ID: 968453452

View in Genome Browser
Species Human (GRCh38)
Location 4:685922-685944
Sequence GGATGCACAAAGTGTCAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968453450_968453452 -1 Left 968453450 4:685900-685922 CCAGAGGGTTCGCTGGGTGGGCG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG 0: 1
1: 0
2: 0
3: 7
4: 87
968453444_968453452 11 Left 968453444 4:685888-685910 CCACAAGGACGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 8
4: 78
Right 968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG 0: 1
1: 0
2: 0
3: 7
4: 87
968453449_968453452 0 Left 968453449 4:685899-685921 CCCAGAGGGTTCGCTGGGTGGGC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968453452 Original CRISPR GGATGCACAAAGTGTCAGCT CGG Intronic
902982776 1:20137868-20137890 GGATCCACAGAGAGGCAGCTGGG + Intergenic
904256296 1:29257153-29257175 GAAAGAACAAAGTGTCAGATTGG + Intronic
906681597 1:47729840-47729862 TGCTTCACAGAGTGTCAGCTGGG - Intergenic
908218335 1:61978040-61978062 GGAGGCACAAAGTGACTTCTGGG - Intronic
910348626 1:86270184-86270206 GGCTGCACAAAGAATCACCTGGG - Intergenic
911664235 1:100535900-100535922 GGCAACACAAAGTGGCAGCTGGG + Intergenic
911718996 1:101169371-101169393 GGATGCACGAAGCGTTAGCCAGG - Intergenic
919279317 1:195466710-195466732 GGAAGACCAAAGAGTCAGCTTGG - Intergenic
924052506 1:240092619-240092641 GGATGGACAAAGGACCAGCTCGG + Exonic
1064424800 10:15221183-15221205 AGATGGCCAAAGTGTCATCTAGG + Intronic
1064860672 10:19821689-19821711 GGATGGACAAAGTCTTAGCATGG - Intronic
1069688241 10:70333162-70333184 GGTTGCAAGAAGTGTTAGCTTGG + Intronic
1070712569 10:78693480-78693502 GAATGAACAATGTGTCAGCAGGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1078399959 11:11017518-11017540 GGATGCACGTTGTGTCAGCTAGG + Intergenic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1085452012 11:76639829-76639851 AGATGCAGAAAGTCACAGCTTGG + Intergenic
1091147729 11:133294587-133294609 GGATGCCTAAATTATCAGCTTGG - Intronic
1091777938 12:3196905-3196927 GCCTGGACAAAGTGTGAGCTGGG + Intronic
1096538927 12:52292813-52292835 GGAAGCATAAAATGTCAGATTGG + Intronic
1098426746 12:70372892-70372914 GGATGAACAGAGTTTCATCTTGG + Intronic
1099204266 12:79710768-79710790 GGAGGCACCAAGAGTCAGCGAGG - Intergenic
1101415051 12:104501583-104501605 GGGTGCTCAGAGTGTCGGCTTGG - Intronic
1103041711 12:117701219-117701241 GCATGCCCATAGTCTCAGCTAGG - Intronic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1118589527 14:67391046-67391068 GGAGGCAGCAGGTGTCAGCTGGG + Intronic
1123938806 15:25206869-25206891 CGATGCACCAAGTCTCAGATGGG - Intergenic
1127337789 15:58006789-58006811 TGATGCACAAATTCTCAGCTGGG + Intronic
1128134711 15:65254336-65254358 GGATGCTCCAAATGTCAGGTTGG + Intronic
1133236722 16:4390827-4390849 GCTTGCACAAAGTCGCAGCTAGG + Intronic
1143765073 17:9132392-9132414 GGATGTACAAGGTGTGCGCTGGG - Intronic
1156081615 18:33342540-33342562 TGCTGCTCAAAGTGTCAGCTTGG - Intronic
1157858449 18:51121426-51121448 GGAGGCACCAAGTGTGAGCGAGG + Intergenic
1162662608 19:12182065-12182087 GGAAGGACAAATAGTCAGCTGGG - Intronic
1166704678 19:44902162-44902184 GGATGGACAAAGCTCCAGCTTGG - Intronic
1167731110 19:51256541-51256563 AGGGGCACAAAGTTTCAGCTAGG + Intronic
1168443552 19:56392318-56392340 GCATGCACAAAGCCTCAGTTTGG - Intronic
929319107 2:40519392-40519414 GAAGGCACAGAGTGTCAGATTGG - Intronic
930057458 2:47263106-47263128 GCATGCACTAAGTGTTGGCTAGG + Intergenic
930128174 2:47820653-47820675 GGATTCAAAATGTGGCAGCTCGG - Intronic
932808258 2:74801360-74801382 GGATACACAAAGAGACAGCAGGG + Intergenic
934520578 2:95017888-95017910 GGCTGCACACAGGGTCAGCGCGG - Intergenic
935340838 2:102058459-102058481 GGATGCACACACTGCCACCTTGG - Intergenic
941294399 2:163718008-163718030 AGATGCACAGATTGTCTGCTTGG - Intronic
942643583 2:178087039-178087061 GGATAAAGAAAATGTCAGCTGGG + Intronic
944267129 2:197740766-197740788 GGGTGCACAGAGTTTCAACTTGG + Intronic
948151282 2:235747039-235747061 GGATGCACTGAGTGTCTTCTGGG - Intronic
1169687098 20:8287649-8287671 GGATGTACAAAGAATCAGCATGG + Intronic
1173376125 20:42484895-42484917 GGAAGCAGAATGTGGCAGCTAGG - Intronic
1174125032 20:48298072-48298094 GGCTGCAAACAGTATCAGCTGGG + Intergenic
1175008307 20:55709542-55709564 AGATGCAGACAGTGTCAGTTGGG - Intergenic
1176974025 21:15298203-15298225 GGAGAGACAAAGTCTCAGCTGGG + Intergenic
1178897156 21:36568389-36568411 GGAGGCACGAAGTCCCAGCTAGG + Intronic
1179940486 21:44636604-44636626 GGATGAGAAAAGTGTCAGATGGG - Intronic
1180192381 21:46172122-46172144 GGATGCACAGAGTGTGAGGTGGG + Intronic
952662349 3:35866874-35866896 AGATGATCACAGTGTCAGCTGGG + Intergenic
952929786 3:38350150-38350172 AGGTGCACAAAGGGTCAGCTGGG - Intronic
953867274 3:46595296-46595318 TGATGAACAAAGTGTCATCAGGG - Intronic
954082324 3:48219864-48219886 GGATGAACAAACTGCCTGCTTGG + Intergenic
956529704 3:70204305-70204327 GGATGCAGAAATTGAGAGCTGGG - Intergenic
958504438 3:94956231-94956253 GGAAGCAGCAAGTGTCAGCGAGG - Intergenic
959216288 3:103454647-103454669 GGAAGCACAAAGTGACTGCAAGG - Intergenic
962827734 3:139112164-139112186 GGAGGCACAAAGTGTGGGCCAGG - Intronic
963894788 3:150673747-150673769 GTCTCCACAAAGTGTTAGCTGGG - Intronic
967237198 3:187396961-187396983 TGATCCACAGGGTGTCAGCTGGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
970637555 4:18025294-18025316 GGATTCACTGACTGTCAGCTAGG + Intergenic
979111785 4:116767115-116767137 GGATCGACAAAGTGTGAGCAGGG + Intergenic
979642617 4:123026857-123026879 TGATGCATAAGGTGTCAACTGGG - Intronic
984257245 4:177403511-177403533 GTAGGCAGAAAGTGACAGCTGGG - Intergenic
986127200 5:4894095-4894117 GGATGCACAGGGAGTAAGCTAGG + Intergenic
990101134 5:52188762-52188784 TGATAGACAAAGTGTCAGCAGGG - Intergenic
997400921 5:133601582-133601604 GGATGAACAGAGTGTGAGCAAGG + Intronic
997786759 5:136720637-136720659 AGTTACACAAAGTGTCAGTTGGG - Intergenic
998015021 5:138724992-138725014 GGAAGCACAAAGTCTCCTCTTGG - Intronic
1001413862 5:171529373-171529395 GGATGAACCCAGTGTCTGCTGGG - Intergenic
1016024257 6:139269756-139269778 GGATGCACACAGTATCATCTTGG + Intronic
1020223749 7:6263081-6263103 AGATGGACATACTGTCAGCTTGG - Intronic
1026322726 7:69281723-69281745 TGATGCACAAAGCATCAGCTAGG - Intergenic
1027298265 7:76801383-76801405 GTATGCTCAAAGTGTCTGCAGGG - Intergenic
1031576374 7:123419902-123419924 GGATCCACAGAGTACCAGCTGGG + Intergenic
1034588533 7:152118437-152118459 ACATGCAGACAGTGTCAGCTAGG - Intronic
1036025326 8:4901131-4901153 GCATGTTCAAAGTGTCATCTGGG + Intronic
1047844254 8:128788885-128788907 GGCTTTACAATGTGTCAGCTTGG - Intergenic
1050150386 9:2614014-2614036 GGATGCATAAAGTGACGACTGGG + Intergenic
1052422495 9:28261307-28261329 GGCTGCAAAAAGAGTAAGCTGGG - Intronic
1055503481 9:76924957-76924979 GGAGGCAGAAGATGTCAGCTGGG + Intergenic
1185582686 X:1223147-1223169 GCATGGACAATGAGTCAGCTGGG + Intergenic
1185735396 X:2491947-2491969 GGTTGCCCAAAATGACAGCTGGG + Intronic
1196297191 X:114011723-114011745 GGATTCACAAAGAGACAGCAGGG + Intergenic
1197614747 X:128678862-128678884 GTATGCACATATGGTCAGCTAGG + Intergenic
1198033543 X:132779066-132779088 GGGTGCACAAACTGCCAGCAGGG + Intronic
1200863688 Y:8019890-8019912 GAATGAAAACAGTGTCAGCTGGG + Intergenic