronic
1152012182 17:77725387-77725409 ACACGAGGGTAAGCCAGGAGCGG - Intergenic
1152436285 17:80278328-80278350 ACCCCAGGGCCAGCCAGGCCAGG - Intronic
1152724723 17:81939561-81939583 CCCCCAGAGCACGCTAGGAGGGG + Intronic
1153894331 18:9544806-9544828 ACCCCAGATCAAGCCAGGCCGGG + Intergenic
1154209215 18:12365121-12365143 GCCCCAGAGCAATCCCAGAGGGG + Intronic
1155174436 18:23290272-23290294 ATCCCAGAGCCAGCCAGCAAGGG + Intronic
1155264328 18:24076268-24076290 ACCACAGAGCAGGCCGGGCGCGG - Intronic
1155416835 18:25607265-25607287 ACCTCAGAAAAAGCTAGGAGTGG - Intergenic
1156295511 18:35786022-35786044 ACCCCAGAACCAGCCTGAAGAGG + Intergenic
1156718042 18:40036130-40036152 ACCCCATAGGAAGCCAGTGGGGG - Intergenic
1157453894 18:47809339-47809361 AGGCCAGAGCAAGCAAGGTGAGG + Exonic
1160243004 18:77136465-77136487 ACCCCAGAGGGAGCCAGGAAAGG + Intergenic
1160348063 18:78151348-78151370 ACGCCAGAGCTTGCCAAGAGAGG + Intergenic
1161938979 19:7390749-7390771 ATCACAGACCAAGCCAGGTGTGG + Intronic
1161984295 19:7645299-7645321 ACCCCGGGGTACGCCAGGAGCGG + Exonic
1162003982 19:7765422-7765444 ACTCTAGAGCAGGACAGGAGAGG + Intronic
1162060307 19:8090772-8090794 ACCCCAGGGCAGGCCAGGGGCGG - Intronic
1163699104 19:18778198-18778220 ACCACAGTGCAGGACAGGAGGGG - Exonic
1163717357 19:18879930-18879952 AATACAGAGCAAGCCAGGGGTGG - Intronic
1163842321 19:19618867-19618889 AACCCAGTCCAAGCCCGGAGAGG - Exonic
1165385936 19:35510746-35510768 ACCCCCGAGGAAGCCAGATGTGG + Intronic
1165424785 19:35739816-35739838 TCCGCAGACCAAGCCAGGATAGG + Exonic
1165449494 19:35873945-35873967 ACTCCAGAGCCAGCCCTGAGAGG - Intronic
1165747831 19:38240802-38240824 ACCCCAGTGGACGCCTGGAGGGG + Intergenic
1166748005 19:45151107-45151129 AAGCCACAGCCAGCCAGGAGGGG - Exonic
1167101922 19:47409006-47409028 ACCCCAGAGAAACCCAGAAGTGG - Intronic
925020966 2:567561-567583 ACCCAAGAGCGAGAGAGGAGAGG + Intergenic
925234625 2:2267057-2267079 GAACCAGAGCAAGCCAGGTGGGG + Intronic
926569962 2:14518879-14518901 ACCCTAGAGAAGGACAGGAGGGG + Intergenic
927060773 2:19417180-19417202 ACCCCAGTGTAAGCCTTGAGAGG + Intergenic
927217581 2:20676774-20676796 ACAGCAGAGCAACCCAGGATGGG + Intergenic
927775379 2:25898897-25898919 ACCCGAGAGCAAGCAATGTGTGG + Intergenic
928720900 2:34119672-34119694 ACCCCAGAGAAGGGAAGGAGAGG + Intergenic
931253245 2:60551304-60551326 ACCTCAGACCAAGCCAGGCCTGG + Intronic
932476742 2:72011219-72011241 ACCCCTGGGCCAGCCCGGAGAGG - Intergenic
933195947 2:79390112-79390134 ACCCAAGAGAAAGCCTGGTGGGG + Intronic
933722525 2:85407420-85407442 ACCCCAGTGCCAGCCAGGCATGG + Intronic
936846547 2:116841936-116841958 ACCCCAGAGTCAGTCAGTAGAGG + Intergenic
937078610 2:119124890-119124912 ACCCCAGGGCACCTCAGGAGAGG - Intergenic
937364901 2:121254492-121254514 ATCCCAAAGCCAGCCAGGTGTGG + Intronic
937908519 2:127064354-127064376 ACCCCAGACCCAGCCAAGTGGGG + Intronic
937913449 2:127087473-127087495 ACCCCAGAGGAAGCCAGGGTGGG + Intronic
938109169 2:128552677-128552699 ACCCCCCAGCAACCAAGGAGGGG - Intergenic
941978647 2:171432101-171432123 ACCTGCGTGCAAGCCAGGAGTGG + Intronic
942937510 2:181575640-181575662 ACCCCTGAGCAAAACAGCAGGGG + Intronic
944299684 2:198109155-198109177 ATCCAAGATCAAGGCAGGAGTGG + Intronic
945341732 2:208664216-208664238 ACCCCACACCAGGACAGGAGGGG + Intronic
946038758 2:216765972-216765994 ACCCCAGAGCCAGCCAGGAGTGG - Intergenic
947472011 2:230409349-230409371 ACACCAGAGAGAGCCAGAAGTGG - Intergenic
948586112 2:239020769-239020791 GCCCCAGAGGGAGGCAGGAGGGG - Intergenic
948727900 2:239945982-239946004 CCCCCAGACCAGGACAGGAGAGG + Intronic
948788044 2:240363272-240363294 TCCCAAAAGCCAGCCAGGAGTGG + Intergenic
948789972 2:240372153-240372175 ACCCCAGAGGAGCCCAGAAGTGG + Intergenic
1169257905 20:4112587-4112609 TCCCGTGAGCAAGCCAGGAATGG - Intergenic
1169878434 20:10322468-10322490 TCCCCAGGCTAAGCCAGGAGTGG - Intergenic
1170149567 20:13215636-13215658 TCCCCAGAACAAGGCTGGAGCGG - Intergenic
1172444050 20:34984063-34984085 GCCACACAGCAAGTCAGGAGCGG - Intronic
1172616072 20:36285706-36285728 ATCCAAGAGCAAGCCAGTGGTGG - Intergenic
1172961634 20:38804684-38804706 ACCCCAGGGCCAGCCAGCTGGGG - Intergenic
1173199444 20:40943870-40943892 AGCCGAGAGGAAGCCAGGAATGG - Intergenic
1175133369 20:56806038-56806060 CTCCCAGAGCAAGCCAGGCAAGG - Intergenic
1175518757 20:59586136-59586158 ACCACAGAGCAGGCCAGGGCAGG - Intronic
1175974192 20:62702182-62702204 ACACCAGAGCTGGACAGGAGGGG + Intergenic
1176040044 20:63060547-63060569 GCCCCAGGGCCAGCCAGGAGGGG - Intergenic
1176163626 20:63661515-63661537 TCCCCACAGGAGGCCAGGAGAGG - Intronic
1177184799 21:17781447-17781469 ACCACAGAAACAGCCAGGAGAGG - Intergenic
1180150391 21:45944216-45944238 AGCCCAGAGCAGGTGAGGAGGGG + Intergenic
1180945441 22:19689810-19689832 ACCCCAGAGAGAGCCCTGAGTGG - Intergenic
1181559596 22:23692437-23692459 AGCCCAGTCCAGGCCAGGAGAGG - Exonic
1181689408 22:24550118-24550140 AGCCCACAGCCAGCCAGCAGTGG - Intronic
1183395290 22:37568016-37568038 GCCACACAGCAAGCCAGGACTGG + Intronic
1184464359 22:44660163-44660185 ACCCCAGATCAGGCCGGGCGCGG - Intergenic
1185226806 22:49658013-49658035 ACTCCAGAGAAAGCCAGGAGAGG - Intergenic
1185375363 22:50480586-50480608 TGCCCAGGGCAAGTCAGGAGAGG + Intergenic
949547038 3:5081317-5081339 ACCCGAGAGCAAGCCAGGCAGGG - Intergenic
950339230 3:12227847-12227869 ACCACAGATGAAGCCCGGAGAGG + Intergenic
950414989 3:12864032-12864054 AGGCCAGTGGAAGCCAGGAGTGG - Intronic
951708456 3:25566926-25566948 TCCCCACAGTAAGCCAGGTGAGG - Intronic
953136372 3:40185764-40185786 ACCCTAGAGCCAGCCCTGAGTGG + Intronic
953365329 3:42339769-42339791 ACCTCAGCATAAGCCAGGAGTGG - Intergenic
955863238 3:63354986-63355008 GTCCCAGAGCAGGCCAGGAATGG + Intronic
955872282 3:63451748-63451770 AACCCAGAGCAGGCAAAGAGAGG - Intronic
956591980 3:70924772-70924794 GCCCCAGAGCAAGCAGGAAGTGG - Intergenic
960551014 3:118976510-118976532 ACCCCAGATCATGGCAGCAGTGG - Intronic
960687095 3:120306057-120306079 AGCCCAAAGCAGGCCAGGCGCGG + Intergenic
962201634 3:133404948-133404970 AGCACAGAGCAAGGCTGGAGAGG - Intronic
966191783 3:177278010-177278032 AACCCAGAGATAGCCAGGCGTGG - Intergenic
968450918 4:675554-675576 ACCCCAGAGCAAGCCAGGAGAGG - Intronic
968594966 4:1477502-1477524 CAGCCAGAGCCAGCCAGGAGAGG - Intergenic
968622646 4:1610720-1610742 ACCCCAGGCCAAGGCTGGAGGGG + Intergenic
968748202 4:2372051-2372073 AGCCCAGTGGAAGCCTGGAGGGG + Intronic
968943946 4:3653868-3653890 ACCCCACAGCCAGCGAGGGGAGG - Intergenic
968961509 4:3747243-3747265 ACTCCAGAGCCAGCACGGAGGGG + Intergenic
969461471 4:7331354-7331376 ACCCTACAGCAAGGCAGAAGTGG + Intronic
970261665 4:14231200-14231222 ACCCCTGAGTGAGCCAGAAGTGG - Intergenic
972473873 4:39432648-39432670 AGCCCAGGGCAAGCCAGGCATGG + Intronic
972818051 4:42666545-42666567 AACCCAGAGGAAGCCAAAAGGGG - Intergenic
975736421 4:77385641-77385663 ATCCCTGAGAAAGCCTGGAGAGG + Intronic
976148763 4:82071382-82071404 TCCTGAGAGCAAGCCTGGAGAGG + Intergenic
977153987 4:93550232-93550254 ACCTCAGAAAAAGCCAGGTGTGG - Intronic
977236199 4:94510213-94510235 ACTCCAGAGAAAACTAGGAGTGG - Intronic
978514528 4:109557187-109557209 ACCAGAGAGCCAGCCAGGCGTGG - Intergenic
979129947 4:117031221-117031243 ACCCCAGAGCAGTGCAGGAGAGG - Intergenic
983810801 4:172059271-172059293 TCCCAGAAGCAAGCCAGGAGAGG - Intronic
983882968 4:172953542-172953564 ACCCCAGGGCATGGTAGGAGAGG + Intronic
984935831 4:184888777-184888799 ACCCCAGAGGCAGCCAGGAAGGG + Intergenic
985669704 5:1201082-1201104 AGCCCAGAGCCAGGCTGGAGGGG + Intergenic
986337982 5:6769075-6769097 GACACAGAGCAAGCCAGCAGGGG + Intergenic
987428098 5:17796363-17796385 AGCCCACAGCCAGCCAGGACTGG + Intergenic
988891793 5:35625493-35625515 ACCCCAGAGGGAGGCAGGAAGGG + Intronic
989323120 5:40159930-40159952 ACCCCAAAGCAGGCCAGGTGCGG - Intergenic
992089599 5:73305133-73305155 ACCCCTTAGGAAGCCTGGAGTGG + Intergenic
992433529 5:76732855-76732877 TTCCCAGAGTACGCCAGGAGAGG - Exonic
992640478 5:78764485-78764507 CCCCCAAAGCAAGCAAAGAGGGG - Intronic
993120354 5:83766632-83766654 ATCCCAGAGCATCCCAGGGGTGG - Intergenic
995261365 5:110107960-110107982 ACCTCAGAGCAGGCTGGGAGCGG + Intergenic
996862466 5:128082939-128082961 AGCCCAGAGCAAACCAGGCTGGG + Intergenic
1000310182 5:160035541-160035563 GCCCCACAGCAAGTGAGGAGCGG - Intronic
1000670770 5:164060364-164060386 ATCCCAGAGAAAGCCAGAATGGG + Intergenic
1001642549 5:173254884-173254906 ACCCCACAGCAAGCCTCCAGAGG - Intergenic
1003597042 6:7482774-7482796 ATCCCACTGCAAGCCAGGTGCGG + Intergenic
1003823330 6:9924860-9924882 AAGGCAGAGCAGGCCAGGAGGGG + Intronic
1004443055 6:15672091-15672113 CCACCAGAGCAAGGCAAGAGTGG + Intergenic
1005667991 6:28077434-28077456 ACCCCAGGGGAAGCCAGGGCTGG - Intergenic
1006805741 6:36787917-36787939 ACTCCAGAGCAAGGCAGGTCTGG + Intronic
1007110101 6:39308632-39308654 ACCAATGAGCAAGCCAGGAATGG + Intronic
1007616256 6:43181295-43181317 ACCCCAGAGCCACCGAGGAAGGG - Exonic
1008546780 6:52590221-52590243 TCCCCAGGGCATGCCAGGAAAGG - Intergenic
1010632640 6:78216809-78216831 GAACCAGACCAAGCCAGGAGTGG - Intergenic
1011294477 6:85811212-85811234 ACCCCAGACCCAGCCAGCAGAGG - Intergenic
1012665751 6:101966686-101966708 AGCTCAGAGCAAGTGAGGAGGGG - Intronic
1012990699 6:105922848-105922870 GCCCCAGACCAAACCAGGACTGG + Intergenic
1013046181 6:106488325-106488347 GCCTGAGAGCAAGCCTGGAGGGG - Intergenic
1014421997 6:121257810-121257832 ACCCCAGAGCCAACCAGAAGGGG - Intronic
1015251813 6:131135461-131135483 ACGCCGGAACAAGCCAGAAGGGG - Intergenic
1015581503 6:134730218-134730240 ACTCCAGAGCCAGGCAGGAGGGG + Intergenic
1016903160 6:149121753-149121775 ACACCAGAAAAAGCCAAGAGGGG + Intergenic
1017344808 6:153368560-153368582 AGCCTGGAGCAAGGCAGGAGAGG - Intergenic
1018280807 6:162183504-162183526 TCCCCATACCAAGACAGGAGGGG - Intronic
1018640192 6:165898067-165898089 TCCCCAGCGCAAGGTAGGAGGGG - Intronic
1018788224 6:167125462-167125484 ACCACAGAGCCAGCCAGTATTGG + Intronic
1018945832 6:168346152-168346174 CCCCCAGAGCCAGGCCGGAGAGG + Intergenic
1018957190 6:168418163-168418185 AGCTCACAGGAAGCCAGGAGCGG - Intergenic
1019254556 7:40984-41006 ACCTCAGAGGATGCCAGGTGGGG + Intergenic
1019304559 7:327020-327042 AACACAGAGCAACTCAGGAGTGG + Intergenic
1019489112 7:1302943-1302965 GCCCCAGACCAAGGCCGGAGTGG + Intergenic
1020175063 7:5875596-5875618 ACCAGAGACCAGGCCAGGAGTGG - Intergenic
1021231482 7:18090676-18090698 ACTCCAGAGGCAGCCAGTAGTGG + Intronic
1021520359 7:21533998-21534020 ACCCAAGAGTCAGTCAGGAGTGG + Intergenic
1021917961 7:25454701-25454723 AACCGAGAGAAACCCAGGAGAGG - Intergenic
1023267705 7:38425290-38425312 AGCCCACAGCAGCCCAGGAGAGG + Intronic
1024010108 7:45259793-45259815 ACACCAGCGCAAGATAGGAGGGG + Intergenic
1024010130 7:45259882-45259904 GCCACAGAGCAAGGTAGGAGGGG + Intergenic
1024473573 7:49788151-49788173 ACCACAGCCCGAGCCAGGAGTGG - Intronic
1024488045 7:49942960-49942982 AACCCAGAACAATCCAGAAGAGG - Intronic
1026020434 7:66700916-66700938 ACCCCAGAGCAAACCCAGGGAGG - Intronic
1026879851 7:73901443-73901465 ACCCCAGAGCAAACCCAGGGAGG + Intergenic
1026933203 7:74236586-74236608 AGCCCCCAGCTAGCCAGGAGAGG - Intronic
1028502438 7:91534067-91534089 AATCCAGAGCAAACAAGGAGGGG - Intergenic
1029386896 7:100249137-100249159 ACCCCACCCCAGGCCAGGAGCGG - Intronic
1029536430 7:101160307-101160329 GCCCCAGAGCCAGCCAACAGTGG - Intronic
1032485551 7:132284632-132284654 AGGCCAGAGCCAACCAGGAGTGG + Intronic
1034393090 7:150800952-150800974 ACTGCAGAGGAAGCCAGGTGCGG + Exonic
1036137594 8:6176077-6176099 ACCCCTGAACAAGCCATGGGGGG + Intergenic
1037269855 8:17114827-17114849 ACCCCAGAGGAGGCCGGGCGCGG + Intronic
1037363396 8:18097430-18097452 ACCCCAGACTCAGCCAGCAGAGG + Intergenic
1037670522 8:21011576-21011598 ACCCCACAGCAAGACAGGGAGGG - Intergenic
1038216011 8:25562281-25562303 ACCCCAGACCTAGTCAGTAGAGG - Intergenic
1038263056 8:26014625-26014647 CACCCAAAGCAAGCAAGGAGAGG + Intronic
1041179887 8:55236411-55236433 ACTCCAGTGCAATCCAGGTGAGG + Intronic
1041195924 8:55401300-55401322 ATCCCAGAGCACACAAGGAGTGG + Intronic
1045648464 8:104321723-104321745 ACCACAGAAAAAGCCAGTAGAGG - Intergenic
1046074071 8:109296176-109296198 ACTCCAGATCAAAACAGGAGTGG + Intronic
1046140515 8:110084114-110084136 TCCCAAGGGCAAGCCAGGTGTGG - Intergenic
1048962651 8:139593487-139593509 AGCCAACAGGAAGCCAGGAGTGG - Intergenic
1049423280 8:142526189-142526211 ACCCCAGGGAGAGCCAGGATTGG + Intronic
1049647777 8:143743565-143743587 TCCACTGAGCAAGCGAGGAGGGG - Intergenic
1049688548 8:143949013-143949035 GCCGCAGAGAGAGCCAGGAGGGG + Intronic
1049978065 9:878558-878580 ACCTCAGAGAAGGCCAGGAGTGG + Intronic
1049982866 9:920790-920812 GACCCTGAGCAAGCCAGGTGGGG + Intronic
1050095665 9:2063075-2063097 ACCCAAGAGCATGCAAGGAAGGG - Intronic
1050743107 9:8845408-8845430 TCGCCAGAGCTAGCCAGGAGAGG - Intronic
1051172417 9:14332040-14332062 AACCAAGAGGAAGCCAGGTGGGG + Intronic
1053219074 9:36296398-36296420 ACACAAGATCTAGCCAGGAGTGG - Intronic
1056439186 9:86603299-86603321 ACATGAGAGCAAGGCAGGAGAGG - Intergenic
1056949758 9:91032666-91032688 ACCCCAGGGCCAGCCTGGAGTGG + Intergenic
1057168938 9:92949298-92949320 ACCCAACAGCAAGCCACCAGTGG - Intronic
1057477122 9:95412199-95412221 ACCCCAGGGCAAGTCTGAAGTGG + Intergenic
1059419996 9:114184925-114184947 GTCCCAGAGCAGGCCAGGAAGGG - Intronic
1060662527 9:125412889-125412911 GGCCCAGAGCAGGCAAGGAGGGG - Intergenic
1061597281 9:131640042-131640064 AGCCCTGAGAAAGCCAGGATTGG + Intronic
1061844604 9:133379951-133379973 ACCCCACAGCCAGCCAGCAAGGG - Intronic
1062203660 9:135322694-135322716 ACCACAGAGCACCCCAGGGGAGG + Intergenic
1062674362 9:137731755-137731777 TTCCGAGGGCAAGCCAGGAGTGG + Intronic
1062745841 9:138211569-138211591 ACCTCAGAGGATGCCAGGTGGGG - Intergenic
1186506559 X:10097976-10097998 AACCAAGGGCAAGCCAGGCGCGG - Intronic
1186793545 X:13022624-13022646 ACCACAGAGCAAGGCAGGGGTGG + Intergenic
1187663062 X:21572623-21572645 ACCGCAGAGCAAAGCGGGAGAGG + Intronic
1189035370 X:37489652-37489674 ACCCCAGAGCCAGTCAGCTGTGG - Intronic
1198215504 X:134550827-134550849 AGCCCTGGGCAGGCCAGGAGGGG + Intergenic
1199169340 X:144717859-144717881 ACCCCAGTCCTGGCCAGGAGGGG - Intergenic