ID: 968450954

View in Genome Browser
Species Human (GRCh38)
Location 4:675698-675720
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 818
Summary {0: 1, 1: 0, 2: 41, 3: 260, 4: 516}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968450954_968450963 2 Left 968450954 4:675698-675720 CCAGCTTGTGGCCCGTTAGGAAC 0: 1
1: 0
2: 41
3: 260
4: 516
Right 968450963 4:675723-675745 GGCAGCACAGGACGAGGTGAGGG 0: 1
1: 0
2: 0
3: 53
4: 314
968450954_968450959 -10 Left 968450954 4:675698-675720 CCAGCTTGTGGCCCGTTAGGAAC 0: 1
1: 0
2: 41
3: 260
4: 516
Right 968450959 4:675711-675733 CGTTAGGAACCGGGCAGCACAGG 0: 1
1: 0
2: 3
3: 28
4: 95
968450954_968450960 -4 Left 968450954 4:675698-675720 CCAGCTTGTGGCCCGTTAGGAAC 0: 1
1: 0
2: 41
3: 260
4: 516
Right 968450960 4:675717-675739 GAACCGGGCAGCACAGGACGAGG 0: 1
1: 0
2: 11
3: 147
4: 1051
968450954_968450962 1 Left 968450954 4:675698-675720 CCAGCTTGTGGCCCGTTAGGAAC 0: 1
1: 0
2: 41
3: 260
4: 516
Right 968450962 4:675722-675744 GGGCAGCACAGGACGAGGTGAGG 0: 1
1: 0
2: 6
3: 42
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968450954 Original CRISPR GTTCCTAACGGGCCACAAGC TGG (reversed) Intronic
900159672 1:1217547-1217569 GTTCTTCACGGGCAGCAAGCTGG - Exonic
900587296 1:3439521-3439543 GTTCCTAACAGGCCAAGAACTGG + Intergenic
900711319 1:4116424-4116446 GTTCCTAATGGGCCACAGACTGG + Intergenic
900963338 1:5939847-5939869 TTTCATTACGGGCCACCAGCAGG + Intronic
902592710 1:17486407-17486429 GTTCCTAACAGGCCACAGACAGG - Intergenic
902600127 1:17535381-17535403 GTTCCTAACAGGCCACAGCCTGG + Intergenic
902803830 1:18848539-18848561 GTTCCTAACAGGCCACAGACTGG - Intronic
903043358 1:20548694-20548716 GTTCCTAACTGGCTACAGACTGG - Intergenic
903178181 1:21592774-21592796 GTTCCTAAGGGTCCATACGCTGG - Intergenic
903442925 1:23401791-23401813 GTTCCTAACAGGCCACAGACTGG - Intronic
903554788 1:24185666-24185688 CTTCCTAACGGGTGACCAGCAGG + Intronic
903701979 1:25255956-25255978 GTTCCTAACAGGCCACAAATGGG + Intronic
903703827 1:25270325-25270347 GTTCCTAACGGGCCACAGCCTGG - Intronic
903723416 1:25422999-25423021 GTTCCTAACGGGCCACAGCCTGG + Intronic
904247498 1:29198228-29198250 GTTCCTAACAGGCCACGAACTGG + Intronic
904737717 1:32647503-32647525 GTTCCTAACAGGCCACCAACTGG - Intronic
905378108 1:37538803-37538825 GTTCCTAACAGGCCACGGACTGG - Intronic
905688917 1:39928411-39928433 GTTCCTAACAGACCACAGACCGG - Intergenic
905763581 1:40581404-40581426 GTTCCTAACAGGCCACAGACTGG - Intergenic
906435661 1:45794314-45794336 GTTCCTAACGGGCTGCAGACCGG - Intronic
907057455 1:51383661-51383683 GTTCCTAACAGGCCACAGACTGG + Intronic
907127402 1:52063047-52063069 GTTCCTAACAGGTCACAGACTGG + Intronic
907222686 1:52918877-52918899 GTTCCTAGCAGGCCACAGACTGG - Intronic
907530539 1:55091186-55091208 GTTCCTAACGGGTCCCAGGCCGG - Intronic
907911176 1:58828096-58828118 GTTCCTAACAGGCCACAGATGGG - Intergenic
908155134 1:61345537-61345559 GTTCCTAACAGGCCACTGACTGG - Intronic
908172183 1:61516297-61516319 GTTCCTAACAGGCCACAGACTGG - Intergenic
908309032 1:62857145-62857167 GTTCCTAACAGGCCACAGACTGG - Intronic
908343399 1:63205874-63205896 GTTCTTAACAGGCCACAGACTGG - Intergenic
908588689 1:65604670-65604692 GTTCCTAAGAGGCCACAGACAGG - Intronic
908831704 1:68185435-68185457 GTTCCTAACAGGCCACTGACTGG - Intronic
909221601 1:72969310-72969332 GTTCCTAACAGGCCACAGACAGG + Intergenic
909329365 1:74393976-74393998 GTTTCTAACAGGCCACAGGTTGG + Intronic
909660508 1:78076657-78076679 GTTCCTAACAGGCCAAGGGCTGG + Intronic
910590238 1:88922423-88922445 GTTCCTAACAGGTCACCAGCTGG - Intergenic
910953744 1:92679004-92679026 GTTCCTAACAGGCCACAGACTGG - Intronic
911150611 1:94594154-94594176 GTTCCTAACAGGCCACGGACCGG - Intergenic
911573031 1:99540626-99540648 GTTCCTAACAGGCCATGAACAGG + Intergenic
912216412 1:107618189-107618211 GTTCCTAACAGGCCACAGTCTGG + Intronic
912750365 1:112282546-112282568 GTTCCTAACAGGCTCCTAGCTGG + Intergenic
913325021 1:117620604-117620626 GTTCCTAACAGGCCACGGACTGG - Intronic
913554624 1:119952715-119952737 GTTCCTAACAGGCCACACACAGG + Intronic
914335776 1:146713962-146713984 GTTCCTAACAGGCCACAAACTGG - Intergenic
916296100 1:163222157-163222179 GTTCCTAACAGGTCACGAACTGG - Intronic
916303573 1:163303695-163303717 GTTCCTAACAGGCCACAGACCGG - Intronic
916333914 1:163648701-163648723 GTTCCTAACGGGCCATGGACCGG - Intergenic
917098947 1:171426786-171426808 GTTCCTAACAGGCCACAGACTGG + Intergenic
917231891 1:172846396-172846418 GTTCCTAACAGGCTACAGACTGG - Intergenic
917543708 1:175940207-175940229 GTTCCTAACAGGCCACGGACTGG + Intergenic
917562674 1:176175630-176175652 GTTCCTAATAGGCCACAGACTGG + Intronic
918287556 1:183072640-183072662 GTTCCTAACAGGCCACAGACTGG - Intronic
918576582 1:186068136-186068158 GTTCCTAATAGGCCACAGGCTGG + Intronic
918699406 1:187589244-187589266 GTTCCTAACAGGTCACAGACAGG - Intergenic
918811144 1:189122698-189122720 GTTCCCAGCAGGCCACAGGCTGG - Intergenic
919099061 1:193071238-193071260 GTTCCTAACAGGCCACGGACTGG + Intronic
919515853 1:198521883-198521905 GTTCCTAACAAGCCACAGACAGG - Intergenic
919811543 1:201411948-201411970 GTTCCTAACAGGCCACGGACAGG + Intronic
919996605 1:202757265-202757287 GTTCCTAACAGGCCACCGACTGG + Intronic
920550377 1:206855663-206855685 GTTCCTAACAGGCCACCAACCGG + Intergenic
922031171 1:221800974-221800996 GTTCCTAACAGACCACAGACAGG - Intergenic
922329349 1:224560424-224560446 GTTCCTAACAGGCCACAGAGTGG - Intronic
922614304 1:226952202-226952224 GCTCCTAACAGGCCACCAGGCGG - Intronic
923618421 1:235557090-235557112 GTTCCTAACAGGCCACAGACTGG + Intronic
923704427 1:236332526-236332548 GTTCCTAACAGGCCACAGACTGG - Intergenic
923807455 1:237273394-237273416 GTTCCTAAGGGGCCACTGACTGG + Intronic
924030179 1:239878508-239878530 GTTCCTAACAGGCCACAGACTGG + Intronic
924072723 1:240298504-240298526 GTTCCTAACAGGCCACAGAATGG - Intronic
1063356365 10:5402617-5402639 GTTCCTAACAGGGCACAGACTGG - Intronic
1064104415 10:12489249-12489271 GTTTCTAACAGGCCACAGACTGG + Intronic
1064119930 10:12609743-12609765 GTTTCTAACAGGCCACAGACTGG + Intronic
1065307317 10:24381389-24381411 TTTCCTAACAGGCCACAGACTGG - Intronic
1065368398 10:24956778-24956800 GTTCCTAACAGGCCACAGGCTGG - Intergenic
1065408839 10:25398927-25398949 GTTCCTAACAGGCCATGAACTGG - Intronic
1065666142 10:28063541-28063563 GTTCCTAACAGGCCACAGACTGG - Intronic
1065672525 10:28135888-28135910 GTTCCTAACAGGTCATAAGCGGG - Intronic
1066199536 10:33131812-33131834 GTTCCTAACAGGCTACAGACTGG + Intergenic
1066214152 10:33269610-33269632 GTTCCTAACAGACCACAAACTGG - Intronic
1067139228 10:43642435-43642457 GTTCCTAACAGGCCACAGACTGG - Intergenic
1067250952 10:44586919-44586941 GTTCCTAACAGGCCACGGACTGG - Intergenic
1068163531 10:53299036-53299058 GTTCCTACCAGGCCACAGACTGG + Intergenic
1068334841 10:55621437-55621459 GTTCCTAACAGGCCATGAACAGG - Intronic
1068374975 10:56166036-56166058 GTTCCTTACAGGCCACAAATTGG + Intergenic
1068544294 10:58328518-58328540 GTTCCTAACAGGCCACAGACTGG + Intergenic
1068630066 10:59289286-59289308 GGTCCTAACAGGCTACAGGCCGG + Intronic
1068676335 10:59773404-59773426 GTTCCTAACAGGCCACAGATGGG - Intergenic
1069136470 10:64772918-64772940 GTTCCTAACAGGCCACAGACTGG - Intergenic
1069372237 10:67760588-67760610 GTTCCTAACAGGCCACGGACCGG - Intergenic
1070097791 10:73355152-73355174 GTTCCTGACAGGCCACGGGCTGG - Intronic
1072892750 10:99339427-99339449 GTTCCTACCAGGCCACAAACTGG - Intronic
1072990428 10:100187106-100187128 GTTCCTAACAGGCCACTGTCTGG + Exonic
1073059707 10:100726140-100726162 GATCCTGATGGGCCACATGCAGG - Intergenic
1073276454 10:102315745-102315767 GTTCCTAATGGGCCACAGACTGG + Intronic
1074098714 10:110336154-110336176 GTTCCAAAAGCGCGACAAGCAGG - Intergenic
1074139609 10:110660440-110660462 GTTCCTAACAGGCCACAGCCTGG - Intronic
1074968628 10:118516686-118516708 GCTCTTTACGGGCCACAAACAGG + Intergenic
1075237323 10:120742501-120742523 GTTCCTAACAGGCCACGGACTGG - Intergenic
1075853061 10:125604174-125604196 GTTCCTAACAGGCCACCAACTGG - Intronic
1075880648 10:125847963-125847985 GTTCCTAACAGGCCACGAACTGG + Intronic
1075917638 10:126182911-126182933 GTTCCTAACAGGCCACGGACAGG - Intronic
1075977912 10:126712814-126712836 GTTCCTAATGGGCCACAAACTGG - Intergenic
1076621200 10:131789221-131789243 GCTCCTAACAGGCCACAGACTGG - Intergenic
1078097278 11:8307756-8307778 GTTCCTAACAGACCACAGACTGG - Intergenic
1078116996 11:8463470-8463492 GTTCCTAACAGGCCACGGACAGG + Intronic
1078174083 11:8955743-8955765 GTTCCTAACAGACCACAGACTGG + Intronic
1078248078 11:9594565-9594587 GTTCCTAACAGGGCACGAACTGG + Intergenic
1078734518 11:14007741-14007763 GCTCCTAACAGGCCACAGACTGG + Intronic
1078812660 11:14783889-14783911 GTTCCTAACAGGCCACAGACCGG - Intronic
1078949705 11:16116719-16116741 GTTCCTAACAGGCCACAACCTGG - Intronic
1079666045 11:23106983-23107005 GTTCCTAACAGGCCATGAACAGG - Intergenic
1079870428 11:25792300-25792322 GTTCCCAACAGGCCACAGACTGG - Intergenic
1080061297 11:27959621-27959643 TTTCATAAAGGGACACAAGCAGG - Intergenic
1080471499 11:32550308-32550330 GTTCCTAACAGGCCACAGATCGG - Intergenic
1080512405 11:32987961-32987983 GTTGCTAACAGGCCACAGACTGG - Intronic
1080884483 11:36353819-36353841 ATTCCTAACAGGCCACAGACTGG + Intronic
1081263652 11:40991900-40991922 GTTCCTAACAGGCCACCAACTGG + Intronic
1081263659 11:40991937-40991959 GTTCCTAAGAGGCCACCAACTGG + Intronic
1081294180 11:41365049-41365071 GTTCCTAACAGGCCACAAACTGG - Intronic
1082740837 11:56909236-56909258 GTTCCTAACAGACCACAGACTGG + Intergenic
1082841458 11:57693418-57693440 GTTCCTAACAGGCCATGAACCGG + Intronic
1083020023 11:59497169-59497191 GTTTCTAACAGGCCAAAAGCTGG + Intergenic
1083149701 11:60784066-60784088 GTTCCTAACAGGCCACAGACTGG - Intergenic
1083233236 11:61336372-61336394 GTTCCCACCGGGCCACCAGGTGG + Intronic
1084206340 11:67596293-67596315 GTTCCTAAAGCCCTACAAGCAGG + Intergenic
1085382710 11:76134884-76134906 GTTCTTAACAGGCCACAGACGGG - Intronic
1085723396 11:78932911-78932933 GTTCCTAACAGGCCACGGTCCGG + Intronic
1086665586 11:89477463-89477485 GTTCCTAACAGGCCACGAACTGG + Intronic
1087796941 11:102464182-102464204 GTTCCTGACAGGCCACGAACAGG - Intronic
1087812485 11:102623290-102623312 GTTCCTAACAGGCCACAGACTGG - Intronic
1087854811 11:103078994-103079016 GTTTCTAACAGGCCACAGGCTGG - Intronic
1088341463 11:108772642-108772664 GTTCCTAACAGGCCACAGACCGG - Intronic
1088472191 11:110198455-110198477 GTTCCTAACAGGCCACACGCCGG - Intronic
1088736249 11:112729960-112729982 GTTCCTAACGTGCCACACACTGG - Intergenic
1089095137 11:115913793-115913815 GTTCCTAACAGGCCACAGACTGG - Intergenic
1089101323 11:115965112-115965134 GTTCCTAACAGGCCACAGACTGG + Intergenic
1089308203 11:117540187-117540209 GTTACTAACAGGCCACGAACAGG - Intronic
1090264056 11:125343032-125343054 GTTCCAAGGGGGCCACAGGCTGG + Intronic
1090901646 11:131037568-131037590 GTTCCTAACAGGCCACAGACCGG + Intergenic
1091307344 11:134544826-134544848 GTTCCTAACAGGCCACGAACGGG + Intergenic
1091513986 12:1159466-1159488 GTTCCTAACAGGCCACAGACCGG + Intronic
1092110606 12:5960868-5960890 GTTCCTAACAGGCCACTGACCGG - Intronic
1092194909 12:6543299-6543321 GTTCCTAACAGGCCACAGACAGG - Intronic
1092392308 12:8091679-8091701 GTTTCTAACAGGCCACAGACTGG + Intronic
1092734261 12:11565297-11565319 GTTCCTAACAGGCCATCAACAGG - Intergenic
1092871641 12:12810885-12810907 GCTCCTAACGGGCCACGGACTGG - Intronic
1094066185 12:26363035-26363057 GTTCCTAACAGGCCACAGACTGG - Intronic
1094075156 12:26464510-26464532 GTTCCTAACAGGCCACAGACTGG + Intronic
1094251885 12:28371188-28371210 GTTCCTAACAGGCCACGAAATGG - Intronic
1094344139 12:29448284-29448306 GTTCCTAACAGGCCATGAGTTGG + Intronic
1094527203 12:31239412-31239434 CATCCTACCGGGCCACAAGGAGG - Intergenic
1094645773 12:32322576-32322598 GTTCCTAATAGGCCACAAACTGG + Intronic
1094689181 12:32751866-32751888 GTTCCTAACAGGCCACGGACTGG + Intronic
1095177595 12:39111100-39111122 GTTCCTAACAGGCCACAGACTGG - Intergenic
1095184096 12:39180696-39180718 GTTCCTAACAGGCCATAGACTGG + Intergenic
1095203080 12:39408414-39408436 GTTCCTAGCAGGCCACAGACTGG + Intronic
1095654333 12:44650979-44651001 GTTCCTAACAGGCCACAGACTGG - Intronic
1095695827 12:45143010-45143032 ATTCCTAACAGGCCACAGACTGG + Intergenic
1095762354 12:45853915-45853937 GTTCCTAAAGGGCCACGGACTGG - Intronic
1095914830 12:47467240-47467262 GTTCCTAACAGGCCACAGACTGG + Intergenic
1096341111 12:50800501-50800523 GTTCCTAATAGGCCACAGACAGG - Intronic
1096431713 12:51549748-51549770 GTTCCTAACAGGCCACAGACAGG - Intergenic
1097580896 12:61455034-61455056 GTTCCTAACAGGCCACAGCTTGG + Intergenic
1097809938 12:64007508-64007530 GTTCCTAACAGGCCACGGACTGG + Intronic
1098314402 12:69178000-69178022 GTTCCTAACAGGCCAGAGACTGG + Intergenic
1099195293 12:79608522-79608544 GCTCCTAACAGGCCACAGACAGG + Intronic
1099270068 12:80497491-80497513 GTTCCTAACAGGCCACCAGCTGG + Intronic
1099317776 12:81106107-81106129 GTTCCTAACAGGCCACAGACTGG - Intronic
1099814288 12:87625330-87625352 GTTCCTAACAGGCGACGAACAGG - Intergenic
1100230824 12:92605255-92605277 GTTCCTAACAGGCCATAGACTGG - Intergenic
1100386694 12:94110434-94110456 GATCCTAATAGGCCACAAACTGG - Intergenic
1100456862 12:94760126-94760148 GTTCCTAACAGGCCACAGATCGG + Intergenic
1100547822 12:95620197-95620219 GTTCCTAACAGACCACAGACCGG + Intergenic
1100688431 12:97012036-97012058 GTTCCTAACAGGCCAAAGACTGG - Intergenic
1101089480 12:101270402-101270424 GTTCCTAACAGGCCATGAACCGG - Intergenic
1101374213 12:104157008-104157030 GTTCCTAACAGGCCACAGGCTGG + Intergenic
1101399005 12:104372299-104372321 GTTCCTAACAGGCCACAGAGCGG + Intergenic
1101658094 12:106742012-106742034 GTTCCTAACAGGCCACGGTCCGG + Intronic
1101976709 12:109365842-109365864 GTTCCTAACAGGCCACGGACCGG - Intronic
1102431396 12:112886567-112886589 GTTCCTAACAGGCCACAGACTGG + Intronic
1102601733 12:114036629-114036651 CTTCCTAACAGGCCACAGACTGG - Intergenic
1103161351 12:118731899-118731921 GTTCCTAACAGACCACAGACTGG - Intergenic
1103214292 12:119189725-119189747 GTTCCTAACAGGCCACAGATGGG + Intronic
1103429038 12:120865788-120865810 GTTTCTAACAGGCCACTAACTGG - Intronic
1103865344 12:124047324-124047346 GTTCCTAACAGGCCAAAGACAGG - Intronic
1104246816 12:127050992-127051014 GCTCCTAACAGGCCACAAACTGG - Intergenic
1104466122 12:128992393-128992415 GTTCCTAACAGGCCACAGGCCGG + Intergenic
1104538479 12:129640716-129640738 GCTCCTAACAGGCCACAGACTGG - Intronic
1104722227 12:131050960-131050982 GTTCCTAACAGGCCACGGGCTGG + Intronic
1105064254 12:133182933-133182955 GTTCCTAACAGACCACAGACTGG - Intronic
1105203847 13:18202831-18202853 GTTCCTAACAGGACACGAACCGG - Intergenic
1105373333 13:19819960-19819982 GTTCCTAACAGGCCACAGCCAGG + Intergenic
1105669841 13:22600829-22600851 GATTCTAACAGGCCACAGGCTGG + Intergenic
1106457153 13:29937440-29937462 GTTCCTAACAGGCCACAGACTGG - Intergenic
1106658314 13:31771261-31771283 GTTCCTAACATGCCACAGACTGG - Intronic
1106832743 13:33602649-33602671 GTTCCTAACAGGCCACAGACCGG - Intergenic
1106975259 13:35204023-35204045 GTTCCTGACAGGCCACAGACCGG - Intronic
1107446187 13:40472083-40472105 ATTCCTAACAGGCCACATACTGG - Intergenic
1107515772 13:41127443-41127465 GTTCCAAACAGGCCACAGACTGG + Intergenic
1107749568 13:43550189-43550211 GTTCCTAACAGGCCACAAACTGG + Intronic
1107797217 13:44065085-44065107 GTTCCTAACAGGCCACGGGCTGG + Intergenic
1108369993 13:49759808-49759830 GTTCCTAATGGGCCACGGACTGG + Intronic
1108608210 13:52061334-52061356 GTTCCTAACAGGCCACAGACTGG + Intronic
1109111613 13:58327721-58327743 GTTCCTAACAGGCCATGGGCCGG - Intergenic
1109282260 13:60370591-60370613 GTTCCTAACAGGACACAGACTGG + Intergenic
1109830549 13:67781425-67781447 GTTCCTAACAGGCCACGGACTGG + Intergenic
1110077725 13:71269887-71269909 GTTCCTAACAGGCCACGGACAGG + Intergenic
1110232559 13:73182118-73182140 GTTCCTAACAGGCCACGAACTGG + Intergenic
1110330883 13:74270963-74270985 GTTCCTAACAGGCCATGAACCGG - Intergenic
1110419071 13:75284575-75284597 GTTCATAACAGGCCACAGACAGG + Intergenic
1111592797 13:90371445-90371467 GTTCCTAACAGGTCACCATCCGG + Intergenic
1111694080 13:91601468-91601490 GTTCCTAACAGGCCACGGACTGG - Intronic
1111781804 13:92737357-92737379 ATTCCTGACGGGCCTGAAGCTGG - Intronic
1112032999 13:95474426-95474448 GTTCCTAACAGGCCACAGACTGG + Intronic
1112594396 13:100794696-100794718 GTTCCCAACAGGCCAAAAACTGG - Intergenic
1112804453 13:103147948-103147970 GTTCCTCACAGGACACTAGCAGG - Intergenic
1112917125 13:104565445-104565467 GTTTCTAACAGGCCACAGACTGG + Intergenic
1113973364 13:114207676-114207698 GTTCCTAACAGGCCACAGACTGG + Intergenic
1114274087 14:21125989-21126011 GTTCCTAACAGGCCACCGACTGG - Intergenic
1114373289 14:22113646-22113668 GTTCCTAACAGGCCACAGAATGG + Intergenic
1114576576 14:23719744-23719766 GTTCCTAACAGGCCATGAACCGG - Intergenic
1115094844 14:29622261-29622283 GTTCCTAACAGGCCACGTACAGG + Intronic
1115275964 14:31608816-31608838 GTTTCTAACAGGCCACAGACTGG + Intronic
1115955788 14:38777573-38777595 GCTCCTAACAGGCCACAAACTGG + Intergenic
1117281173 14:54242496-54242518 GTTCCTAACAGGACACAAACTGG + Intergenic
1117554406 14:56869833-56869855 GGTCCTAACAGGCCACAGACTGG - Intergenic
1117574969 14:57088516-57088538 GTCCCTAACAGGCCACAGACTGG - Intergenic
1117706496 14:58475139-58475161 GTTCCTAACAGGCCACAGACTGG - Intronic
1117767789 14:59100892-59100914 GTTCCTAACAGTCCACAATCCGG + Intergenic
1118142089 14:63095077-63095099 GCTCCTAACAGGCCACAGACTGG + Intronic
1119121606 14:72084355-72084377 GTTCCTAACAGGCCACAGACTGG + Intronic
1119293721 14:73516662-73516684 GTTCCTAACAGGCCATGAACTGG - Intronic
1120141033 14:80929892-80929914 GTTCCTAACAGGCCACGGACTGG - Intronic
1120810924 14:88802721-88802743 GTTCCTAACAGGCCACAGATGGG - Intergenic
1120868643 14:89317750-89317772 GTTCCTAACAGGCCCCGAACTGG - Intronic
1120919593 14:89742909-89742931 GTTCCTAACAGGCCATGAACTGG + Intergenic
1121078121 14:91085928-91085950 GTTCCTAAGAGGCCACAAACTGG - Intronic
1121149180 14:91615124-91615146 GTTCCTAACAGTCCACAGACTGG - Intronic
1121170552 14:91850420-91850442 GTTCCTAATAGGCCACAGGCTGG - Intronic
1121500910 14:94436692-94436714 GTTCCTAACAGGCCACGGACTGG - Intergenic
1122190170 14:100036012-100036034 GTTCCTAACAGGCCACGAACTGG - Intronic
1122833632 14:104420037-104420059 GTTCCTAACAGGCCACGGACTGG - Intergenic
1122833696 14:104420661-104420683 GTTCCTAACAGGCCACGGACTGG - Intergenic
1123065020 14:105614265-105614287 GTTCCTAACAGGCCATGAACCGG - Intergenic
1123069214 14:105633700-105633722 GTTCCTAACAGGCCATGAACCGG - Intergenic
1123088314 14:105729492-105729514 GTTCCTAACAGGCCATGAACTGG - Intergenic
1202894242 14_KI270722v1_random:188910-188932 GTTCCTCACAGGCCACAGACTGG - Intergenic
1124096842 15:26656522-26656544 GTTCCTAACAGGCCACGGACTGG - Intronic
1124393103 15:29277657-29277679 GTTCCTAACAGGCCACGAACTGG + Intronic
1124808210 15:32907501-32907523 GTTCCTAACAGGCCATGGGCTGG + Intronic
1124917823 15:33994091-33994113 GTTCCTAACAAGCCACAGACCGG - Intronic
1125249053 15:37678344-37678366 GTTCCTAACAGGCCACAGACTGG + Intergenic
1125375869 15:39028824-39028846 GTTCCTAACAGGCCACAGACCGG - Intergenic
1125643539 15:41251495-41251517 GTTCCTAACTGGCCACAGACTGG - Intronic
1126344383 15:47677144-47677166 GTTCCTAACAGGCTACAGACTGG + Intronic
1126399067 15:48250772-48250794 TTTCCTAAATGGCCACAAGATGG - Intronic
1126457022 15:48874382-48874404 GTTCCTAACAGGCCACGGACTGG - Intronic
1126474762 15:49054144-49054166 GTTTCTAACAGGCCCCTAGCTGG - Intergenic
1126661843 15:51040000-51040022 GTTCCTAACAGGCCACGGACCGG - Intergenic
1126911512 15:53422007-53422029 GTTCCTAACAGGCCACAGACTGG - Intergenic
1127008562 15:54597236-54597258 GTTCCTAACAGGCCACAGACCGG + Intronic
1127379066 15:58413363-58413385 GTTCCTAACAGGCCACACACTGG - Intronic
1127809502 15:62551262-62551284 GTTCCTAACAGGGCACAGACTGG + Intronic
1127901055 15:63341294-63341316 GTTCCTAACAGGCCACAGACCGG - Intronic
1128383445 15:67130362-67130384 GTTCCTAACAGGCCGCACACGGG - Intronic
1129499462 15:76022119-76022141 GTTCCTAATAGGCCACAGTCTGG + Intronic
1129595258 15:76958881-76958903 GTTCCTAACAGGCCATGAACCGG + Intergenic
1131810581 15:96169048-96169070 GTTCCTAACAGGCCACAGATTGG - Intergenic
1132033359 15:98457536-98457558 GCTCCTAACAGGCCACAGACTGG + Intronic
1133119986 16:3600304-3600326 GTTCCTAACAGGCCACAGACCGG + Intronic
1133660343 16:7910353-7910375 GTTCCTAACAGGCCACAGCTGGG + Intergenic
1133809259 16:9148622-9148644 GTTCCTAAAGGGCCAGGAACTGG + Intergenic
1133967958 16:10545364-10545386 GTTCCTAACAGGCTACAGACAGG - Intronic
1134689244 16:16180218-16180240 GTTCCTAACAGGCCACAGACTGG + Intronic
1136060940 16:27726011-27726033 GTTCCTAACAGGCCACAGACTGG - Intronic
1137836641 16:51598448-51598470 GTTCCTAAGAGGCCACAGACTGG + Intergenic
1138313697 16:56050145-56050167 GTTCCTAACAGGCCACAAACCGG - Intergenic
1139305861 16:65985929-65985951 GTTCCTAACAGGCCACAGACTGG - Intergenic
1139997848 16:70997266-70997288 GTTCCTAACAGGCCACAAACTGG + Intronic
1140163322 16:72522565-72522587 GTTCCTAACAGGTCACAGACTGG + Intergenic
1140338699 16:74136459-74136481 GTTCCTAACAAGCCACAGACTGG + Intergenic
1140548366 16:75834956-75834978 ATTCCTAACAGGCCACTGGCTGG + Intergenic
1140672624 16:77293898-77293920 GTTCCTTACAGACCACAAACAGG + Intronic
1140920337 16:79531792-79531814 GTTCCTAAGAGGCCACAGACTGG + Intergenic
1141043642 16:80694307-80694329 GTTCCTAACAGGCCACGGCCTGG + Intronic
1141107109 16:81242766-81242788 GTTCCTAACAGGCTACAGACTGG - Intronic
1141193298 16:81840734-81840756 ATTCCTAACGGGCCACAGACAGG + Intronic
1141216089 16:82025176-82025198 GTTCCTAACAGGCCACAGACTGG + Intergenic
1143796618 17:9342268-9342290 GTTCCTAAAAGGCCACAGACCGG + Intronic
1144310858 17:14013312-14013334 GTTCCCCACAGGCCACAAACTGG - Intergenic
1145009694 17:19360884-19360906 GTTCCTAACAGGCCACGGACTGG - Intronic
1145191673 17:20846457-20846479 GTTCCTAACAGGCCATGAGCAGG - Intronic
1146255103 17:31387682-31387704 GTTCCTAACAGGCCATGAACTGG - Intergenic
1146689365 17:34862534-34862556 GTTCCTAACAGGCAACAGACTGG - Intergenic
1146738088 17:35256860-35256882 GTTCCTAACAGGCCACAGTCAGG - Intronic
1149440287 17:56668053-56668075 GTTCCTAACAGGCCACAGACTGG - Intergenic
1149442435 17:56686025-56686047 GTTCCTAAAGGGCTACTGGCAGG - Intergenic
1149588256 17:57808099-57808121 GTTCCTAACAGGCCACTGACTGG - Intergenic
1149703146 17:58672229-58672251 GTTCCTAACAGGCCACCAACTGG + Intronic
1150517109 17:65825426-65825448 GTTCCTAACAGGCCACAGACAGG + Intronic
1151331622 17:73413048-73413070 GTTCCTAACAGACCACAGACTGG - Intronic
1151413409 17:73946133-73946155 GTTCCTAACAGGCCACAGACTGG - Intergenic
1151984050 17:77530629-77530651 GTTCCTAAAGGGCCACAGACCGG + Intergenic
1152316382 17:79583044-79583066 GTTCCTAAGGGGCCACATCAAGG + Intergenic
1152414518 17:80150607-80150629 GTTCCTAACAGGCCACAGACAGG - Intergenic
1152621106 17:81365333-81365355 GTTCCTAACAGGACACCAACAGG + Intergenic
1152945343 17:83194887-83194909 GTTCCTAACAGACCACAGCCTGG + Intergenic
1153519319 18:5937266-5937288 GTTCCTAATAGGCCACAAACTGG - Intergenic
1153533857 18:6079121-6079143 GTTCCTAACAGGCTACAGACCGG + Intronic
1155401827 18:25447798-25447820 GTTCCTAACAGGCCACGGACTGG - Intergenic
1155612519 18:27682875-27682897 GTTCCTAACAAGCCACAGACTGG + Intergenic
1155759638 18:29549619-29549641 GTTCCTAACAGGCCACAGACTGG - Intergenic
1155908328 18:31479022-31479044 GTTCCTAACAGGCCACAGACAGG + Intergenic
1156276179 18:35584877-35584899 GTTTCTAACAGGCCACAGACTGG + Intronic
1157157274 18:45280384-45280406 GGTGTTAAGGGGCCACAAGCAGG + Intronic
1157209947 18:45733759-45733781 GTTCCCAACAGGCCACAGACAGG - Intronic
1157691645 18:49687291-49687313 GTTTCTAACAGGCCACAGACCGG + Intergenic
1158285302 18:55874139-55874161 GTTCCTAACGGGCCACAGACAGG + Intergenic
1158595997 18:58816555-58816577 GTTCCTAACAGGCCACAGACCGG + Intergenic
1158810080 18:61021759-61021781 GTTCCTAACAGGCCACCAGCAGG - Intergenic
1158862913 18:61610566-61610588 GTTTCTAACAGGCCACAGACTGG + Intergenic
1158865130 18:61631244-61631266 GTTCCTAACAGGCCACCTACTGG + Intergenic
1158909524 18:62046329-62046351 GTTCCTAACAGGCCACAGACTGG - Intronic
1158910507 18:62056721-62056743 GTTCCTAACAGGCCATGAACTGG - Intronic
1159558360 18:69968272-69968294 GTTCCTAAAAGGCCACAGACTGG + Intergenic
1160606793 18:80057696-80057718 GTTCCTAACAGGCCACAGATGGG - Intronic
1162037457 19:7949437-7949459 GTTCCTAACAGGCCACAGACAGG + Intergenic
1162684490 19:12370449-12370471 GCTCCTAACAGGCCACAGTCTGG + Intergenic
1163372772 19:16911141-16911163 CTTCCTAACAGGCCACCAACCGG - Intronic
1163616835 19:18334152-18334174 GTTCCTAACAGGCCACAGACTGG - Intergenic
1165054440 19:33165203-33165225 TTTCCTAACAGGCCACAGACTGG + Intronic
1165779220 19:38422456-38422478 GTTCCTAACAGGCCACGGACTGG - Intronic
1165902027 19:39173594-39173616 GCCCCTAACGGGCCATCAGCGGG + Exonic
1166391956 19:42413323-42413345 CTTCCTAAAGGGCCACACCCCGG - Intronic
1167223207 19:48217217-48217239 GTTTCTAACGGGCCACAGACCGG + Intronic
1167802436 19:51753212-51753234 CTTCCTAACAGGCCACAGACCGG - Intronic
1167986771 19:53325027-53325049 GTTCCTAACAGGCCATAGACTGG - Intergenic
1168384640 19:55953000-55953022 GTTCCTAACAGGCCACAGACTGG - Intronic
1168568722 19:57446132-57446154 GTTCCTAACAGGCCACAGACTGG - Intronic
925029588 2:639183-639205 GTTCCTAACAGGCCACAGGCTGG + Intergenic
925103829 2:1272434-1272456 GTTCCTAACAGGCCACAGACTGG + Intronic
925530476 2:4855338-4855360 GTTCCTAACAGGCCACGGACAGG - Intergenic
925825251 2:7841971-7841993 GTTCCTAACAGGCTACAGACTGG + Intergenic
926562206 2:14430151-14430173 GTTCCTAACAGGCCAAAGACTGG - Intergenic
926701501 2:15807196-15807218 GTTCCTAACAGGCCCCAAATCGG - Intergenic
926963060 2:18379981-18380003 GTTCCTAACAGGCCACGCACTGG - Intergenic
927228034 2:20789670-20789692 GTTCCTGACAGGCCACAGACAGG - Intronic
927507863 2:23626353-23626375 GTTCCTAACAGGCCACAGGCTGG + Intronic
927765529 2:25803830-25803852 GTTCCTAACGGGCCACAGACTGG + Intronic
928491906 2:31793073-31793095 GCTCCTAAAGGTCCACATGCAGG - Intergenic
928711990 2:34017655-34017677 GTTCCTAACAGGCCACAGACTGG + Intergenic
929090095 2:38207553-38207575 GTTCCTAATAGGCTACAAACTGG - Intergenic
929264114 2:39899413-39899435 GTTCCTAACCGGCCACAAATCGG - Intergenic
930884013 2:56303536-56303558 TTTCCTAAAGGGCACCAAGCAGG + Intronic
930948390 2:57105837-57105859 GTTCCTAGCAGGCCACAGACAGG - Intergenic
931011142 2:57915758-57915780 GTTCCTAACAGGCCACAAACCGG - Intronic
931298293 2:60951718-60951740 ATTCCTAACAGGTCACCAGCTGG + Intronic
932054344 2:68429607-68429629 GTTCCTAACAGGCCATAGACTGG - Intergenic
933739631 2:85523358-85523380 GTTCCTAACAGGGCACAGACTGG + Intergenic
933888218 2:86740030-86740052 GTTCCTAACAGGCCACAGAGGGG - Intronic
933921960 2:87056676-87056698 GTTCCTAACAGGCCACAGAGGGG + Intergenic
934876097 2:97922296-97922318 GTTCCTAACAGGCCACAGACCGG + Intronic
935002372 2:99031651-99031673 GTTCCTAACAGACCACAGACTGG - Intronic
935228198 2:101072779-101072801 GTTCCTAACAGGCCACAAATTGG + Intronic
935725672 2:106021819-106021841 GTTCCTAACAGGCCACAGATTGG - Intergenic
935804305 2:106730989-106731011 GTTCCTAATAGGCCACAGACTGG - Intergenic
935884575 2:107602973-107602995 GTTCATAACAGGTCACAAACTGG - Intergenic
936034506 2:109100201-109100223 GTTCCTAACAGGCCACAGACTGG - Intergenic
936042358 2:109159612-109159634 GTTCCTAACAGGGCACAGACTGG - Intronic
936228930 2:110682464-110682486 GTTCCTAACAGGCCATGAACAGG + Intergenic
936755943 2:115712413-115712435 GTTCTTAACAGGCCACAGACTGG + Intronic
938963142 2:136361051-136361073 GTTCCTAACAGGTCACGAACCGG + Intergenic
939370398 2:141292005-141292027 GTTCCTAACAGGCCACGGACTGG - Intronic
940293786 2:152101683-152101705 GTTCCTAACAGGCCACAGACTGG - Intergenic
940986821 2:160059248-160059270 GTTCCTAACAGGCCACAAACTGG + Intronic
941002731 2:160218729-160218751 GTTGCTAACAGGCCACAGACTGG - Intronic
941075966 2:161007128-161007150 GTTCCTAACAGGCCACGGACTGG + Intergenic
941676238 2:168346098-168346120 ATTCCTAACAGGCCACAGACTGG - Intergenic
942104905 2:172624293-172624315 GTTCCTTACAGGCCACAGACTGG - Intergenic
942305176 2:174600150-174600172 GTTCCTAAGGGGCCATAGACTGG + Intronic
942338816 2:174921147-174921169 GTTCCTAACAGGCCACAGAGTGG + Intronic
942340069 2:174934497-174934519 GTTCCTAACAGGCCACAAGACGG + Intronic
942477623 2:176344659-176344681 GTTCCTAACAGGCCACGGACTGG - Intergenic
942944800 2:181660290-181660312 GTTCCAAACAGGCCACAGACAGG + Intronic
943058928 2:183017615-183017637 GTTCCTAACAGGCCACGGACTGG + Intronic
943618453 2:190120069-190120091 GTTCCTAACAGGCCACGGACTGG - Intronic
943742987 2:191431275-191431297 GTTCCTAACAGGCCATAGACCGG - Intergenic
944237955 2:197457204-197457226 GTTCCTAACAGGCCACGGACAGG + Intronic
944311606 2:198239912-198239934 GTTCCTAACAGGCCACAGACTGG - Intronic
944318716 2:198311271-198311293 GTTCCTAACTGGCCACACACTGG + Intronic
944896195 2:204167782-204167804 GTTCCTAACAGGCCACAGACTGG - Intergenic
945027310 2:205631416-205631438 GTTCCTAACAGGCCACAGACCGG + Intergenic
945149817 2:206778706-206778728 GTTCCTAACAGGCCACGGACTGG - Intronic
945327653 2:208501446-208501468 GTTCCTAACAGGCCATGAACCGG + Intronic
945526592 2:210895383-210895405 GTTCCTAACAGGCCACAGACTGG + Intergenic
946150408 2:217762405-217762427 GTTCCTAACAGGCCATGGGCTGG + Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946779309 2:223176567-223176589 GTTCCTAACAGGCCACAGACCGG - Intronic
948165358 2:235857107-235857129 GTTCCTAACAGGCCACAGACTGG - Intronic
948250134 2:236520901-236520923 GTTCCTAACAGGCCACGGACCGG + Intergenic
948330189 2:237158423-237158445 GTTCCTAACAGGCCACAGACTGG + Intergenic
948420370 2:237856334-237856356 GTTCCTAACAGGCCATGATCTGG + Intergenic
948516337 2:238506066-238506088 GTTCCTAACAGGCCACAGTCGGG + Intergenic
948535741 2:238645243-238645265 GTTCCTAACAGGCCACAGACAGG - Intergenic
948654740 2:239469619-239469641 GTTCCTAACAGGCCACAGACTGG + Intergenic
948690257 2:239697710-239697732 GTTCCTAAAAGGCCACAGACTGG + Intergenic
1168784036 20:521992-522014 GTTCCTAACAGGCCATGAACTGG - Intronic
1169166724 20:3430517-3430539 TTTCCTAACAGGCCACAGACTGG + Intergenic
1169322014 20:4640763-4640785 GTTCCTAACAGGCCACAGACTGG - Intergenic
1169946675 20:10996489-10996511 GTTCCTAACAGGCCACAGACTGG - Intergenic
1170018832 20:11813288-11813310 GTTCCTAACAGGCCTCAGACCGG + Intergenic
1170135538 20:13069645-13069667 GTTCCTAACAGGCCACAGACTGG + Intronic
1171213575 20:23335526-23335548 GTTCCTAATGGCCCCCAAACTGG + Intergenic
1171508646 20:25661122-25661144 GTTCCTAACAGGCCATGAACTGG + Intergenic
1172028700 20:31967286-31967308 GATCCTAAGGGGCCAGAAGGTGG - Intergenic
1172239086 20:33400208-33400230 GTTCCTCACAGGCCACAGACAGG + Intronic
1172622004 20:36323931-36323953 GTTCCTAACAGGCCACAGACTGG + Intronic
1172850019 20:37954900-37954922 GTTCCTAACAGGTCACAAACTGG + Intergenic
1173320809 20:41985316-41985338 CTTCCTAACAGGCCACAGACTGG - Intergenic
1173546475 20:43902023-43902045 GTTCCTAACAGGCTACAGACCGG - Intergenic
1173570585 20:44073174-44073196 GTTCCTGACAGGCCACAGACTGG - Intergenic
1173725550 20:45294749-45294771 GTTCCTAACAGGCCATGGGCTGG - Intronic
1174365142 20:50052127-50052149 GTTCCTAACAGGCCACGAATGGG + Intergenic
1174866600 20:54142284-54142306 GTTCCTTACAGGCCACAGACTGG + Intergenic
1174986666 20:55461621-55461643 GTTCCTAACAGGCCACAAACTGG - Intergenic
1175165537 20:57041303-57041325 GTCCCCAAGGGGCCAGAAGCGGG - Intergenic
1175203610 20:57294248-57294270 ATTCCTAACAGGCCACAGACCGG + Intergenic
1175805866 20:61829104-61829126 GTTCCTAACAGGCCACAGACCGG + Intronic
1176161073 20:63649127-63649149 GCTCCTCATGGGCCACCAGCTGG - Intronic
1176714122 21:10335255-10335277 GTTCCTAACAGGACACGAACCGG + Intergenic
1177417161 21:20808760-20808782 GTTCCTAACAGGCCACAGACCGG - Intergenic
1178319723 21:31596157-31596179 GTTCCTAACAGGCCACAGAACGG - Intergenic
1178458336 21:32776855-32776877 GTTCCTAACAGGCCACTGACTGG - Intergenic
1179057086 21:37946181-37946203 GTTCCTAACAGGCCACAGAGCGG - Intergenic
1179559086 21:42201450-42201472 ATTCCTAACGGGCCACGGACTGG + Intronic
1180100778 21:45584005-45584027 GTTCCTAACAGGCCACAGACTGG + Intergenic
1180774483 22:18415470-18415492 GTTCCTAACAGGACACGAACCGG - Intergenic
1180807636 22:18726287-18726309 GTTCCTAACAGGACACGAACCGG - Intergenic
1181070595 22:20334478-20334500 GTTCCTAACAGGACACGAACCGG - Intergenic
1181193580 22:21162420-21162442 GTTCCTAACAGGACACGAACCGG - Intergenic
1181215863 22:21330178-21330200 GTTCCTAACAGGACACGAACCGG + Intergenic
1181567343 22:23747210-23747232 GTTCCTAACAGGCCACAGACTGG - Intronic
1181624109 22:24111315-24111337 GTTCCTAACAGGCCACGGACTGG - Intronic
1182722574 22:32415267-32415289 GTTCCTAACAGGCCACAGACCGG + Intronic
1183756586 22:39772335-39772357 GTTCCTAACAGGTCACAGACTGG + Intronic
1185189505 22:49425551-49425573 GTTCCTAACTGGCCACCGACCGG + Intronic
1185304282 22:50104274-50104296 GTTTCTAACAGGCCACAGTCCGG + Intronic
949293665 3:2495524-2495546 GTTCCTAACAGGCCACAGACAGG - Intronic
949800406 3:7897773-7897795 GTTCCTAACAGGCCAGGATCTGG - Intergenic
950881803 3:16328368-16328390 GTTCCCAAAGGGCCACCAGCAGG - Intronic
950992857 3:17459461-17459483 GTTCCTAACAGGCCACAGCCTGG + Intronic
951050640 3:18089414-18089436 GTTCCTAACAGGCCACGGACTGG - Intronic
951628149 3:24689472-24689494 GTTCCTAACAGGCCACAGACTGG - Intergenic
952170907 3:30806025-30806047 GTTCCTAACAGGCCATGAACCGG + Intronic
952709992 3:36420426-36420448 GTTCCTAACAGGCTACAGACCGG - Intronic
952796272 3:37242176-37242198 GTTCCTAACAGGCCATGGGCTGG + Intergenic
953227451 3:41033672-41033694 GTTCCTAACAGGCCACAGATTGG + Intergenic
953849845 3:46457143-46457165 GTTCCTAACAGGCCATCAACCGG + Intronic
954470451 3:50689837-50689859 GTTCCTAACGGGGATAAAGCAGG + Intronic
954476351 3:50749980-50750002 GTTCCTAACAGGCCACAGATTGG - Intronic
955022235 3:55132600-55132622 GTTCCTAACAGGCCACGGACTGG - Intergenic
955617581 3:60825504-60825526 GTCCCTAACAGGCCACAGACTGG - Intronic
955623901 3:60895960-60895982 GTTCCTAACAGGCCACAGACTGG - Intronic
955917933 3:63925335-63925357 TTTCCTAACAGGCCATAGGCGGG - Intronic
956213831 3:66827921-66827943 GTTCCTAACAGGCCACAGACCGG + Intergenic
956217129 3:66860220-66860242 GTTCCTGAGGGGCAACATGCAGG + Intergenic
956390590 3:68769059-68769081 GTTCCTAACAGGCCACAAACTGG - Intronic
956393496 3:68799785-68799807 GTTCCTAACAAGCCACAGACAGG - Intronic
956646956 3:71465750-71465772 TTTCCTAACGGGCCATGGGCTGG - Intronic
956877514 3:73478193-73478215 GTTACTAACAGGCCACAGACTGG - Intronic
957150949 3:76485479-76485501 GTTCCTAACAGACCGCAAACTGG + Intronic
957623349 3:82624173-82624195 GTTCATAACAGGCCACAGACTGG - Intergenic
957801554 3:85090645-85090667 GTTCCTAACAGGCCACTGACCGG - Intronic
958920228 3:100097007-100097029 GTTCCTAACAGGCCACAGAGTGG - Intronic
958941192 3:100316729-100316751 TATCCTAAAGGGCCACAAGATGG + Intronic
959033663 3:101334133-101334155 GCTCCTAACAGGCCACAGACTGG + Intronic
959040846 3:101422004-101422026 GTTCCTAACAGACCACAGACTGG - Intronic
959294245 3:104514939-104514961 GTTCCTAATAGGCCACAGACAGG - Intergenic
959775910 3:110162784-110162806 GTTCCTAACAGGCCACAAACGGG - Intergenic
960537556 3:118830158-118830180 GTTTCTAACAGGCCACAGACTGG - Intergenic
960766448 3:121135745-121135767 GTTCCTAACAGGCCACAGACTGG + Intronic
960823423 3:121758147-121758169 GTTCCTAACAGGCCACGGACTGG + Intergenic
961195033 3:124994313-124994335 GTTCCTAACAGACCACAAACTGG + Intronic
961727287 3:128939935-128939957 GTTCCTAACAGGCCAGAGACCGG + Intronic
962053215 3:131841398-131841420 GTTCCTAACAGGCCACAGACTGG - Intronic
962197620 3:133377735-133377757 GTTCCTAACAGGCCACAGACTGG - Intronic
962332203 3:134488050-134488072 GTTCCTAACAGGCCACGGACTGG - Intronic
962857627 3:139363239-139363261 ATTCCTAACAGGCCACAGACTGG - Intronic
963536789 3:146539410-146539432 GTTCCTAACAGGCCACAGACTGG + Intronic
964378272 3:156071049-156071071 GTTCCTAACAGGCCAATGGCTGG - Intronic
964876825 3:161376885-161376907 GTTCCTAACAGGCCACAGATAGG - Intergenic
964969707 3:162544293-162544315 GTTCCTAACAAGCCACAAAAAGG - Intergenic
965304847 3:167051555-167051577 GTTTCTAACAGGCCACTAACTGG - Intergenic
965639274 3:170815520-170815542 GTTCCTAACAGGCCACAGACTGG - Intronic
965769582 3:172167657-172167679 GTTCCTAACATGCCACAGACAGG - Intronic
966358481 3:179107865-179107887 GTTCTTAACAGGCCACAGACTGG + Intergenic
967009868 3:185422803-185422825 GTTCCTAACAGGCCACAGACTGG - Intronic
967455147 3:189676739-189676761 GTTCCTAACAGGCCACAGATGGG - Intronic
968331485 3:197874173-197874195 GTTCCTAACAGGCCACAGACTGG - Intronic
968450954 4:675698-675720 GTTCCTAACGGGCCACAAGCTGG - Intronic
969192229 4:5531425-5531447 GTTCCTAACAGGCCATAGGCCGG - Intergenic
970170021 4:13280171-13280193 GTTCCTAACAGGCCACAGACTGG - Intergenic
970388896 4:15587315-15587337 GTTCCTAACAGGCCACAGACTGG + Intronic
970620829 4:17816369-17816391 GTTCCTAACAGGCCACAGACTGG + Intronic
970633483 4:17980719-17980741 TTTCCTAACAGGCCACAGACTGG - Intronic
970905466 4:21211331-21211353 GTTCCTAACAGGACACACACTGG - Intronic
970924422 4:21434517-21434539 GTTCCTAACAGGCCACAGAGTGG - Intronic
971032932 4:22660546-22660568 GTTCCTAACAGGCCACGGACTGG - Intergenic
971212936 4:24637242-24637264 GCTCCTAACAGGCCACAGCCAGG - Intergenic
971564556 4:28120754-28120776 GCTCCTAACAGGCCACAGACTGG + Intergenic
971755244 4:30699342-30699364 GTTCCTAACAGGCCACAAACTGG + Intergenic
972027654 4:34405536-34405558 GATCCTAGCAGGCCACAGGCTGG + Intergenic
972410029 4:38784260-38784282 GTTCCTAACAGGCCATGAACTGG - Intergenic
972556467 4:40186525-40186547 GTTCCTAACAGGCCACGGGTGGG + Intergenic
972622569 4:40762668-40762690 GTTCCTAACAGGCCACAGACAGG - Intronic
972663389 4:41140605-41140627 GTTCCTAACAGGCCACAGACTGG - Intronic
972975690 4:44632916-44632938 GTTCCTAACAGGCCATGGGCAGG - Intronic
973145504 4:46820444-46820466 GTTCCTAACAGGCCATGGGCTGG + Intronic
973275323 4:48301104-48301126 GTTCCTAACGGGCCATAGACTGG - Intergenic
973977866 4:56281114-56281136 GTTCCTAACAGGCCACACACCGG - Intronic
973990706 4:56404005-56404027 GTTCCTAACAAGCCACAGACTGG + Intronic
974347832 4:60704357-60704379 GTTCCTAACAGGCCACAGAGTGG - Intergenic
976482864 4:85564846-85564868 GTTCCTAACTGGCCACAGACTGG + Intronic
976668155 4:87622484-87622506 GTTCCTAACAAGCCACAGACCGG + Intergenic
976811064 4:89101801-89101823 GTTCCTGACAGGCCACCAACCGG - Intronic
977420606 4:96795202-96795224 GTTTCTAACAGGCCACAGACTGG + Intergenic
977810554 4:101350435-101350457 GTTCCTAATAGGCCACAGACTGG + Intergenic
978623192 4:110655111-110655133 GTTCCTAACAGGCCACAGACTGG + Intergenic
978989026 4:115054927-115054949 GTTGCTAACAGGCCACAGACTGG - Intronic
979464092 4:121016612-121016634 GTTCCTAACAGGCCACGGACCGG + Intergenic
979489510 4:121309019-121309041 GTTCCTAACAGGCCACAGACAGG - Intergenic
979852526 4:125591561-125591583 GTTCCTAACAGGTCACAGACTGG + Intergenic
979977766 4:127218257-127218279 GTTCCTAACAGGCCACGGACTGG - Intergenic
981000109 4:139821249-139821271 GTTCCTAACAGGCCACGGACTGG - Intronic
981591311 4:146365853-146365875 GTTCCTAACAGGCCACAGACTGG - Intronic
982023896 4:151232953-151232975 GTTCCTAACAGGCCATAGACTGG - Intronic
982049469 4:151486197-151486219 GTTCCTAACAGGCCAGAGACTGG + Intronic
982146833 4:152403792-152403814 GTTCCTAACAGGCCACAGACTGG + Intronic
983295058 4:165856783-165856805 GTTCCTAACAGGTCACAGACAGG + Intergenic
983850249 4:172571089-172571111 GTTCCTAAAAGGCCACAGACTGG + Intronic
983869034 4:172803219-172803241 GTTCCTAACAGGCCACACATGGG - Intronic
984376826 4:178942132-178942154 GTTCCTCACAGGCCACCAACCGG - Intergenic
984385295 4:179048035-179048057 GTTCCTAACAGGCCACAGACTGG + Intergenic
984772943 4:183454120-183454142 GTTCCTAACAGGCCACAGACTGG + Intergenic
985684499 5:1274712-1274734 GTTCCTAACAGGCCCCAGACCGG + Intronic
986837881 5:11661826-11661848 GTTCCTAACAGGCTACCAGCCGG - Intronic
987018829 5:13848875-13848897 GTTCCTAACAGGCCACAGACTGG + Intronic
987184939 5:15407696-15407718 GTTCCTAACAGGCCACAGACCGG + Intergenic
987230628 5:15890137-15890159 GTTCCTAACTGGCCACAGACCGG - Intronic
988390020 5:30615943-30615965 GTTCCTAATCGGCCACACACTGG - Intergenic
988813622 5:34808994-34809016 GATCCTAACAGGCCACAGACTGG + Intronic
989163605 5:38414039-38414061 CTTCCTAACAGGCCACAGACTGG + Intronic
989227543 5:39047460-39047482 GTTCCTAACAGGCCACGGACTGG + Intronic
989747500 5:44847441-44847463 GTTCCTAACAGGCCACTGACAGG + Intergenic
990009643 5:50981591-50981613 GTTCCTAACAGGCCATAGCCAGG - Intergenic
990397219 5:55394660-55394682 GTTCTTAACAGGCCACAGACTGG + Intronic
990493188 5:56321645-56321667 GTTCCTAACAGGCCATGAACCGG + Intergenic
990972175 5:61520064-61520086 GTTCCTAACAGACCACAGACTGG + Intronic
991036848 5:62135925-62135947 GTTCCTAACAGGCCATAGACCGG + Intergenic
991622476 5:68559205-68559227 GTTCGTAACAGGCCACAGACTGG - Intergenic
992033659 5:72749526-72749548 GTTCCTAACAAGCTACAAACAGG + Intergenic
992613520 5:78528268-78528290 GTTCCTAACAGGCCACAGACCGG - Intronic
993011870 5:82492298-82492320 CTTCCTAACAGGCCACAGACTGG - Intergenic
993426047 5:87765245-87765267 GTTCCTAACAGGCCGCAGACTGG + Intergenic
993558141 5:89367389-89367411 TTTCCTAACAGGCCACAAACTGG + Intergenic
993855208 5:93065956-93065978 GTTCCTAACAGGCCACAGAGTGG - Intergenic
993968547 5:94388300-94388322 GTTCCTAACAGGCCACCAACTGG + Intronic
994516762 5:100782175-100782197 GTTCCTAACAGGCCACTGACTGG - Intergenic
995627816 5:114098367-114098389 GTTCCTAACAGGCCACAGACTGG - Intergenic
996228366 5:121030403-121030425 GTTCCTAACAGGCCACAGACTGG + Intergenic
996585131 5:125079140-125079162 GTTCCTAACCGGCCACAAACCGG - Intergenic
997546730 5:134714317-134714339 GTTCCTAACAGGCCACCCACTGG - Intronic
997693850 5:135845994-135846016 GTTCCTAACAGGCCACAGGCTGG - Intronic
997740897 5:136252846-136252868 ATTCCTAACAGGCCACAGACTGG + Intronic
997811520 5:136975025-136975047 GTTCCTAAGAGGCCACAGACTGG + Intergenic
997924330 5:138014320-138014342 GTTCCTAACAGGCCACAGACTGG - Intronic
998926707 5:147134701-147134723 GTTCCTAACAGACCACAGACTGG + Intergenic
999502873 5:152164393-152164415 GTTCCTAACAGACCACAACCTGG - Intergenic
999512661 5:152268936-152268958 GTTCCTAACAGGCCATAGACTGG + Intergenic
999559297 5:152782844-152782866 GTTCCTAACAGGGCACAGACTGG + Intergenic
999587234 5:153103423-153103445 GTTCCTAACAGGCCACAAACTGG - Intergenic
999762076 5:154710164-154710186 GTTTCTAACAGGCCACAGACTGG + Intergenic
1000308740 5:160020495-160020517 GTTCCTTACAGGCCACAGACTGG - Intronic
1000609398 5:163358001-163358023 GTTCCTAACAGGCCATGACCTGG - Intergenic
1000777568 5:165439678-165439700 ATTCATACAGGGCCACAAGCTGG + Intergenic
1001225431 5:169940823-169940845 GTTCCTACCTGGCCACAGACTGG + Intronic
1002195566 5:177499028-177499050 GTTCCTAACAGGCCACAAACGGG - Intergenic
1002323682 5:178390994-178391016 GTTCCTAACAGGCCACAAACTGG - Intronic
1002949659 6:1797040-1797062 GTTCCTAACAGGCCATATACTGG - Intronic
1003141761 6:3477721-3477743 GTTCCTAACAGACCACAGACTGG + Intergenic
1003696680 6:8412903-8412925 GTTCCTAACAGGCCACGGACTGG + Intergenic
1003779790 6:9411649-9411671 GTTCCTAACAAGCCACACACTGG + Intergenic
1003882339 6:10490086-10490108 GTTCCTAACAAGCCACAGACTGG - Intergenic
1004699456 6:18065391-18065413 GTTCCTAACAGGCCACCAACTGG - Intergenic
1004795629 6:19080167-19080189 GTTCCTAACAGGCCACAGACCGG - Intergenic
1004852271 6:19712385-19712407 GTTCCTAACAGGTCACAGACTGG - Intergenic
1005086784 6:22015161-22015183 GTTCCTAACAGGCCACAGACTGG - Intergenic
1005387973 6:25304651-25304673 GTTCCTAACAGGCCACAGACTGG + Intronic
1005660526 6:27994259-27994281 GTTCCTAACAGGCCACGGACTGG - Intergenic
1006237341 6:32645545-32645567 GTTTCTAACAGGCCACCAACTGG + Intronic
1006720169 6:36145076-36145098 GTTCCTAACAGGCCACAGACAGG + Intergenic
1006871351 6:37255087-37255109 GTTCCTAACAGGCAACAGACAGG + Intronic
1007152647 6:39709515-39709537 GTTCCTAACAGGCCACAGACTGG + Intronic
1007895366 6:45350872-45350894 GTTCCCAACAGGCCACGAACTGG - Intronic
1008523813 6:52387727-52387749 GTTCCTAACAGGCCACAGACAGG - Intronic
1008596188 6:53044161-53044183 GCTCCTAACAGGCCACAGACTGG - Intronic
1008950834 6:57156993-57157015 GTTCTTAACAGGCCACAGACTGG + Intronic
1008955662 6:57213266-57213288 GTTCCTAACAGGCCACAGAACGG + Intronic
1008967520 6:57328090-57328112 GTTCCTAATGGGCCATGTGCTGG + Intronic
1009439633 6:63661932-63661954 GTTCCTAACAGGCCCCAAACTGG - Intronic
1009513418 6:64582207-64582229 GTTCCTAACAGGCCACAGACAGG - Intronic
1009523772 6:64717593-64717615 GTTCCTAACAGGCCACGAACTGG + Intronic
1009582068 6:65549134-65549156 GTTCCTAAATGGACACAAACCGG + Intronic
1009922747 6:70083022-70083044 GTTCCTAACAGTCCACAGACCGG + Intronic
1009962087 6:70535383-70535405 GTTCCTAAGAGGCCACAGACAGG - Intronic
1010776632 6:79894055-79894077 GTTCCTAACAGGCCACAAACCGG - Intergenic
1011027624 6:82886467-82886489 GTTCCTAATAGGACACAGGCTGG + Intergenic
1011139878 6:84141136-84141158 GTTCCTAACAGGCCATGAACTGG + Intronic
1011637646 6:89389078-89389100 GTTCCTAACAGGCCACAGACTGG + Intronic
1012211995 6:96530927-96530949 GTTCCTAACAGGCCACAGACTGG - Intronic
1012973391 6:105754914-105754936 GTTCCTAACAGGCCACAGAATGG - Intergenic
1013465855 6:110416457-110416479 GTTCCTAACAGGCCACGGACTGG + Intergenic
1013501000 6:110751195-110751217 GTTCCTAACAGGCCACCAACTGG - Intronic
1014151522 6:118061947-118061969 GTTCCTAACAGGCCACGGACTGG + Intronic
1014304970 6:119728383-119728405 GTTCCTAACAGGACACAGACTGG + Intergenic
1014460446 6:121688322-121688344 GTTCCTAACAGGCCACAGACAGG + Intergenic
1014474650 6:121857655-121857677 GTTCCTAACAGGCCACTGACTGG - Intergenic
1014895900 6:126898658-126898680 GTTCCTAACAGGCCACAGACTGG + Intergenic
1015066805 6:129039889-129039911 GTTCCTAACAGGCCACAGGCTGG + Intronic
1015147720 6:130006009-130006031 GTTCCTAACAGGCTACATACTGG + Intergenic
1015201226 6:130583524-130583546 GTTCCTAACAGGCCACGGACTGG + Intergenic
1015305044 6:131697798-131697820 GTTCCTAACAGGCCACAGACAGG + Intronic
1015553851 6:134440677-134440699 GTTTCTAACAGGCCACAGACTGG - Intergenic
1015672741 6:135708765-135708787 GTTCCTAACGGGCCACGGACTGG + Intergenic
1015942760 6:138468396-138468418 GTTCCTAACAGGCCACAGATGGG - Intronic
1015953730 6:138579194-138579216 GTTCCTAATAGGCCACAGCCTGG + Intronic
1015985663 6:138881875-138881897 GTTCCTAACAGGCCACAGACTGG + Intronic
1016025883 6:139286582-139286604 GTTCCTAACAGGCCACGGACTGG - Intronic
1016196765 6:141353437-141353459 GTTCCTAACGGGCCACAGAGGGG - Intergenic
1016666908 6:146652928-146652950 GTTCCTAACAGGCCACAGATTGG - Intronic
1016757012 6:147698185-147698207 GTTCCTAACAGGCCACAGACCGG + Intronic
1017061015 6:150485080-150485102 GTTCCTAACAAGCCACAGACCGG + Intergenic
1017093759 6:150785733-150785755 GTTCCTAACAGGTCACAAACTGG - Intronic
1017216280 6:151911111-151911133 GTTCCTAACAGGCCATGAACTGG + Intronic
1017735597 6:157360088-157360110 GTTCCTAACAGGCCATAGACAGG + Intergenic
1018097021 6:160397366-160397388 GTTCCTAACAGGCCACAAACTGG + Intronic
1018489301 6:164275414-164275436 GTTCCTAACAGGCCACAGACTGG - Intergenic
1018751957 6:166814462-166814484 GTTCCTAACAGGCCACGGGCTGG - Intronic
1020130890 7:5558037-5558059 GTACCCAACGGGACACAGGCAGG + Intronic
1020826489 7:13035542-13035564 ATTCCTAACGGGCCACAGACAGG - Intergenic
1021554361 7:21904445-21904467 GTTCCAAACAGGCCACAGACTGG - Intronic
1021749979 7:23787448-23787470 GTTCTTAACAGGCCACAGACTGG - Intronic
1023277523 7:38535876-38535898 GTTCCTCACCGGCCACAAACTGG + Intronic
1023327030 7:39071420-39071442 GTTCCTAACAGGCCACAGACTGG + Intronic
1023383922 7:39635849-39635871 GTTCCTAACAGGCCACAGACTGG + Intronic
1023549098 7:41349914-41349936 GTTCCTAACAGGCCACGGACCGG - Intergenic
1023591005 7:41780509-41780531 GTTCCTAACAGGCCACAGACTGG - Intergenic
1024071094 7:45786124-45786146 GCTCCTAACGGGCTATATGCAGG - Intergenic
1024410408 7:49034235-49034257 GTTTCTAACAGGCCACAGACTGG + Intergenic
1024690424 7:51795490-51795512 GTTCCTAACAGGCCACAGACAGG + Intergenic
1025104732 7:56161804-56161826 GTTCCTAACAGGTCACAGACTGG - Intergenic
1025105924 7:56172046-56172068 GTTCCTAACAGGCTACATACTGG + Intergenic
1025218775 7:57086136-57086158 GTTCCTAACAGGCCACGGACTGG - Intergenic
1025235048 7:57228733-57228755 GTACAAAACAGGCCACAAGCTGG - Intergenic
1025625607 7:63218617-63218639 GTTCCTAACAGGCCATAGCCTGG + Intergenic
1025629700 7:63259724-63259746 GTTCCTAACAGGCCACGGACTGG - Intergenic
1025652574 7:63484303-63484325 GTTCCTAACAGGCCACGGACTGG + Intergenic
1026149607 7:67776833-67776855 GTTCCTAACAGGCCAGAAACAGG + Intergenic
1026300543 7:69094055-69094077 GTTCCTGACAGGCCACAGACTGG + Intergenic
1026310101 7:69175852-69175874 GTTGCTAACAGGCCACAGACCGG - Intergenic
1026313781 7:69210866-69210888 GTTCCTAACAGGCCACAGACTGG - Intergenic
1026316032 7:69228457-69228479 GTTCCTAACAGGTCACAGACTGG + Intergenic
1026574738 7:71562727-71562749 GTTCCTAACAGGCCATCAACTGG + Intronic
1026620446 7:71945480-71945502 GTTCCTAACAGGCCACAGACTGG - Intronic
1027195882 7:76029943-76029965 GTTCCTAACAGACCACAGACTGG + Intronic
1027398784 7:77786397-77786419 GTTCCTAATAGGCCACGGGCTGG + Intergenic
1027787802 7:82602176-82602198 ATTCCTAACAGGCCACATACCGG - Intergenic
1028181877 7:87733844-87733866 GTTCCTAACAGGCCACGGACAGG + Intronic
1028297109 7:89147587-89147609 GTTCCTAACAGGCAACAGACTGG - Intronic
1029034396 7:97503588-97503610 GTTCTTAACAGGCCACAGACCGG - Intergenic
1029151009 7:98480477-98480499 GTTCCTAACAGGCCATGAACTGG - Intergenic
1029431793 7:100535999-100536021 GTTCCTAACAGGCCACAGACAGG + Intergenic
1031045200 7:116879705-116879727 GTTCCTAACAGGCCCCAGACTGG + Intronic
1031221850 7:118976535-118976557 GTTCCTAACAGGCCACAAAGGGG + Intergenic
1031826747 7:126575105-126575127 GTTCCTAACAGGCCACAAACCGG - Intronic
1032446093 7:131984874-131984896 GTTCCTAACAGGCCACAGAGTGG - Intergenic
1032615124 7:133460320-133460342 GTTCCTAACAGGCCATGGGCTGG + Intronic
1032878848 7:136067027-136067049 GTTCCTAACAGGCCACGAACTGG + Intergenic
1033292520 7:140099542-140099564 GTTCCTAACAGGCCACGGACTGG - Intronic
1033479826 7:141728705-141728727 GTTCCTAACAGGCCACAGACTGG - Intronic
1034007991 7:147495809-147495831 GTTCCTAAAAGGCCACAAACTGG - Intronic
1034046178 7:147930048-147930070 GTTCCTAACAGGCCACAGACTGG + Intronic
1034144162 7:148853559-148853581 GTTCCTAACGGGCCACAGACGGG + Intronic
1035015061 7:155758582-155758604 GTTCCTAACAGGCCACAGACTGG + Intronic
1035286092 7:157808137-157808159 GTTCCTAACAGGCCACAGACTGG - Intronic
1036005089 8:4653013-4653035 GTTCCTAACAGGCCACAGATAGG + Intronic
1036116029 8:5961722-5961744 GTTCCTAACAGGCTACAAACTGG + Intergenic
1036132751 8:6131697-6131719 GTTCCTAACAGGCCACAAACAGG + Intergenic
1036159700 8:6375693-6375715 GTTCCTAACAGGCCACAAACTGG - Intergenic
1036172017 8:6496420-6496442 GTTCCTAATAGGCCACAGACTGG + Intronic
1036431689 8:8697999-8698021 GTTCCTGACAGGCCACAGACTGG - Intergenic
1036586300 8:10126979-10127001 GTTCCCAACAGGCCACAGCCTGG + Intronic
1037109962 8:15154118-15154140 GTTCCTAACAGGCCATGAACTGG + Intronic
1037530334 8:19766614-19766636 GTTCCTAACAGGCCAGAGACTGG - Intergenic
1037603613 8:20419538-20419560 GTTCCTAACAGGCCACTGACTGG + Intergenic
1037690392 8:21176907-21176929 GTTCCTAACAGGCCACAGACTGG + Intergenic
1038191088 8:25321731-25321753 GTTCCTAACAGGCCACAGACTGG + Intronic
1038285237 8:26200518-26200540 GTTCCTAACAGGCCATGAACTGG - Intergenic
1038351569 8:26780655-26780677 GTTTCTAACAGGCCACAGACTGG - Intronic
1038676008 8:29623555-29623577 GTTCCTAACAGGCCACGGACTGG + Intergenic
1038706586 8:29899570-29899592 GTTCCTAACAGGCCACAGACTGG - Intergenic
1038749519 8:30282702-30282724 GCTCTTAACGGGGCACAAGCAGG - Intergenic
1039042333 8:33419561-33419583 GTTCCTAACAGGCCACGGACAGG + Intronic
1039114241 8:34074493-34074515 GTTCCTAACAGGCCACAGATGGG + Intergenic
1039961094 8:42248306-42248328 ATTCCTAACAGGCCACAGACCGG + Intergenic
1040031094 8:42824428-42824450 GTTCCTAACAGGCCACAGACTGG + Intergenic
1040099682 8:43487458-43487480 GTTCCTAACAGGCCATGGGCTGG + Intergenic
1040858975 8:51979393-51979415 GTTCCTAACAGGCCACAGAGCGG + Intergenic
1041498547 8:58514337-58514359 GTTCCTAAAAGGCCACAGACGGG - Intergenic
1041835632 8:62210200-62210222 GTTCCTAACAGGACACAAATAGG - Intergenic
1041928266 8:63260278-63260300 GTTCCTAACAGGCCACAGACTGG - Intergenic
1042981424 8:74533196-74533218 GTTCCTAACAGGCCAGGAACCGG + Intergenic
1043285034 8:78517270-78517292 GTTGGTACAGGGCCACAAGCAGG - Intronic
1043417920 8:80070639-80070661 GTTCCTAACAGGCCACAGATGGG + Intronic
1043544698 8:81302180-81302202 GTTCCTAACAGGCCACTGCCGGG - Intergenic
1043781305 8:84339250-84339272 GTTCCCAACAGGCCACAAACTGG - Intronic
1044136711 8:88594761-88594783 GTTCCTAACAGGCCACAGACTGG + Intergenic
1044586791 8:93875895-93875917 GTTCATAACAGGCCACAGGCTGG + Intronic
1044900560 8:96939361-96939383 ATTCCTAACAGGCCACAGACTGG + Intronic
1045175988 8:99725289-99725311 GTTCCTAACAGGCCATGGGCTGG - Intronic
1045283746 8:100772342-100772364 GTTCCTAACAGGCCACAGAAGGG + Intergenic
1045294410 8:100861027-100861049 GTTCCTAACAGGCCACTGACTGG + Intergenic
1045885949 8:107097978-107098000 GTTCCTAACAGGCCACAGAATGG + Intergenic
1045980861 8:108185609-108185631 GTTCCTAACAGGCCACCAACTGG + Intergenic
1046022902 8:108687876-108687898 GTTCCTAACAGGCCACGTACAGG + Intronic
1046163514 8:110397834-110397856 GTCCCTAACAGGCCATAGGCAGG + Intergenic
1046524523 8:115367553-115367575 GTTCCTAACACGCCACAGACTGG - Intergenic
1046534950 8:115497417-115497439 GTTCCTAACAGGCCACAGACTGG + Intronic
1046622497 8:116543157-116543179 GTTCCTAACAGGCCACGGACCGG + Intergenic
1047188551 8:122657412-122657434 GTTCCTAACAGGCCATAGACTGG + Intergenic
1047478632 8:125259294-125259316 GTTCCTAACAGGCCACCGACTGG - Intronic
1047676487 8:127208437-127208459 GTTCCTAACAGGCCACAAAATGG + Intergenic
1048044823 8:130763734-130763756 GTTCCTAACAGGCCACAGACAGG + Intergenic
1048140087 8:131785828-131785850 GTTCCTTACAGGCCACGGGCAGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1048583415 8:135749934-135749956 GTTCTTAACAGGCCACAGACAGG - Intergenic
1048599079 8:135899782-135899804 GTTCCTCACAGGCCACAGGCAGG - Intergenic
1048723760 8:137358434-137358456 GTTCCTAACAGGCCACAGATTGG - Intergenic
1048999997 8:139818994-139819016 GTTCCTAACGGGACATAGACCGG - Intronic
1049626056 8:143621990-143622012 GTTCCTAACAGGCCACAGACCGG + Intergenic
1050131272 9:2415207-2415229 GCTCCTAACAGGCCACCAACAGG + Intergenic
1051000945 9:12280961-12280983 GTTCCTAACAGCCCACAGACTGG + Intergenic
1051286413 9:15501931-15501953 GTTCCTAACAGGCCACGGACGGG - Intronic
1051332065 9:16033265-16033287 TTTCCTAACGGGCCACGGACTGG - Intronic
1051554335 9:18365757-18365779 GTTCCTAACAGGCCACAGATAGG - Intergenic
1051665490 9:19464259-19464281 GTTCCTAACAGGCCACAAAGGGG + Intergenic
1051689571 9:19695989-19696011 GTTCTTAACAGGCCACAGACTGG - Intronic
1051807425 9:21011023-21011045 GTTCTTAATGGGCCACAGACTGG + Intronic
1052038072 9:23705805-23705827 GTTCCTAACAGGCCACGGACTGG + Intronic
1052293128 9:26866933-26866955 GTTCCTAACAGGCCACAGATTGG - Intronic
1052390417 9:27872564-27872586 GTTCCTAACAGGCCACAAACTGG + Intergenic
1053136860 9:35656503-35656525 GAGCCTAACAGGCCACAGGCTGG - Intergenic
1053153166 9:35755758-35755780 CTTCCTAACAGGCCACAGACTGG + Exonic
1053329055 9:37187494-37187516 GTTCCTAACAGGCCACGAACTGG + Intronic
1054809768 9:69425539-69425561 GTTCCTAACAGGCCACAGACTGG - Intergenic
1055539747 9:77291063-77291085 GTTCCTAACAGGTCACAGACCGG - Intronic
1055909324 9:81329314-81329336 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056144088 9:83712017-83712039 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056189175 9:84167828-84167850 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056885055 9:90433752-90433774 GTTCCTAACAGGCCACAGACAGG - Intergenic
1057007164 9:91570380-91570402 GTTCCTAACAGGCCACAGACTGG + Intronic
1057460175 9:95254026-95254048 GTTCCTAACAGGCCACGGACTGG + Intronic
1057699979 9:97356654-97356676 ATTCCTAATGGGCCTCCAGCTGG + Intronic
1058667041 9:107328715-107328737 GTTCCTAACAGGCCAATGGCTGG + Intronic
1058824945 9:108766892-108766914 GTTCCTAACAGGCCACTGACTGG - Intergenic
1059151734 9:111955290-111955312 GCTCCTAACAGGCCACAGACGGG + Intergenic
1059164346 9:112064205-112064227 GTTCCTAACAGGCCACAGACTGG - Intronic
1059347999 9:113645343-113645365 GCTCCTAACAGGCCACAGACTGG - Intergenic
1059795734 9:117694451-117694473 GTTCCTAACAGGCCACAGACTGG - Intergenic
1061527830 9:131182296-131182318 GTTCCTAAGAGGCCACAGACCGG - Intronic
1185742375 X:2544139-2544161 GTTCCTAACAGGCCACAGACTGG - Intergenic
1185811164 X:3112040-3112062 GTTCTTAACAGGCCACGAACAGG + Intronic
1185981513 X:4785120-4785142 GTTCCTAACAGGCCACAGACCGG - Intergenic
1186237800 X:7532245-7532267 GTTCCTAACAGGCCACGAGCCGG + Intergenic
1186565159 X:10654654-10654676 GTTCCTAACAAGCCACAGACTGG + Intronic
1187460673 X:19484144-19484166 GTTCCTAACAGGCCACTGACCGG - Intronic
1188065935 X:25659290-25659312 GTTCCTAACAGGCCACAGACTGG + Intergenic
1188232865 X:27687042-27687064 GTTCCTAACAGGCCACAGACAGG + Intronic
1188333773 X:28902732-28902754 GTTCCTAACAGGCCATATACTGG - Intronic
1189483881 X:41414260-41414282 GCTCCTAACAGGCCACAGACTGG - Intergenic
1189749852 X:44209683-44209705 GTTCCTAACAGGCCACGGACTGG - Intronic
1189880212 X:45483181-45483203 GTTCCTAACAGGCCACAAACTGG + Intergenic
1190027191 X:46935440-46935462 GTTCCTAACAGGCCACAGACTGG - Intronic
1190261513 X:48800733-48800755 TTTCCTACCGGGCTATAAGCTGG - Intergenic
1190402182 X:50048320-50048342 GTTCCTAACAGGCCACAGACTGG + Intronic
1192102263 X:68277370-68277392 GCTCCTAACAGGCCACAGACTGG + Intronic
1192295354 X:69842032-69842054 GTTCCTAACAGGCCACAGATTGG - Intronic
1192407555 X:70901709-70901731 GTTCCTAACAGGCCAGAGACAGG + Intronic
1192496690 X:71620950-71620972 GTTCCTAACAGGCCACAGACCGG + Intergenic
1192548661 X:72035856-72035878 GTTCCAAACAGGCCACAGACTGG - Intergenic
1193037296 X:76965946-76965968 GTTCCTAACAGGCCACGAACCGG + Intergenic
1194945594 X:100063276-100063298 GTTCCTAACAGACCACAGACTGG - Intergenic
1195557258 X:106241177-106241199 GTTTCTAAAGGGACTCAAGCAGG - Intergenic
1195656231 X:107333970-107333992 GTTCCTAACAAGCCACAGACTGG + Intergenic
1195768833 X:108327079-108327101 GTTCCTAACAGGCCACAGACAGG - Intronic
1195922379 X:109996399-109996421 GTTCCTAACAGGCCACAGACTGG + Intergenic
1196754444 X:119145549-119145571 GTTCCTAACAGGCTACAGACTGG - Intronic
1197641711 X:128975231-128975253 GTTCCTAACAGGCCACGGTCTGG + Intergenic
1197840846 X:130744801-130744823 GTTCCTAACAGGCCACGGACCGG - Intronic
1197982142 X:132228283-132228305 GTTCCTAACAGGCCACAGACCGG - Intergenic
1198271076 X:135056416-135056438 GTTCCCAACAGGCCACAGACTGG + Intergenic
1198617680 X:138477545-138477567 GTTCCTAACAGGCCACAGACTGG + Intergenic
1198813950 X:140566863-140566885 GTTCTTAACGGGCCACAGACTGG + Intergenic
1199213844 X:145245090-145245112 GTTTCTAACAGGCCACGAACCGG + Intergenic
1199283955 X:146035748-146035770 GTTCCTAACAGGCCACGGACTGG - Intergenic
1199659929 X:150038571-150038593 GTTCCTAACAGGCCACGGACTGG + Intergenic
1200368507 X:155694929-155694951 GTTCCTAACAGGCCACAGACTGG + Intergenic
1200974470 Y:9193905-9193927 GTTCCTAACAGGACACAGGTGGG - Intergenic
1201238852 Y:11938490-11938512 GTTCCTAACAAGCCACAGACAGG - Intergenic
1201589816 Y:15602820-15602842 GTTCCTAACAGGCCACAGACTGG - Intergenic