ID: 968453450

View in Genome Browser
Species Human (GRCh38)
Location 4:685900-685922
Sequence CGCCCACCCAGCGAACCCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968453450_968453454 10 Left 968453450 4:685900-685922 CCAGAGGGTTCGCTGGGTGGGCG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 968453454 4:685933-685955 GTGTCAGCTCGGCTGTGGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 168
968453450_968453456 30 Left 968453450 4:685900-685922 CCAGAGGGTTCGCTGGGTGGGCG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 968453456 4:685953-685975 TGGCTTCATCGCCAGCCCACAGG 0: 1
1: 0
2: 1
3: 16
4: 133
968453450_968453453 5 Left 968453450 4:685900-685922 CCAGAGGGTTCGCTGGGTGGGCG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 968453453 4:685928-685950 ACAAAGTGTCAGCTCGGCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 140
968453450_968453452 -1 Left 968453450 4:685900-685922 CCAGAGGGTTCGCTGGGTGGGCG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968453450 Original CRISPR CGCCCACCCAGCGAACCCTC TGG (reversed) Exonic
900888484 1:5432198-5432220 CGCTCACCCCGCTCACCCTCCGG + Intergenic
902236435 1:15060399-15060421 CGTCCACCCAGGGAGCACTCTGG + Intronic
908050921 1:60229525-60229547 CACGCACACAGCAAACCCTCTGG + Intergenic
910511391 1:88009902-88009924 TTCCCACCAAGGGAACCCTCAGG + Intergenic
911527635 1:99005052-99005074 CGCCCACGCAGCGCCTCCTCCGG - Intergenic
912381597 1:109250566-109250588 CGCCCACCCAGGGACTCTTCTGG - Exonic
917968587 1:180193679-180193701 CTCCCACCCACTGGACCCTCTGG - Intronic
1071569799 10:86690675-86690697 CTCCCAGCCAGCCAGCCCTCTGG + Intronic
1071882902 10:89918735-89918757 CTCCCACCTAGAGGACCCTCTGG - Intergenic
1072694496 10:97593126-97593148 CACCCTCCCAGCCAACTCTCAGG - Intronic
1072698032 10:97618575-97618597 AGCCCACCCAGCAGAGCCTCAGG - Intronic
1074157539 10:110811909-110811931 CGCCCACCCCGCACACCCCCAGG + Intronic
1076898351 10:133325157-133325179 GGCCCACCCAGGGGAGCCTCGGG - Intronic
1079460446 11:20673548-20673570 CCCCCACCCAGGGAATGCTCGGG - Intronic
1083367764 11:62151796-62151818 CTACCACCCACCGAACCTTCTGG + Exonic
1083826397 11:65206407-65206429 TGCCCACTCAGCCCACCCTCAGG - Intronic
1084650946 11:70488866-70488888 AACACACCCAGAGAACCCTCAGG - Intronic
1086025419 11:82284638-82284660 AGGCCACCCAGAGAACTCTCTGG - Intergenic
1087951316 11:104223520-104223542 CCCTCACTCAGCGACCCCTCTGG + Intergenic
1096672665 12:53209498-53209520 CCCTCACCCAGGGAGCCCTCTGG - Intergenic
1102186154 12:110950594-110950616 CGCCCAGCCAGCGCCCCGTCTGG - Intergenic
1102204915 12:111083699-111083721 CGCCCACCGAGCAAACTCACAGG + Intronic
1105418150 13:20231280-20231302 CGCCCACCCAGGGGACACTGAGG + Intronic
1113945445 13:114041440-114041462 CGCCTTCACAGCGAAGCCTCTGG - Intronic
1117637119 14:57755189-57755211 CGCCAACACAGCGAGCCCTGTGG - Intronic
1118477581 14:66132814-66132836 CTCCCACCCAGTCAAGCCTCAGG - Intergenic
1118775597 14:68972035-68972057 CTCCCACCCTGCCAACCCTGGGG + Intronic
1119742959 14:77026225-77026247 CGCGCCCCCAGCGCACCCCCGGG - Exonic
1119889894 14:78174818-78174840 CGTCCACCAAGCGAACCCGTGGG + Intergenic
1121712574 14:96050571-96050593 CGCCCACAGAGAGAACCCTGGGG - Intronic
1123403917 15:20009544-20009566 CGCCCACCCAGACAATCCTGGGG - Intergenic
1123513257 15:21016190-21016212 CGCCCACCCAGACAATCCTGGGG - Intergenic
1124784440 15:32666444-32666466 CTCCCACTCAGCGAGCCCTTTGG + Intronic
1125019623 15:34971842-34971864 CCTCCACCCACCCAACCCTCTGG + Intergenic
1127309862 15:57743162-57743184 TGCCCACTCAGAGACCCCTCAGG + Intronic
1131827809 15:96334097-96334119 CGCCGACCCAGCCGACCCACGGG + Exonic
1132319030 15:100911296-100911318 CGCCCACCCACGGGCCCCTCCGG + Intronic
1132671261 16:1103058-1103080 CGCGCACCCAGCTCACCCGCGGG - Intergenic
1133223084 16:4327667-4327689 GGCCCGCCCAGCCCACCCTCCGG + Intronic
1136550090 16:30978445-30978467 TGCCTCCCCAGCGTACCCTCAGG - Intronic
1138512212 16:57515282-57515304 CTTCCAGCCAGGGAACCCTCCGG - Intronic
1141190255 16:81819456-81819478 GGTCCACCCAGCTAAGCCTCAGG - Intronic
1141442238 16:84036952-84036974 CCCCCAGCCAGCCACCCCTCGGG + Intronic
1141488608 16:84356849-84356871 CGCCCACCCCGGGAAGCCTGGGG - Intergenic
1142036590 16:87866083-87866105 CGCCCCCCCATAGAACCCTGTGG - Intronic
1143595191 17:7909762-7909784 CTACCACCCATCCAACCCTCTGG + Intronic
1144504335 17:15817349-15817371 CGCCCACCCAGCGCCCCTCCTGG - Intergenic
1144836324 17:18158392-18158414 CGCCCACCCACCCATCCCTGTGG - Intronic
1146472615 17:33136739-33136761 TGCTCACCCACGGAACCCTCAGG + Intronic
1148437271 17:47694249-47694271 TGCCCACCCCGCGACCCCTGGGG - Intronic
1151589390 17:75033664-75033686 CAACCACCAAGCGGACCCTCGGG + Intronic
1152435542 17:80274088-80274110 CACGCACCCAGCGGACGCTCAGG - Intronic
1152445020 17:80337427-80337449 CGCCCACCCAGCGCCCCAGCTGG - Intronic
1153973412 18:10246512-10246534 CTCCCATCCAGGGAACCCTGCGG - Intergenic
1155044911 18:22095135-22095157 GGCCCACCCAGGAATCCCTCAGG - Intronic
1156497942 18:37538121-37538143 CTCCCACCCCGCCATCCCTCTGG - Intronic
1157558593 18:48630287-48630309 CGCCCACCCCCCCAACCCTGAGG - Intronic
1160972102 19:1774117-1774139 CGAGCACCCAGTGGACCCTCTGG - Intronic
1161861480 19:6801545-6801567 CGCCCTCTCTGGGAACCCTCGGG + Intronic
1163608058 19:18286603-18286625 CTCCCAGCCAGAGAGCCCTCTGG + Intergenic
1167647859 19:50715533-50715555 CCCCAAGCCAGCGATCCCTCTGG - Intronic
927971406 2:27307978-27308000 CGCTCGCCCGGCGACCCCTCCGG + Intronic
928405536 2:31011703-31011725 CTCCCTCCCAGCTACCCCTCAGG + Intronic
930697017 2:54422146-54422168 CACCCACACAGCGAACCCACAGG - Intergenic
933759690 2:85665121-85665143 CCCCCACCCAGGGGACCCTGGGG - Intronic
936008226 2:108908579-108908601 CGCCCACCCAGCTCACCCGCTGG - Intronic
948686088 2:239670552-239670574 GGACCACCCAGAGGACCCTCGGG - Intergenic
1172840671 20:37901414-37901436 CCCCCACCCCCCGAACCTTCTGG - Intergenic
1176307016 21:5128875-5128897 CTCCCACGGAGCGACCCCTCCGG + Intergenic
1179850043 21:44133155-44133177 CTCCCACGGAGCGACCCCTCCGG - Intergenic
1180016215 21:45086491-45086513 CGCGCACCCAGCCCAGCCTCAGG + Intronic
1184361987 22:44024359-44024381 CGCCCACCCCGCGGCCCCGCAGG + Intronic
1184657529 22:45949330-45949352 CGCCCACCCACCCTGCCCTCCGG + Intronic
1184697963 22:46150377-46150399 CGCCCGCCCCGCGCGCCCTCCGG - Intergenic
1184728883 22:46362399-46362421 CGCACACACAGCGAACACTGGGG + Exonic
1185420384 22:50731497-50731519 AGCCCACCCAGCGCACAGTCAGG + Intergenic
954367844 3:50155605-50155627 GGGCCACCCCGCGACCCCTCTGG + Intronic
955937206 3:64113196-64113218 CACCCCCACAGCAAACCCTCTGG - Intronic
968453450 4:685900-685922 CGCCCACCCAGCGAACCCTCTGG - Exonic
984999738 4:185471433-185471455 CGCCCGCCCAGCGCGCCCTCGGG - Intronic
985312292 4:188615647-188615669 TGGCCACCCAGCCAACCCGCTGG - Intergenic
985651055 5:1107759-1107781 CGCCCACTCAGAGAAGCCTGGGG + Intronic
985757554 5:1727964-1727986 CTCCCACCCAGCGGACGCCCTGG - Intergenic
992413646 5:76532469-76532491 CCCCCACCCACCCAATCCTCAGG - Intronic
999380234 5:151116429-151116451 TGCCCAGCCATAGAACCCTCAGG + Intronic
1003218473 6:4135893-4135915 CGCCCACGCACCGACCCCCCCGG - Intergenic
1013048047 6:106507428-106507450 CACCCAGCCTGGGAACCCTCAGG + Intergenic
1018361898 6:163078964-163078986 CACCCTCCCAGCGTACCCACAGG - Intronic
1026589882 7:71685353-71685375 CACTGACCCAGTGAACCCTCTGG + Intronic
1048111360 8:131472211-131472233 CCCCCACCCAGAGACCCCACTGG + Intergenic
1050066548 9:1765805-1765827 AAGCCAGCCAGCGAACCCTCTGG + Intergenic
1053353049 9:37425632-37425654 TGTCCACCCAGCGAGGCCTCCGG - Intronic
1056621412 9:88217816-88217838 TGCCCACCCAGCGTGCCCTGTGG + Intergenic
1059375393 9:113876634-113876656 CCCCCACCCAGCGCCCCCTCCGG + Intronic
1061999653 9:134209577-134209599 TGCCCACCCAGCCCAGCCTCAGG - Intergenic
1062621371 9:137423809-137423831 CCCCGACCCAGCGAACGCCCCGG + Intronic
1190227821 X:48559724-48559746 GGCCCAGCGAGCGAACCCTGAGG + Exonic
1195724742 X:107902935-107902957 CGCCCACCCAGCCAGCCCAGGGG + Intronic