ID: 968453451

View in Genome Browser
Species Human (GRCh38)
Location 4:685901-685923
Sequence CAGAGGGTTCGCTGGGTGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 315}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968453437_968453451 24 Left 968453437 4:685854-685876 CCCTTCTTGACCAGCACAGGGGA 0: 1
1: 0
2: 0
3: 7
4: 152
Right 968453451 4:685901-685923 CAGAGGGTTCGCTGGGTGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 315
968453444_968453451 -10 Left 968453444 4:685888-685910 CCACAAGGACGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 8
4: 78
Right 968453451 4:685901-685923 CAGAGGGTTCGCTGGGTGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 315
968453438_968453451 23 Left 968453438 4:685855-685877 CCTTCTTGACCAGCACAGGGGAC 0: 1
1: 0
2: 1
3: 7
4: 137
Right 968453451 4:685901-685923 CAGAGGGTTCGCTGGGTGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 315
968453433_968453451 29 Left 968453433 4:685849-685871 CCTCACCCTTCTTGACCAGCACA 0: 1
1: 0
2: 2
3: 20
4: 228
Right 968453451 4:685901-685923 CAGAGGGTTCGCTGGGTGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 315
968453439_968453451 14 Left 968453439 4:685864-685886 CCAGCACAGGGGACAGCACATTG 0: 1
1: 0
2: 2
3: 18
4: 236
Right 968453451 4:685901-685923 CAGAGGGTTCGCTGGGTGGGCGG 0: 1
1: 0
2: 5
3: 24
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968453451 Original CRISPR CAGAGGGTTCGCTGGGTGGG CGG Exonic
900494999 1:2972260-2972282 CACAGGGTACGCTGGATGGCAGG + Intergenic
901628417 1:10636274-10636296 GAGAGGGTTGGCTGGGGTGGGGG + Intergenic
903466317 1:23554751-23554773 CAGCGACTCCGCTGGGTGGGGGG + Intergenic
904250653 1:29221756-29221778 CTGTGAGTTGGCTGGGTGGGTGG + Intronic
904493543 1:30874523-30874545 CAGAGGTTCCGGTGAGTGGGGGG - Exonic
904839708 1:33364474-33364496 CAGTGGGTTGGCTGGGCAGGAGG + Intronic
905284453 1:36870227-36870249 CAGGGGGTTAGCAGGGTTGGGGG - Intronic
906143699 1:43548002-43548024 CACAGGGTGTGCTGGGTAGGTGG + Intronic
906243695 1:44258349-44258371 GTGAGGGGTGGCTGGGTGGGTGG - Intronic
907421664 1:54351879-54351901 CAGATGTTTGGATGGGTGGGTGG - Intronic
911721899 1:101200228-101200250 CAGAGGGATGGCTGAGTAGGGGG - Intergenic
913093716 1:115497071-115497093 GAGAGGGTTGGCTGGGGGAGGGG - Intergenic
915227790 1:154423510-154423532 CAGAGGGCTGAGTGGGTGGGAGG + Intronic
916442655 1:164842759-164842781 CTGAGGGGTCACAGGGTGGGAGG - Intronic
917968588 1:180193680-180193702 CAGAGGGTCCAGTGGGTGGGAGG + Intronic
918142529 1:181731641-181731663 GAGAGGGCTCGCTGGGCGGAGGG - Intronic
919052241 1:192525673-192525695 CATAGGTTTGGATGGGTGGGTGG - Intergenic
920071633 1:203306585-203306607 CAGAGGGAACACAGGGTGGGAGG + Intronic
920096924 1:203492396-203492418 CAGAGGCTCTGCTGGGTGGAGGG - Intergenic
922025515 1:221744681-221744703 CAGAGGGTTGCCTGGGAAGGCGG + Intergenic
923630462 1:235646354-235646376 CAGCGGGTTTGGTGGGTGGTGGG - Intronic
924068217 1:240248102-240248124 CAGAGGCTGCGTAGGGTGGGTGG - Intronic
924574687 1:245269204-245269226 GAGAGGGGCCGTTGGGTGGGAGG - Intronic
924574714 1:245269266-245269288 GAGAGGGGCCGTTGGGTGGGAGG - Intronic
924957650 1:248944862-248944884 GGGAGGGGTCGCTGGGCGGGCGG - Intergenic
1063221316 10:3970875-3970897 AACAGGGTACCCTGGGTGGGAGG - Intergenic
1063592296 10:7406974-7406996 TAGAGGGTTGGCGGGGGGGGAGG + Intronic
1064487051 10:15804215-15804237 CAGAGGGTTGGCGGGGGGGCGGG + Intronic
1065020264 10:21496733-21496755 CAGAGGGTACGGTGGGGGGCGGG - Exonic
1065110595 10:22436741-22436763 CAGAGGGCTCGGTGGGCGCGAGG + Intronic
1067082130 10:43217817-43217839 CTGAGTGTTGGCTGGGTGGTTGG - Intronic
1067289092 10:44928470-44928492 CAGATGGATGGATGGGTGGGTGG - Intronic
1069892674 10:71661873-71661895 GAGGGGGCGCGCTGGGTGGGAGG - Intronic
1069892682 10:71661892-71661914 AAGGGGGCGCGCTGGGTGGGAGG - Intronic
1070228338 10:74535874-74535896 AATAGGGTCAGCTGGGTGGGGGG - Intronic
1070793723 10:79204759-79204781 CAGATAGTTAGATGGGTGGGTGG + Intronic
1071882903 10:89918736-89918758 CAGAGGGTCCTCTAGGTGGGAGG + Intergenic
1072612542 10:97028276-97028298 CAGAGGGTGAGTGGGGTGGGAGG - Intronic
1072694497 10:97593127-97593149 CTGAGAGTTGGCTGGGAGGGTGG + Intronic
1072861574 10:99011003-99011025 CAGAGGGGTTGAAGGGTGGGAGG - Intronic
1073540757 10:104314941-104314963 CAGAGGGCTCCCTGGGAAGGTGG + Exonic
1074704268 10:116117522-116117544 CAGATGGATGGATGGGTGGGTGG + Intronic
1076349636 10:129807226-129807248 TCGAGGGTTTGCTGGGTGGGAGG + Intergenic
1076359454 10:129876896-129876918 CAGAGGGGTAGCTGGGTGGGGGG - Intronic
1076963494 10:133786380-133786402 GGGAGGGGTCGCTGGGCGGGCGG - Intergenic
1077076735 11:705648-705670 CAGAGGCTTCGGTGAGTGGGTGG - Intronic
1077121076 11:908811-908833 CAGAGGGGCCACTAGGTGGGTGG - Intronic
1077296589 11:1829296-1829318 CAGAGGGTTCAACAGGTGGGGGG + Intronic
1077418190 11:2435757-2435779 CAGATGGATGGATGGGTGGGTGG - Intergenic
1077756242 11:5030793-5030815 CAGATGGCCCTCTGGGTGGGAGG + Intergenic
1078983313 11:16562866-16562888 CAGATGGTCCTCTGGGTGGTGGG - Intronic
1080645120 11:34182485-34182507 CATTGGGTTCTCTGGGGGGGGGG + Intronic
1081857402 11:46312499-46312521 CAGAGGGCTTCCTTGGTGGGTGG + Intronic
1083188938 11:61035688-61035710 GAGAGGCTTCCTTGGGTGGGTGG + Intergenic
1083862250 11:65427567-65427589 CAGAAGGTTTACTAGGTGGGCGG - Intergenic
1084500887 11:69534449-69534471 GAGTGGGGTCGCTGCGTGGGAGG + Intergenic
1084518879 11:69650840-69650862 CAGGGGGTGTGCAGGGTGGGCGG + Intronic
1084940899 11:72612714-72612736 TAGATGGGTGGCTGGGTGGGTGG + Intronic
1085329849 11:75639140-75639162 CAGAAGGGTGGCAGGGTGGGAGG + Intronic
1085790666 11:79494401-79494423 CTGAGGGTTCTTGGGGTGGGGGG + Intergenic
1087503667 11:98993340-98993362 CAGTGGGTTGGATGGGTGGGTGG + Intergenic
1087951314 11:104223519-104223541 CAGAGGGGTCGCTGAGTGAGGGG - Intergenic
1089125159 11:116171678-116171700 CAGAGGCTTAGCTGAGTAGGTGG + Intergenic
1090168692 11:124579094-124579116 CAGAGTTTTGGCTGGGTAGGGGG - Intergenic
1090839430 11:130475574-130475596 CAGAGGCTTGGCTGGCTGGCTGG - Exonic
1090941344 11:131390782-131390804 CAGAGGGCTCTCTGGGGGTGGGG - Intronic
1095438177 12:42214603-42214625 GAGAGGCTTCTCTGAGTGGGTGG - Intronic
1096193157 12:49633002-49633024 CATAGGGCCCTCTGGGTGGGGGG - Exonic
1096636746 12:52965248-52965270 CAGAGGGTCTGGTGGCTGGGAGG - Intergenic
1096672667 12:53209499-53209521 CAGAGGGCTCCCTGGGTGAGGGG + Intergenic
1097861379 12:64521894-64521916 CAGAGGGTTCTGAAGGTGGGAGG - Intergenic
1099188205 12:79538878-79538900 CAGAGGTCACGCTGGGTGGGTGG + Intergenic
1102143869 12:110639418-110639440 CAGTGGTTTCTCTGGGTGGTAGG - Intronic
1102186155 12:110950595-110950617 CAGACGGGGCGCTGGCTGGGCGG + Intergenic
1102186203 12:110950696-110950718 CAGGGCGCTGGCTGGGTGGGGGG + Intergenic
1102570579 12:113824860-113824882 TAGAGGGATCCCTTGGTGGGAGG - Intronic
1103255933 12:119541321-119541343 CAGATGGGTGGATGGGTGGGTGG + Intergenic
1103262027 12:119595771-119595793 CAGAGCTTGCGCGGGGTGGGTGG - Intronic
1104588593 12:130066911-130066933 CAGAGGGAAGGCTGGGTGGCGGG - Intergenic
1105971039 13:25429485-25429507 CAGCTGGATGGCTGGGTGGGTGG + Intronic
1106124532 13:26889507-26889529 CAGAGGGTGCCCTGGCAGGGAGG + Intergenic
1106172006 13:27296498-27296520 CAGAGTGCTCACTTGGTGGGGGG - Intergenic
1106552958 13:30787525-30787547 CAGAGTGTCTGCTGGGTTGGAGG - Intergenic
1107401543 13:40074297-40074319 CAGAAGGGTCCCTGAGTGGGTGG - Intergenic
1107600780 13:42010458-42010480 GAGTGGGTTGGCGGGGTGGGGGG - Intergenic
1110730820 13:78876969-78876991 CAGACAGTTTCCTGGGTGGGAGG - Intergenic
1112512057 13:100018769-100018791 CAGAGGAAGGGCTGGGTGGGAGG + Intergenic
1114260817 14:21034833-21034855 AAGAGGGTTGGATGGGTGGGAGG + Intronic
1115899506 14:38129194-38129216 CAGAGGGATGGCTTGGTGGCAGG + Intergenic
1117003540 14:51395487-51395509 CAGGGGATTCTCTGGGAGGGAGG - Intergenic
1117637120 14:57755190-57755212 CACAGGGCTCGCTGTGTTGGCGG + Intronic
1118043095 14:61938418-61938440 TTCAGGGTTGGCTGGGTGGGAGG + Intergenic
1118477582 14:66132815-66132837 CTGAGGCTTGACTGGGTGGGAGG + Intergenic
1121630410 14:95417819-95417841 CAGTGGGTTAGGTGGGTGGTGGG + Exonic
1122043452 14:99007080-99007102 CAGAGGGTTCCCGGGGAGTGTGG + Intergenic
1122135932 14:99633024-99633046 GAGTGGGTGGGCTGGGTGGGTGG + Intergenic
1122177371 14:99931070-99931092 GAAAGGGTTGGCTGGGTGGCAGG - Intronic
1122572751 14:102718575-102718597 CTGAGGGTTGGGTGGGAGGGTGG + Intronic
1123494109 15:20807262-20807284 CAGAGGCTGAGCAGGGTGGGGGG + Intergenic
1124608772 15:31193344-31193366 CAGAGTGTTGGATGGGTGGATGG - Intergenic
1125019621 15:34971841-34971863 CAGAGGGTTGGGTGGGTGGAGGG - Intergenic
1125603160 15:40926415-40926437 CAGAGGCTACGCTGCGGGGGAGG + Intergenic
1128943997 15:71809461-71809483 CAGAGGCATCGCTGGGCTGGAGG + Intronic
1129333414 15:74839094-74839116 CAGAGGGTTCGTTGTGGGGCAGG - Intronic
1129788396 15:78324069-78324091 CAGTGGGGTTGCGGGGTGGGGGG - Intergenic
1129976548 15:79826970-79826992 TACAGGGTTCATTGGGTGGGTGG + Intergenic
1130224878 15:82048598-82048620 CAGAGGAGTCCCTGGGTGGCTGG + Intergenic
1130546752 15:84862526-84862548 CAGCAGGTTGGCAGGGTGGGAGG + Intronic
1130992455 15:88884120-88884142 CAGTGGTTCCCCTGGGTGGGGGG + Intronic
1131008210 15:88995868-88995890 CAGAGGGTTGGCGGGGTGGGGGG - Intergenic
1131564877 15:93476982-93477004 CAGTGGGTTTGCTGGGCGTGGGG + Intergenic
1132163243 15:99562781-99562803 CAGAGGGAGCGCTGTGTGCGGGG - Intergenic
1132352605 15:101149136-101149158 CAGAGGGTGCCCTGGGAAGGTGG - Intergenic
1133805561 16:9123889-9123911 CAGATTGTTAACTGGGTGGGTGG + Intergenic
1135051759 16:19198972-19198994 CTGAGTGGTCGGTGGGTGGGTGG + Intronic
1135413834 16:22254227-22254249 CAGAGGGCTCCCTGGGCGAGGGG - Intronic
1135524285 16:23202241-23202263 CAGATGGATGGGTGGGTGGGTGG + Intronic
1135770482 16:25214481-25214503 TAGATGGTTGGGTGGGTGGGTGG - Intergenic
1136223442 16:28843719-28843741 GAGAAGGTACGGTGGGTGGGAGG - Exonic
1137507048 16:49063158-49063180 CAGAAGGGTGGCTGGCTGGGAGG + Intergenic
1137957946 16:52852327-52852349 CAGTGGGCTGGATGGGTGGGTGG + Intergenic
1138247646 16:55479353-55479375 CCGAGGGTCCGCTGGCTCGGTGG - Exonic
1138344400 16:56311366-56311388 CACAGGGCTCACTGGGTGAGAGG - Intronic
1138360882 16:56425849-56425871 CAGAGGGTTAATGGGGTGGGGGG - Intergenic
1139488434 16:67272214-67272236 CAGGGGGTTCTTAGGGTGGGGGG + Intergenic
1140402012 16:74679301-74679323 CAGAGGCATGGCTGGGTGGCTGG + Intronic
1141717472 16:85735130-85735152 CAGAGGGGGTGCTGGGTTGGGGG - Intronic
1142036591 16:87866084-87866106 CACAGGGTTCTATGGGGGGGCGG + Intronic
1142235314 16:88919639-88919661 GAGAGGCTGCTCTGGGTGGGAGG - Intronic
1142477755 17:199722-199744 GAGAGCCTTGGCTGGGTGGGAGG + Intergenic
1143863070 17:9905204-9905226 CTGGGGAGTCGCTGGGTGGGTGG + Exonic
1144050797 17:11495706-11495728 CAGAGGGATGGCAGGGTGGCCGG - Intronic
1144473323 17:15563406-15563428 CTGAGGGCGCGCTGGGAGGGTGG - Intronic
1144836325 17:18158393-18158415 CACAGGGATGGGTGGGTGGGCGG + Intronic
1144923159 17:18781314-18781336 CTGAGGGCTCGCTGGGAGGGTGG + Intronic
1145102258 17:20086844-20086866 CAGAGGTTTTGCTGGGTGGGTGG + Intronic
1145271540 17:21407439-21407461 TAGAGGGATGGCTGGGTGGATGG - Intronic
1145309754 17:21694887-21694909 TAGAGGGATGGCTGGGTGGATGG - Intronic
1147534081 17:41307189-41307211 CAGAGGGATGGGTGGGTGGATGG + Intergenic
1147657432 17:42098663-42098685 CAGGGGGTGCGGGGGGTGGGTGG + Intergenic
1147890207 17:43711614-43711636 CAGAAGGTGCCCTTGGTGGGAGG - Intergenic
1147945042 17:44076070-44076092 CAGAGTGTTGGCTTTGTGGGAGG - Exonic
1148114983 17:45170227-45170249 CAGAAGGTTTTCTAGGTGGGAGG + Intergenic
1148336654 17:46846604-46846626 CAGAAGCATGGCTGGGTGGGGGG + Intronic
1148676899 17:49451041-49451063 GAGGGGGCTTGCTGGGTGGGTGG - Intronic
1148808844 17:50278007-50278029 CTGAGGGTCCCCTGGGTCGGAGG + Intronic
1149424077 17:56538292-56538314 CATAGGCTTCTCTGGCTGGGTGG + Intergenic
1152091330 17:78249443-78249465 CAGTGGGGTCCCTGGCTGGGAGG - Intergenic
1153973413 18:10246513-10246535 CGCAGGGTTCCCTGGATGGGAGG + Intergenic
1154377646 18:13823052-13823074 CAGTGGGTTGGGTGGATGGGTGG - Intergenic
1154451639 18:14481720-14481742 CAGAGGCTGAGCAGGGTGGGGGG + Intergenic
1156126452 18:33911135-33911157 CAGAGGGTGGGGTGGGGGGGAGG - Intronic
1156297427 18:35805603-35805625 CAGATGGGTGGATGGGTGGGTGG + Intergenic
1156497943 18:37538122-37538144 CAGAGGGATGGCGGGGTGGGAGG + Intronic
1158623214 18:59050126-59050148 GAGAGTGTCCGGTGGGTGGGAGG - Intergenic
1160134616 18:76261873-76261895 CAGTGGGAGCGCTGGGAGGGAGG + Intergenic
1160238993 18:77109125-77109147 TCCAGGGTTCCCTGGGTGGGTGG + Intronic
1160610365 18:80079770-80079792 CTGAGGCTCCGCTGGGTAGGTGG - Intronic
1160687383 19:443127-443149 CAGATGGGTAGATGGGTGGGTGG + Intronic
1160687414 19:443255-443277 CAGATGGATGGATGGGTGGGTGG + Intronic
1161347709 19:3776441-3776463 CAGGGGGATGGGTGGGTGGGTGG + Intergenic
1161657572 19:5525439-5525461 TAGATGGTTAGGTGGGTGGGTGG - Intergenic
1161657601 19:5525558-5525580 TAGATGGTTAGGTGGGTGGGTGG - Intergenic
1161935908 19:7372126-7372148 CACAGGGTTTGGTGGGTAGGTGG - Intronic
1162675764 19:12296854-12296876 CAGAGGGTTGGCAGGGGCGGGGG + Intergenic
1162909681 19:13842365-13842387 CAGAGAGTTGTCAGGGTGGGAGG - Intergenic
1163469090 19:17486551-17486573 CAGAGAGACCGCTGGGAGGGAGG - Exonic
1163492179 19:17623436-17623458 AGGAGGGGGCGCTGGGTGGGTGG + Intronic
1163608057 19:18286602-18286624 CAGAGGGCTCTCTGGCTGGGAGG - Intergenic
1164809733 19:31146795-31146817 CAGAGTGTTCGCTGGGTGACTGG + Intergenic
1164827208 19:31292623-31292645 TGGAGGGTTGGCTGGGTGGATGG - Intronic
1164891797 19:31829742-31829764 CAGAGGTGTGGGTGGGTGGGGGG - Intergenic
1165305099 19:34998893-34998915 CAGCGGGTAGGCTGGATGGGGGG + Intronic
1165998809 19:39865253-39865275 CAGATGGGTGGGTGGGTGGGTGG + Intronic
1166277344 19:41763194-41763216 AAGAGAGTTCTGTGGGTGGGTGG - Intronic
1166707342 19:44915212-44915234 AAGTGGGTAAGCTGGGTGGGGGG + Intronic
1167101893 19:47408814-47408836 CCGAGGGTACACTGGGTGGATGG + Intronic
1167285458 19:48596524-48596546 TGGAGGGTTCTCTAGGTGGGAGG - Intronic
1168398007 19:56065351-56065373 CTGAGGGTGGGATGGGTGGGCGG + Intergenic
1168704346 19:58460427-58460449 CATAGGTTTCGAAGGGTGGGGGG - Intergenic
1168728629 19:58606834-58606856 GGGAGGGGTCGCTGGGCGGGCGG - Intergenic
925940812 2:8816003-8816025 CAAAGGATTGGGTGGGTGGGTGG - Intronic
926217853 2:10916064-10916086 CAGTGGGTTTGCTGGATGTGTGG + Intergenic
927489524 2:23511543-23511565 CTGAGGGTTAGCTGTGTGTGAGG + Intronic
929794339 2:45047435-45047457 CAGAGGGCACACGGGGTGGGGGG + Intergenic
930090056 2:47525489-47525511 TGGAGAGTTCTCTGGGTGGGAGG + Intronic
933206383 2:79512819-79512841 TCGAGGGGTGGCTGGGTGGGGGG - Intronic
934268219 2:91519560-91519582 GGGAGGCTTCGCTGGCTGGGTGG + Intergenic
936008227 2:108908580-108908602 CAGCGGGTGAGCTGGGTGGGCGG + Intronic
936569873 2:113603870-113603892 GGGAGGGGTCGCTGGGCGGGCGG + Intergenic
937303499 2:120857393-120857415 CAGATGGGTAGGTGGGTGGGTGG - Intronic
938141463 2:128798110-128798132 CAGAGGCTTCTCTGGGTAGCTGG + Intergenic
941574392 2:167212891-167212913 CAGAGGGGTGGGGGGGTGGGGGG - Intronic
947344891 2:229180604-229180626 CAGAGGGCTTGCTAGGTGGCAGG - Intronic
948072423 2:235138527-235138549 TAGTGGGTGAGCTGGGTGGGAGG + Intergenic
948373368 2:237504731-237504753 TAGAGGGGTCGCTGGATGGTAGG - Intronic
948658271 2:239490374-239490396 CAGATGGATGGATGGGTGGGTGG - Intergenic
948792068 2:240384271-240384293 CAGAGGGCTGTCTGGGTGGGGGG + Intergenic
1168852225 20:984859-984881 CAGATGGGTAGGTGGGTGGGTGG - Intronic
1168852309 20:985159-985181 CAGATGGGTAGGTGGGTGGGTGG - Intronic
1169334940 20:4748431-4748453 CAGTGGGTCCCCAGGGTGGGTGG - Intergenic
1172776700 20:37411676-37411698 GAGAGGCCTCGATGGGTGGGAGG - Intergenic
1173337163 20:42122011-42122033 CAGAAGGTTGGCAGGGTAGGAGG + Intronic
1176444506 21:6808503-6808525 CAGAGGCTGAGCAGGGTGGGGGG - Intergenic
1176822671 21:13673541-13673563 CAGAGGCTGAGCAGGGTGGGGGG - Intergenic
1178215948 21:30598526-30598548 CAGAGGGTACTGGGGGTGGGAGG + Intergenic
1179551092 21:42144440-42144462 CAGATGGTTGGGTGGATGGGTGG - Intergenic
1180078096 21:45473291-45473313 CAGAGGGAGCGGTGGGTAGGTGG + Intronic
1180172597 21:46067566-46067588 CAGAGAGTTCGGTGGGAGTGGGG + Intergenic
1180264112 21:46698753-46698775 GGGAGGGGTCGCTGGGCGGGCGG - Intergenic
1182062000 22:27405061-27405083 CAGAGGGGTTCCTGGGTTGGAGG + Intergenic
1182198265 22:28541346-28541368 CAGAGGTCTTGCTGGGTTGGAGG + Intronic
1183357817 22:37368886-37368908 CAGAAGGGTGGGTGGGTGGGTGG - Exonic
1183724885 22:39582988-39583010 CAGATGGATGGATGGGTGGGTGG - Intronic
1184335053 22:43848082-43848104 TAAAAGGCTCGCTGGGTGGGTGG - Intronic
1184352716 22:43955214-43955236 GAGAGGGTCCGCTGGGAGGCTGG - Intronic
1185430350 22:50807134-50807156 GGGAGGGGTCGCTGGGCGGGCGG - Intergenic
950309938 3:11948488-11948510 CAGACAGATGGCTGGGTGGGTGG + Intergenic
950443821 3:13024711-13024733 CAGATGGGTGGATGGGTGGGTGG - Intronic
953087033 3:39679472-39679494 CAGAGGGTGCGGTGGGGAGGAGG - Intergenic
953741981 3:45546056-45546078 CAGAGGGGGTGCTGGGTGAGGGG - Intronic
954417053 3:50398371-50398393 AAGAGGGTTCGCTGAGTGTCAGG - Intronic
954607979 3:51928707-51928729 TGGAGGGTGCGCTGGGTGAGGGG + Intergenic
958023801 3:88027142-88027164 CAGAGGGTTTCCTGGGTGGAGGG - Intergenic
959419147 3:106111360-106111382 CAGGCGGCTGGCTGGGTGGGGGG + Intergenic
961449098 3:126994469-126994491 CAGAGGGTGCCCTGGGTTTGGGG + Intronic
961819518 3:129568138-129568160 CAGTGGCTTTCCTGGGTGGGAGG + Intronic
964204097 3:154151802-154151824 CAGAGGGTACTGTGGCTGGGTGG - Intronic
965040996 3:163506894-163506916 CACAGTGTTCTCTGGGTGGGAGG + Intergenic
966881813 3:184354830-184354852 CAGAGGGTTGGCTGGGGGGGTGG + Intronic
968082578 3:195856893-195856915 GAGAGGGTGAGCGGGGTGGGCGG + Intergenic
968266993 3:197370040-197370062 CAGAGGCTGAGGTGGGTGGGAGG - Intergenic
968453451 4:685901-685923 CAGAGGGTTCGCTGGGTGGGCGG + Exonic
968480029 4:829179-829201 CAGAGGGCTGGCTGGGCCGGGGG - Intergenic
968651321 4:1761382-1761404 CACAGGGTGCACGGGGTGGGTGG - Intergenic
968756701 4:2419820-2419842 CAGAGGGTCGACTGGGTGGTAGG - Intronic
968885543 4:3329181-3329203 CAGGGGGTCAGGTGGGTGGGAGG + Intronic
968954409 4:3710897-3710919 CTGCGGGTTCGCTGTGTTGGTGG + Intergenic
969219188 4:5748612-5748634 CAGATGGATGGATGGGTGGGTGG - Intronic
970575223 4:17420547-17420569 CATAGTGTTATCTGGGTGGGTGG - Intergenic
979138491 4:117141972-117141994 CAGAGGGTAAGGAGGGTGGGTGG + Intergenic
979999372 4:127470545-127470567 CTGAGGGCTCGCGGGGTGCGGGG - Intergenic
980185306 4:129453855-129453877 CTGAGGGTTCTCTGTGTGGGTGG - Intergenic
980844652 4:138309686-138309708 CAGAGGAGCCCCTGGGTGGGAGG + Intergenic
982439403 4:155417542-155417564 CAGAGGGTGTGAAGGGTGGGTGG - Intergenic
984999740 4:185471434-185471456 CCGAGGGCGCGCTGGGCGGGCGG + Intronic
989750234 5:44884118-44884140 CAGAGGGTGCGCAGGGTCCGCGG - Intergenic
991093762 5:62718272-62718294 CAGAGGGCTTGCTGGGAGGGTGG - Intergenic
991926415 5:71709592-71709614 CAGAGAGTTCACTGGTTGTGGGG - Intergenic
992413648 5:76532470-76532492 CTGAGGATTGGGTGGGTGGGGGG + Intronic
993767572 5:91879864-91879886 CAGTGGGTTGGTGGGGTGGGGGG - Intergenic
997235359 5:132269311-132269333 CAGAGGCTTTGGTGGGAGGGAGG - Intronic
998087955 5:139342059-139342081 TAAAGGGTTCCCTGGGTGGTTGG + Intronic
999324732 5:150636783-150636805 CAGAGAGAACGCGGGGTGGGGGG + Intronic
1002641952 5:180634799-180634821 CAGATGGGTGGATGGGTGGGTGG + Intronic
1002817572 6:693970-693992 CAGGGGGTTCTCAGGGTTGGGGG + Intergenic
1003057385 6:2834395-2834417 TAGATGGTTGGATGGGTGGGTGG - Intronic
1004161874 6:13221414-13221436 TAGAGGGTGGACTGGGTGGGTGG + Intronic
1004652268 6:17621685-17621707 CAGAGGCTTCGTTGGGGTGGTGG + Intronic
1004686434 6:17950905-17950927 TAGAGATTTCTCTGGGTGGGTGG - Intronic
1005926383 6:30448883-30448905 AAGAGGGTCGCCTGGGTGGGTGG + Intergenic
1005928109 6:30461464-30461486 AAGAGGGTCACCTGGGTGGGTGG + Intergenic
1006051875 6:31351640-31351662 CAGAGAGTGCCCAGGGTGGGTGG - Intronic
1006171729 6:32097068-32097090 CAGAGGGGACGCTGTGAGGGTGG - Intronic
1007655009 6:43446539-43446561 CACAGGGAACCCTGGGTGGGAGG - Intronic
1007734145 6:43969967-43969989 CTGAGGGTCGGCTGTGTGGGTGG + Intergenic
1008018359 6:46547105-46547127 CAGAGGGTGGGGTGGGTAGGAGG + Intergenic
1011664816 6:89623568-89623590 CAGAGGGGTGGCTGGGAGGCAGG + Intronic
1013456253 6:110332075-110332097 CAGAGGGTAGGCTGGGAGGCAGG + Intronic
1017430401 6:154365019-154365041 CAGGGGGTAGGATGGGTGGGTGG + Intronic
1017981300 6:159402724-159402746 CAGAGGGTTCCTGGGGTAGGAGG + Intergenic
1018033040 6:159858899-159858921 CAGAGGGCTAGCTGAGAGGGAGG - Intergenic
1019055060 6:169218014-169218036 GAGATGGGTCGGTGGGTGGGTGG + Intronic
1019335953 7:482911-482933 CAGATGGGTGGATGGGTGGGTGG + Intergenic
1019501123 7:1365223-1365245 CAGAGGCTTGGCAGGCTGGGAGG - Intergenic
1019643431 7:2116559-2116581 CAGAGGGTTGGGGGGGGGGGGGG + Intronic
1020305027 7:6827415-6827437 CAGGGGGTTGGCCGGGGGGGAGG - Intergenic
1021537590 7:21722917-21722939 AAGAGGGTCAGCTGGGAGGGAGG - Intronic
1021788677 7:24178256-24178278 CAGAGGGTTGGGTGGGGAGGAGG + Intergenic
1022500995 7:30882376-30882398 GACAGGGTTGGGTGGGTGGGGGG - Intronic
1024615757 7:51110263-51110285 CAGAGGCTGCGCAGGGTGGAGGG - Intronic
1025092960 7:56078302-56078324 CAGAGGGTAGGCGGGGTGGTCGG + Intronic
1026446234 7:70487232-70487254 TGGAGGGTTGGCTGGGAGGGGGG - Intronic
1026589881 7:71685352-71685374 CAGAGGGTTCACTGGGTCAGTGG - Intronic
1026904317 7:74054131-74054153 CAGAGAGTTAGGTGGTTGGGTGG + Intronic
1033943198 7:146681411-146681433 CACAGGGTCCTGTGGGTGGGGGG + Intronic
1035023655 7:155813211-155813233 CAGTGTGTGCGCTGGGTGTGTGG + Intergenic
1035093138 7:156330968-156330990 CAGAGGGGTCGCTGAGGTGGAGG + Intergenic
1035330169 7:158091663-158091685 GAGATGGTTGGTTGGGTGGGTGG + Intronic
1035330180 7:158091717-158091739 CAGAGAGATGGTTGGGTGGGTGG + Intronic
1035330227 7:158091913-158091935 GAGATGGTTGGGTGGGTGGGTGG + Intronic
1035330242 7:158091971-158091993 GAGATGGTTGGTTGGGTGGGTGG + Intronic
1035512961 8:206358-206380 GGGAGGGGTCGCTGGGCGGGCGG + Intergenic
1037403309 8:18515460-18515482 TAGAGGGTTGGAGGGGTGGGTGG + Intergenic
1037916356 8:22775622-22775644 GAGAGGGTTTGCTGGGAAGGAGG + Intronic
1038486732 8:27940738-27940760 CAGATGGTTGGGTGGGTGGATGG - Intronic
1039413565 8:37375403-37375425 CAGAGGGAAGGATGGGTGGGAGG - Intergenic
1040869489 8:52085945-52085967 TAGATGGTTGGGTGGGTGGGTGG - Intergenic
1042870784 8:73396905-73396927 CAGAAGAATCGCTGGTTGGGAGG + Intergenic
1043037971 8:75222177-75222199 GAAAGGGTTGGCCGGGTGGGGGG + Intergenic
1044397604 8:91731228-91731250 CAGAAGGAGCTCTGGGTGGGTGG - Intergenic
1046016639 8:108613319-108613341 CAGAGGTTTGGCAGGGTGAGTGG - Intronic
1046131786 8:109975078-109975100 GGGAGGGTTCTCTGGGTGAGGGG + Exonic
1047191216 8:122680853-122680875 CACAGGGATCCCAGGGTGGGTGG - Intergenic
1047915827 8:129582793-129582815 CAGAGGGATAGGTGGTTGGGAGG + Intergenic
1048177321 8:132164430-132164452 CATAGGGATCCATGGGTGGGAGG + Intronic
1049155925 8:141066798-141066820 TAGATGGTTGGATGGGTGGGTGG - Intergenic
1049359915 8:142207503-142207525 TAGAGGGATAGATGGGTGGGTGG + Intergenic
1049359944 8:142207626-142207648 TAGAGGGATAGATGGGTGGGTGG + Intergenic
1049442568 8:142616061-142616083 CAGAGGGTTGGCAGGGAGGGGGG - Intergenic
1049683420 8:143929896-143929918 CCGGGGGCTCTCTGGGTGGGAGG - Intronic
1049801930 8:144521947-144521969 CAGTGGGGTGGCTGGGTGGCAGG - Exonic
1051521798 9:17997597-17997619 CAGAGGCATCGCTGTGTGGAGGG - Intergenic
1052036167 9:23683621-23683643 GAGGGGGTTAGGTGGGTGGGAGG - Intergenic
1052873435 9:33531550-33531572 CAGAGGTTGCCCTGGGTAGGAGG + Intronic
1053051779 9:34967648-34967670 CAGCGTGTTCGATGGCTGGGTGG - Intronic
1053276317 9:36786200-36786222 GAGATGGATCGATGGGTGGGTGG + Intergenic
1053502665 9:38613196-38613218 CAGAGGTTGCCCTGGGTAGGAGG - Intergenic
1055056602 9:72029925-72029947 CAGTTGGTTGGCTGGGTGGGTGG - Intergenic
1055360823 9:75488583-75488605 CAGAGAGTTCAATGGGTGGAAGG + Intergenic
1055602982 9:77939024-77939046 TTGAGGGTTCTCTGGGTGTGAGG + Intronic
1056706459 9:88956097-88956119 CGGAGGGTGCGTGGGGTGGGGGG + Intergenic
1057305208 9:93908348-93908370 CAGGGGGGTAGGTGGGTGGGTGG + Intergenic
1057700100 9:97357825-97357847 CACAAGGTTGGCGGGGTGGGGGG + Intronic
1057988076 9:99737915-99737937 GAGAGGGTGCACTGGGTGTGGGG - Intergenic
1058305754 9:103438903-103438925 CAGAGGGGTAGCTGGCTGTGTGG + Intergenic
1059281325 9:113136538-113136560 CAGAGGGGTAGTTTGGTGGGAGG + Intergenic
1059434119 9:114266209-114266231 CAGTGGGTTGGCTGGGGGTGGGG + Intronic
1060784469 9:126439257-126439279 CACAGGGTCCGCTGGGGGTGGGG + Intronic
1062052010 9:134452246-134452268 CAGATGGGTGACTGGGTGGGTGG - Intergenic
1062213173 9:135375430-135375452 CAGAGCCTTCGGTGGGAGGGTGG + Intergenic
1062610089 9:137369661-137369683 CAGAGGGGTTCCTGGTTGGGTGG - Intronic
1062621369 9:137423808-137423830 CGGGGCGTTCGCTGGGTCGGGGG - Intronic
1062630650 9:137461699-137461721 CAGAGAGGGCGCAGGGTGGGTGG - Intronic
1203524692 Un_GL000213v1:76024-76046 CAGAGGCTGAGCAGGGTGGGGGG + Intergenic
1185616306 X:1424176-1424198 CAGATGGGTGGGTGGGTGGGTGG - Intronic
1186508865 X:10115934-10115956 TAGATGGCTGGCTGGGTGGGTGG - Intronic
1187228131 X:17394002-17394024 CTGAGGGTGCGGTGGGGGGGCGG - Intronic
1189356547 X:40314029-40314051 CTGAGGTTTGGCTGGGTGTGGGG + Intergenic
1192170410 X:68851268-68851290 CAGAGGGCTGGCTGGGAGGGGGG + Intergenic
1192362845 X:70450072-70450094 CAGTGGGTTGGCTGGGGGAGGGG + Intronic
1192533119 X:71906394-71906416 CAGAGGCTTCGCTGAGTGGGAGG - Intergenic
1192535284 X:71922242-71922264 CAAAGGGATCTCTGGGTAGGTGG + Intergenic
1199696555 X:150346628-150346650 CAGAGAGTTCGCTGCTTAGGTGG + Intergenic
1201604455 Y:15770310-15770332 CTGAGGGCTTGCTGGGTTGGAGG - Intergenic