ID: 968453444

View in Genome Browser
Species Human (GRCh38)
Location 4:685888-685910
Sequence GAACCCTCTGGGCGTCCTTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968453444_968453453 17 Left 968453444 4:685888-685910 CCACAAGGACGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 8
4: 78
Right 968453453 4:685928-685950 ACAAAGTGTCAGCTCGGCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 140
968453444_968453454 22 Left 968453444 4:685888-685910 CCACAAGGACGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 8
4: 78
Right 968453454 4:685933-685955 GTGTCAGCTCGGCTGTGGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 168
968453444_968453451 -10 Left 968453444 4:685888-685910 CCACAAGGACGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 8
4: 78
Right 968453451 4:685901-685923 CAGAGGGTTCGCTGGGTGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 315
968453444_968453452 11 Left 968453444 4:685888-685910 CCACAAGGACGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 8
4: 78
Right 968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968453444 Original CRISPR GAACCCTCTGGGCGTCCTTG TGG (reversed) Exonic
900786220 1:4652597-4652619 GAACCCCTTGGGCAGCCTTGTGG - Intergenic
904403125 1:30269863-30269885 GAATCCTCTGGAAGTCCTGGGGG + Intergenic
904461331 1:30682105-30682127 GAACCAGCTGGGTGGCCTTGGGG + Intergenic
905412204 1:37778458-37778480 TGATCCTCTGGGCTTCCTTGTGG - Intergenic
912509252 1:110177067-110177089 GAAAACACTGGGCGTGCTTGAGG + Intronic
915650532 1:157307328-157307350 GAAAACTCTGGGTGTCCCTGTGG - Intergenic
915660860 1:157403838-157403860 GAAGACTCTGGGTGTCCCTGTGG + Intergenic
920029727 1:203029239-203029261 GCAACCTCGGGGCCTCCTTGAGG + Intronic
920119051 1:203642023-203642045 TAACCCTCTGGGCGTGCTTCTGG + Intronic
923715693 1:236423105-236423127 GAAATCTCTGGGGGTCCTAGTGG + Intronic
1063618391 10:7622186-7622208 GAGCCCCCTGGGAGTCCTGGTGG - Intronic
1070707801 10:78654075-78654097 GAAGACTCTGGGCTTCCTTGAGG + Intergenic
1075041825 10:119114079-119114101 AAACCCTCTGGGCCTCCTTCTGG - Intronic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1076825409 10:132964819-132964841 GCAGCCGCTGGGCGTCCTGGGGG - Intergenic
1077392142 11:2305035-2305057 GACCACTCTGGGGGTCCCTGAGG + Intronic
1088834904 11:113569249-113569271 GGACACTCTGTGGGTCCTTGGGG - Intergenic
1089576707 11:119449534-119449556 GAACACACTAGGTGTCCTTGAGG - Intergenic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1096786904 12:54022032-54022054 TAAACCTCTGGGTGTCCCTGTGG + Intronic
1096923206 12:55112378-55112400 GAACCATCTCGGAGTCTTTGTGG - Intergenic
1103555857 12:121766084-121766106 GAACCCTACGGGCCTCCTGGGGG + Intronic
1110710400 13:78644573-78644595 GAACTCTCTGGGCTTTTTTGGGG + Intronic
1111725019 13:91996274-91996296 GAACCCTGTTGGAGTCCTAGTGG - Intronic
1115648105 14:35384187-35384209 GACCCCTTTGGCCCTCCTTGAGG - Intergenic
1119554453 14:75542563-75542585 GTCCCCTCTGGCCCTCCTTGGGG - Intronic
1121051161 14:90819826-90819848 GAACCCTCTGGGCTTCACCGTGG + Intergenic
1129726779 15:77905527-77905549 GACCCCTCTGGAGGTACTTGGGG - Intergenic
1130486450 15:84400949-84400971 GACCCCTCTGGAGGTACTTGGGG + Intergenic
1130808418 15:87351527-87351549 GAACAGTCTGGGGGTCATTGTGG - Intergenic
1131671643 15:94626145-94626167 GAAGCCTCTGGGTGGCCCTGAGG + Intergenic
1133008256 16:2896544-2896566 GAACTTTCTGGGCTTCCTGGGGG - Exonic
1133013822 16:2929780-2929802 GAACTCCCTGGGCTTCCTGGGGG - Exonic
1143520529 17:7441789-7441811 GATCCCTGTGGGCCTCCGTGTGG + Exonic
1146398836 17:32488024-32488046 GACCCGTTTGGGCGTCCCTGCGG - Exonic
1146677619 17:34784405-34784427 GAAGCCACTGGAAGTCCTTGAGG + Intergenic
1151722995 17:75868792-75868814 GAAGCCCCTGGTGGTCCTTGTGG - Intergenic
1151767257 17:76138907-76138929 GAAGAGTCTGGGCGTCCTTGGGG + Intronic
1157325304 18:46664586-46664608 AAACTCTCTGGGTGGCCTTGTGG + Intergenic
1160448792 18:78947669-78947691 AAACCCTCTCGGCGTGATTGCGG - Intergenic
1161507538 19:4652025-4652047 GCATCTTCTGGGCCTCCTTGCGG - Exonic
1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG + Intronic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1165829680 19:38724234-38724256 CGATCCTCTGGGCCTCCTTGTGG - Exonic
1166326891 19:42056550-42056572 GAACCCTCTCGCCCTCCCTGAGG - Intronic
1167431295 19:49456085-49456107 GAACCCTCTGGACATTCTTTTGG + Intronic
947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG + Intronic
948754155 2:240149520-240149542 GAGCCCCCTGGGCGTTCTTATGG - Intergenic
1168906390 20:1407388-1407410 GCTCCCTCTGGGGGTCCTAGGGG - Intergenic
1169135514 20:3194899-3194921 GAACCCTGTGGGCTTGCTAGGGG - Intronic
1169673964 20:8133214-8133236 GAACCCTCTTGGCGCTTTTGTGG + Intronic
1175894465 20:62329960-62329982 CAACCCTCTGGGTGTCTTGGGGG - Intronic
1175914007 20:62417303-62417325 CGATCCTCTGGGCGTCCCTGTGG + Exonic
1176091666 20:63321085-63321107 GGACTCACTGGGGGTCCTTGAGG - Exonic
1176110370 20:63408122-63408144 GATCCCTCAGGGGTTCCTTGTGG - Intronic
1180175326 21:46084401-46084423 GAACCCTCCTGCCGTCCTGGGGG + Intergenic
1183704557 22:39468906-39468928 GAAACTTCTGTGCCTCCTTGAGG + Intronic
955507260 3:59644860-59644882 GAACCCTCTGTGCCCGCTTGGGG - Intergenic
962927888 3:140011931-140011953 GAACCCTCTGGGAGACCTGAAGG + Intronic
966681213 3:182643798-182643820 GAGCCCTCTGGGCTTCATTCTGG + Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
971254338 4:25000619-25000641 GATCCCTCTGTGCGGCCATGTGG - Exonic
971756683 4:30717298-30717320 GAGCCCTCGGGGCGCCCTTGCGG - Intergenic
977848216 4:101791093-101791115 GAACCCTCTGGGCTGCCTGGCGG - Intronic
979099579 4:116598655-116598677 CGATCCTCTGGGCCTCCTTGTGG - Intergenic
989565176 5:42894477-42894499 GGACCCTCTTGCCGTCCCTGCGG + Intergenic
996884276 5:128337725-128337747 GAGCCCTGTGGAAGTCCTTGTGG - Intronic
998936446 5:147234709-147234731 GTACCCGCTGTGCGTCCTGGTGG + Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1006787036 6:36675219-36675241 GAACTCTATGAGAGTCCTTGTGG - Intergenic
1007318831 6:41011599-41011621 GGACCCTCAGGGAGGCCTTGTGG - Intergenic
1008050188 6:46893221-46893243 CAACCCTCTTGGCTTGCTTGAGG + Intronic
1014717787 6:124886372-124886394 GAACCTTCTGGACCTCCCTGAGG - Intergenic
1017812605 6:157994873-157994895 GAACCCCCTGGGACTCCCTGGGG - Intronic
1018937473 6:168283257-168283279 GAGCCCTCTGGGCCTCCTGTAGG + Intergenic
1022902365 7:34823835-34823857 GAGCCCTCTGGGGGTCACTGTGG - Intronic
1028962649 7:96766769-96766791 GAACCCTATTGGCTTCCTTCTGG - Intergenic
1033082334 7:138310101-138310123 TATCCCTGTGGGCTTCCTTGAGG - Intergenic
1037977913 8:23226090-23226112 GAACTCCCAGGGCGACCTTGGGG + Intergenic
1039911863 8:41832684-41832706 GAACCCTCTGGGAACCCTGGGGG - Intronic
1049324425 8:142014651-142014673 GAAGCATCTGGACGTCCCTGCGG - Intergenic
1049944584 9:581248-581270 GCCCCCTCTGGCCGTGCTTGAGG - Intronic
1060216216 9:121740021-121740043 GACCCCACTGGGTCTCCTTGAGG - Intronic
1060407042 9:123377957-123377979 GGACCGTCTGGGTGTCCTTCTGG + Exonic
1191899173 X:66023185-66023207 GGACTCTCTGGGGATCCTTGGGG - Intronic
1197785091 X:130190852-130190874 CAACCCACTGGGCTTCCTGGAGG - Intergenic
1202368980 Y:24184791-24184813 GACCCCTCTGGAGGTACTTGAGG + Intergenic
1202501805 Y:25485326-25485348 GACCCCTCTGGAGGTACTTGAGG - Intergenic