ID: 968453449

View in Genome Browser
Species Human (GRCh38)
Location 4:685899-685921
Sequence GCCCACCCAGCGAACCCTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968453449_968453454 11 Left 968453449 4:685899-685921 CCCAGAGGGTTCGCTGGGTGGGC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 968453454 4:685933-685955 GTGTCAGCTCGGCTGTGGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 168
968453449_968453453 6 Left 968453449 4:685899-685921 CCCAGAGGGTTCGCTGGGTGGGC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 968453453 4:685928-685950 ACAAAGTGTCAGCTCGGCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 140
968453449_968453452 0 Left 968453449 4:685899-685921 CCCAGAGGGTTCGCTGGGTGGGC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968453449 Original CRISPR GCCCACCCAGCGAACCCTCT GGG (reversed) Exonic
903304247 1:22401491-22401513 CCCCACCCACCGGCCCCTCTCGG + Intergenic
905867238 1:41382793-41382815 GCCCAGCTAGGGACCCCTCTCGG + Exonic
908050922 1:60229526-60229548 ACGCACACAGCAAACCCTCTGGG + Intergenic
912222138 1:107690285-107690307 GGTCACCCAGAGAACCCTCATGG - Intronic
914823360 1:151122602-151122624 GCCCAACCAGCTCACTCTCTGGG + Exonic
1063592295 10:7406972-7406994 TCCCCCCCCGCCAACCCTCTAGG - Intronic
1063623224 10:7667273-7667295 GCCCACCCTGCGTCCCCTCCTGG + Intergenic
1071569800 10:86690676-86690698 TCCCAGCCAGCCAGCCCTCTGGG + Intronic
1073076494 10:100828076-100828098 GCCCCTCCAGCGAAGCCTCCTGG - Exonic
1073426291 10:103457595-103457617 GCTCACCCATCCAAGCCTCTCGG - Intronic
1073452349 10:103617417-103617439 GCCAACCCAGTGGACCTTCTTGG - Intronic
1077545074 11:3165549-3165571 GCCCACCCCGCCAAGCCTCCTGG - Intronic
1083826396 11:65206406-65206428 GCCCACTCAGCCCACCCTCAGGG - Intronic
1083998292 11:66282924-66282946 GCCCACCCACCGTGACCTCTGGG - Intronic
1084401032 11:68942971-68942993 GCCCACTCTGGGATCCCTCTGGG - Intergenic
1084401292 11:68944975-68944997 GCCCACTCTGGGATCCCTCTGGG + Intergenic
1084568968 11:69948380-69948402 GCCCACCCAGCACAGGCTCTGGG - Intergenic
1084943990 11:72629184-72629206 GCCGACCCAGGGAAGCCTCATGG + Intronic
1088581286 11:111319333-111319355 GCCCAACCCGTGATCCCTCTAGG - Intergenic
1091548278 12:1518918-1518940 GCACACCCAGCCCACCGTCTTGG + Intergenic
1091912800 12:4245322-4245344 GCCCCCCCATCGTACCCCCTGGG - Intergenic
1094168576 12:27467107-27467129 GACCACCCAGATTACCCTCTTGG - Intronic
1101593292 12:106140789-106140811 GGCCACACAGCCAATCCTCTGGG - Intergenic
1102186153 12:110950593-110950615 GCCCAGCCAGCGCCCCGTCTGGG - Intergenic
1117583225 14:57173812-57173834 GCCCAACTAGCCAACCATCTGGG - Intergenic
1118043094 14:61938416-61938438 TCCCACCCAGCCAACCCTGAAGG - Intergenic
1125603581 15:40928191-40928213 GGCCACCCAGGGGACCCTCTCGG + Intergenic
1127309863 15:57743163-57743185 GCCCACTCAGAGACCCCTCAGGG + Intronic
1133223085 16:4327668-4327690 GCCCGCCCAGCCCACCCTCCGGG + Intronic
1142264305 16:89056763-89056785 GCCCACCCTGCAGACCCTCCTGG + Intergenic
1142397892 16:89843138-89843160 TCCCACCCAGCGCAGCATCTTGG + Intronic
1144495676 17:15743321-15743343 CCCCTCCCAGGGAACCCTCCTGG + Intronic
1144504334 17:15817348-15817370 GCCCACCCAGCGCCCCTCCTGGG - Intergenic
1144638523 17:16925503-16925525 CCCCTCCCAGGGAACCCTCCTGG - Intergenic
1144968692 17:19093739-19093761 GCCCAGGCAGGGACCCCTCTGGG + Exonic
1144979222 17:19158327-19158349 GCCCAGGCAGGGACCCCTCTGGG - Exonic
1144989000 17:19219905-19219927 GCCCAGGCAGGGACCCCTCTGGG + Exonic
1145065307 17:19757757-19757779 GCCCACCCAGCAAGCCTCCTGGG + Intergenic
1147382800 17:40065635-40065657 GCCCCCCCTGCGCAGCCTCTGGG + Intronic
1151987844 17:77555646-77555668 GCCCACCCACCCCTCCCTCTCGG - Intergenic
1153227422 18:2909237-2909259 GCCCACCCAGTGATCCCCTTGGG - Intronic
1155044910 18:22095134-22095156 GCCCACCCAGGAATCCCTCAGGG - Intronic
1161283328 19:3457048-3457070 GGCCACCCCGCGGTCCCTCTAGG - Intronic
1163220400 19:15914400-15914422 CCCCACCCAGCAAGCCTTCTTGG - Intronic
1163228489 19:15981004-15981026 CCCCACCCAGCAACCCTTCTTGG - Intergenic
1163608059 19:18286604-18286626 TCCCAGCCAGAGAGCCCTCTGGG + Intergenic
1164480136 19:28605266-28605288 CCCCACCCACCTGACCCTCTAGG + Intergenic
1167623396 19:50570866-50570888 GAACAACCAGCGAACCCTCTTGG + Intergenic
928238830 2:29569098-29569120 GCCCCACCAGCAAGCCCTCTGGG + Intronic
931094288 2:58921744-58921766 AGACACCCAGTGAACCCTCTGGG - Intergenic
934680081 2:96277502-96277524 GCTCACCCACCTGACCCTCTAGG + Intronic
936008225 2:108908578-108908600 GCCCACCCAGCTCACCCGCTGGG - Intronic
939134874 2:138281604-138281626 GGCCACCCTGTGAACCCTCATGG - Intergenic
947325713 2:228974356-228974378 GCCAACCCAGCCAACTCTGTGGG + Intronic
947807331 2:232977711-232977733 GCTCACCCAGCAAACCCTGCTGG + Intronic
947967491 2:234293883-234293905 GCCCCCCCAGAAAGCCCTCTGGG + Intergenic
948547539 2:238743410-238743432 GACCACACAGAGACCCCTCTGGG + Intergenic
1171490696 20:25515013-25515035 GCCCACCCAGAGTCCCCACTGGG + Intronic
1173315963 20:41943185-41943207 GCCCACCCAGGGATCTTTCTAGG + Intergenic
1174044795 20:47725892-47725914 GCCCACACAGCGAGTCCTTTGGG - Intronic
1174295712 20:49543627-49543649 GCCCACCACGCCAACACTCTAGG - Intronic
1175242862 20:57562674-57562696 GCCCACCCATCGCACCCTGTAGG + Exonic
1176033699 20:63026130-63026152 GGCCACCCAGCCGCCCCTCTCGG - Intergenic
1179110072 21:38438750-38438772 ACCCACCCAGCGAATGATCTGGG - Intronic
1185223466 22:49640446-49640468 CCCCATCCAGCCCACCCTCTAGG + Intronic
952335699 3:32401516-32401538 GCCCACACAGGGAATCCCCTAGG - Intronic
954367845 3:50155606-50155628 GGCCACCCCGCGACCCCTCTGGG + Intronic
955937205 3:64113195-64113217 ACCCCCACAGCAAACCCTCTGGG - Intronic
968087808 3:195881793-195881815 CCCCACCCAGCAAAGCCCCTTGG + Intronic
968453449 4:685899-685921 GCCCACCCAGCGAACCCTCTGGG - Exonic
976316804 4:83667169-83667191 GCCCACCCAGCTAGCCAGCTGGG - Intergenic
981206928 4:142053182-142053204 GTCCTCCCAGCCAACCCTCCAGG - Intronic
984762626 4:183376370-183376392 GCCCTCCAAGTGGACCCTCTGGG + Intergenic
985757553 5:1727963-1727985 TCCCACCCAGCGGACGCCCTGGG - Intergenic
986503495 5:8426114-8426136 ACCCATCCAGGGAATCCTCTTGG + Intergenic
993032551 5:82721932-82721954 GCACACCCAGCCAACTCACTAGG + Intergenic
998087954 5:139342057-139342079 AACCACCCAGGGAACCCTTTAGG - Intronic
999380235 5:151116430-151116452 GCCCAGCCATAGAACCCTCAGGG + Intronic
1001284993 5:170416308-170416330 GCCCACCCCTCTAACCCTCATGG + Intronic
1006741021 6:36309060-36309082 GCCCATCCAGGGACCCCACTTGG - Intergenic
1012168645 6:95990577-95990599 GCCCACTCTGTGAACCCTCCAGG + Intergenic
1016259225 6:142147522-142147544 GCCTACCCAGGGAACTCCCTGGG + Intronic
1020125357 7:5530219-5530241 GCCCACCCTGCGATCCCCATTGG + Intronic
1026152817 7:67802619-67802641 GCCCCGCCAGGGTACCCTCTGGG - Intergenic
1026589883 7:71685354-71685376 ACTGACCCAGTGAACCCTCTGGG + Intronic
1027350380 7:77305984-77306006 GGCCACCCAGCGAATCTGCTTGG + Intronic
1029287030 7:99472838-99472860 TCCCAGCCAGCGGCCCCTCTAGG - Exonic
1034497740 7:151432363-151432385 GGCCACCCAGCAACCCCTCCCGG + Intronic
1034873800 7:154706818-154706840 ACCCACCCAGAGAAATCTCTTGG - Intronic
1037430602 8:18809068-18809090 GCCAACTCAGTGATCCCTCTCGG + Intronic
1037647385 8:20804966-20804988 GCCCAGCCACCCAACCGTCTGGG - Intergenic
1040278896 8:46027827-46027849 GCCCACCCAGCGACCTCTTCAGG + Intergenic
1048111362 8:131472212-131472234 CCCCACCCAGAGACCCCACTGGG + Intergenic
1055602981 9:77939022-77939044 TCACACCCAGAGAACCCTCAAGG - Intronic
1186685728 X:11922743-11922765 GCTCCCACACCGAACCCTCTGGG - Intergenic
1187888171 X:23908130-23908152 GCCCTCCAAGCGCCCCCTCTCGG - Exonic
1199878415 X:151953737-151953759 GCCCACCCAGGGCACACTGTCGG - Exonic