ID: 968453453

View in Genome Browser
Species Human (GRCh38)
Location 4:685928-685950
Sequence ACAAAGTGTCAGCTCGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968453449_968453453 6 Left 968453449 4:685899-685921 CCCAGAGGGTTCGCTGGGTGGGC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 968453453 4:685928-685950 ACAAAGTGTCAGCTCGGCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 140
968453450_968453453 5 Left 968453450 4:685900-685922 CCAGAGGGTTCGCTGGGTGGGCG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 968453453 4:685928-685950 ACAAAGTGTCAGCTCGGCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 140
968453444_968453453 17 Left 968453444 4:685888-685910 CCACAAGGACGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 8
4: 78
Right 968453453 4:685928-685950 ACAAAGTGTCAGCTCGGCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968453453 Original CRISPR ACAAAGTGTCAGCTCGGCTG TGG Intronic
901245380 1:7726159-7726181 ATAAAGTGTCAACTGGGCTGAGG - Intronic
902367552 1:15986964-15986986 ACAAAACGTTAGCTGGGCTGTGG - Intergenic
904256297 1:29257159-29257181 ACAAAGTGTCAGATTGGAAGAGG + Intronic
904941092 1:34165233-34165255 ACCAAGTGTCCGCCCGGCCGGGG + Exonic
907417610 1:54325270-54325292 AGAAAGGGGCAGCTAGGCTGTGG - Intronic
907575525 1:55522548-55522570 GCACAGTGTCAGCTGGGCAGTGG - Intergenic
909326087 1:74352680-74352702 ACAAGGTGGCAGCGAGGCTGGGG - Intronic
909736021 1:78962554-78962576 ATAAAGTTTCAGCTTGGATGGGG - Intronic
911460199 1:98180111-98180133 ACAAAGTGTCAGCTCAGGTATGG - Intergenic
912710470 1:111946152-111946174 ACAAAGTGTTATCAAGGCTGTGG + Intronic
916251865 1:162746397-162746419 ACAAGGTGGCAGCGAGGCTGGGG + Intronic
918624076 1:186637743-186637765 GCAAAGTGGCAGCGAGGCTGGGG + Intergenic
920995630 1:210987995-210988017 GCAAGGTGTCAGCGAGGCTGGGG - Intronic
921922313 1:220683594-220683616 ACCAAGAGTTAGCTCAGCTGTGG - Intergenic
1064358096 10:14637906-14637928 TCAAAGTGTCTGCTAGGCTGAGG - Intronic
1065075941 10:22079797-22079819 ACAGAGTTTGAGCTCTGCTGAGG - Intergenic
1069550889 10:69363231-69363253 ACAAGGGGTTAGCTAGGCTGTGG + Intronic
1070656196 10:78273206-78273228 AGAAAGTGTCAGCTCAGCCCTGG + Intergenic
1071725480 10:88194168-88194190 ACAAAGTGTCAACCAGGCTGAGG - Intergenic
1073826227 10:107325510-107325532 ACCAAGTGTCAGCAAGGATGTGG - Intergenic
1076377576 10:130001965-130001987 TCAAAGTATCAGCAGGGCTGCGG + Intergenic
1084094617 11:66902825-66902847 ACAAAATGTCCACTCAGCTGGGG - Intronic
1086858428 11:91895597-91895619 ATAAATTGTCAGCTCTGCTGAGG - Intergenic
1091341613 11:134819778-134819800 AAGAAGTGTCAACTTGGCTGTGG + Intergenic
1091961945 12:4703152-4703174 TCAAGGTGTCAGCTGGCCTGGGG - Intronic
1092459440 12:8673460-8673482 ACATAGTGTTAGCTGGGCTGCGG + Intergenic
1092919993 12:13222531-13222553 CCAAAGTGATAGCTCTGCTGAGG + Intergenic
1095250690 12:39976049-39976071 ACATGGTGTCAGCTCTGCTCAGG + Intronic
1095913938 12:47457511-47457533 GCAAAGTGGCAGCAAGGCTGGGG - Intergenic
1096615019 12:52827294-52827316 ACAAAGTCTCAGCTCTTGTGGGG - Intronic
1100389741 12:94138049-94138071 ACAGAGTGTTTGCTCTGCTGTGG + Intergenic
1100495661 12:95122784-95122806 AGAAAGTGTCATCTCGGGAGGGG + Intronic
1105702033 13:22940950-22940972 ACAAAGTCTCAGCTGGCGTGTGG + Intergenic
1106067737 13:26372724-26372746 ATAAAGTCTCAGTTCAGCTGAGG + Intronic
1109276871 13:60313342-60313364 AGAAAGTGACATCTGGGCTGGGG + Intergenic
1110205446 13:72906833-72906855 AAAAAGTATCAGCTCTGCTGTGG + Intronic
1110813854 13:79840075-79840097 GCAAAGTGGCAGCCAGGCTGGGG + Intergenic
1111746792 13:92281176-92281198 ACAAGGCGTCAGCAAGGCTGGGG + Intronic
1113426657 13:110213910-110213932 ACAAAAGGTAAGCACGGCTGTGG - Exonic
1118736387 14:68704483-68704505 CCAAAGTGTCAGCAGTGCTGAGG - Intronic
1120678718 14:87453414-87453436 CCAAAGGGTCAGCTCCTCTGAGG + Intergenic
1122668730 14:103353725-103353747 AAAAAGGGTAAGCACGGCTGTGG - Intergenic
1136453573 16:30368589-30368611 GGAAAGAGTCAGCCCGGCTGGGG + Intronic
1138222939 16:55268469-55268491 ACAAAGTGTCAGAGCTACTGGGG + Intergenic
1145050966 17:19660246-19660268 CCAAAGATTCAGCTCGTCTGAGG + Intronic
1147861032 17:43523530-43523552 ATAAAATGTAAGCTCAGCTGAGG + Intronic
1148515561 17:48213686-48213708 ACATAGTGACAACTCAGCTGGGG - Intronic
1150241426 17:63636770-63636792 ACAAGGAGGCAGCCCGGCTGTGG + Intronic
1151396080 17:73823904-73823926 TCAAAGTGTCACCACTGCTGTGG + Intergenic
1153049215 18:885393-885415 TCAAAGTGTCACCTCAGTTGAGG + Intergenic
1157658880 18:49420940-49420962 ACAAGGTGGCAGCGAGGCTGGGG + Intronic
1158119533 18:54033326-54033348 ACAGAGTGACAGCTAGGCTTTGG - Intergenic
1162394247 19:10407208-10407230 ACTAAATGTCAGCTCCACTGGGG - Intronic
1164333644 19:24285491-24285513 ACAAGGTGGCAGCAAGGCTGGGG - Intergenic
928492215 2:31795741-31795763 ACAAGGTGGCAGCGAGGCTGGGG + Intergenic
928759157 2:34561023-34561045 GCAAAGTGGCAGCAAGGCTGGGG - Intergenic
932599563 2:73113927-73113949 ATAAAATGTCAGCTCAGATGGGG + Intronic
941626434 2:167835456-167835478 GCAAAGTGGCAGCGAGGCTGGGG + Intergenic
948206558 2:236165803-236165825 ACAAAGTCACAGCCCAGCTGTGG - Exonic
948793217 2:240389665-240389687 ACACAAGGTCAGCTCAGCTGGGG - Intergenic
1169234333 20:3917475-3917497 ACAAAGACGCAGCTCTGCTGAGG - Intronic
1172672007 20:36641134-36641156 ACACAGTGTAAGCACCGCTGAGG - Intronic
1174242359 20:49147448-49147470 ACAAATTGTCAGTTTAGCTGTGG - Intronic
1174562992 20:51444644-51444666 TCAAAGTGTCAGCTCGTGTTAGG + Intronic
1178006554 21:28227134-28227156 ACAGAGGGTCAGCTTAGCTGGGG - Intergenic
1178976606 21:37226309-37226331 ACACTGTGGCAGCTCAGCTGTGG + Intronic
1182864462 22:33591291-33591313 ACAAAGTGTCAGTGAGGATGTGG - Intronic
1183341648 22:37284921-37284943 AAATAGAGCCAGCTCGGCTGGGG + Intronic
1183502945 22:38192085-38192107 ACAAAGTGGCATCTGAGCTGGGG + Intronic
1183521546 22:38298605-38298627 ACAAGCTGTCAGCACGGATGAGG + Intronic
1184193795 22:42912788-42912810 AGACAGTTTCATCTCGGCTGCGG - Intronic
1184276001 22:43410237-43410259 ACAAAGCCACAGCTTGGCTGTGG - Intergenic
949155070 3:817130-817152 ACAGAGTTTCAGCTCTGCTAAGG + Intergenic
953083920 3:39648132-39648154 AAAAGGTGTCAGGTGGGCTGTGG + Intergenic
954124286 3:48519580-48519602 ACAAAGAGCCAGGTGGGCTGGGG + Exonic
954427565 3:50451448-50451470 ACAAAGTGTCAGGCAGCCTGGGG - Intronic
957806322 3:85153488-85153510 ACAAAGCGGCAGCAAGGCTGGGG + Intronic
959218537 3:103483885-103483907 GCAAGGTGGCAGCTAGGCTGCGG - Intergenic
959835815 3:110917030-110917052 ACAACGTGGCAGCGAGGCTGGGG - Intergenic
960538225 3:118836680-118836702 CCAAAGTGTCACCTGGGTTGGGG + Intergenic
961078651 3:124005186-124005208 ACAAAGTATCCTCTCTGCTGGGG + Intergenic
961517831 3:127449422-127449444 ACAAAGTGTTAGCTGTGATGAGG + Intergenic
961956038 3:130805043-130805065 GCAAGGTGGCAGCTAGGCTGGGG + Intergenic
965623905 3:170668093-170668115 GCAAAGTGGCAGCAAGGCTGGGG - Intronic
968453453 4:685928-685950 ACAAAGTGTCAGCTCGGCTGTGG + Intronic
975413741 4:74084648-74084670 AAAAAGTGTCTGCTGGCCTGTGG - Intergenic
977734503 4:100397269-100397291 TCAAAGTGTCAAGTTGGCTGAGG - Exonic
979186784 4:117806423-117806445 ACACAGTCTCAGCTCTGCTTTGG - Intergenic
980050798 4:128037626-128037648 ATAAAATGTCAGGTCGGGTGTGG - Intronic
980607541 4:135111972-135111994 GCAAGGTGGCAGCTAGGCTGGGG - Intergenic
981165217 4:141549714-141549736 GCAAGGTGTCAGCGAGGCTGGGG + Intergenic
985115316 4:186584458-186584480 TCAAGCTGTCAGCTAGGCTGTGG - Intergenic
989768764 5:45117510-45117532 GCAAAGTGGCAGCAAGGCTGGGG - Intergenic
992404896 5:76447627-76447649 ACCAAGTGTGAGCTAAGCTGGGG + Intronic
994903551 5:105805992-105806014 ACAAAGGGTCAGTTCAGGTGTGG + Intergenic
995214709 5:109582059-109582081 ACAAATTGTCAGCTGTGCAGGGG - Intergenic
997874391 5:137535531-137535553 GCAAAGTGACAGCAAGGCTGGGG + Intronic
1000024641 5:157348022-157348044 AGAAAGTGTGAGCCTGGCTGGGG - Intronic
1000162919 5:158617661-158617683 ACAATGTGTCAACTGGTCTGGGG - Intergenic
1001566127 5:172700629-172700651 ACAAAGGGGCAGGGCGGCTGTGG - Intergenic
1002161285 5:177315233-177315255 ACAAAGTTTGAGCTGGGCAGGGG + Intergenic
1003811399 6:9786510-9786532 CCAAAGTGTGACCTGGGCTGTGG - Intronic
1005125872 6:22446042-22446064 ATAAAGTGGAAGCTCGTCTGTGG + Intergenic
1006010677 6:31040471-31040493 TCAAGGTGTCAGCTGGTCTGTGG - Intergenic
1009873781 6:69480620-69480642 ACAAGGTGGCAGCAAGGCTGGGG + Intergenic
1011251605 6:85377613-85377635 GCAAAGTGGCAGCGAGGCTGGGG + Intergenic
1011440211 6:87379655-87379677 ACAAAGTGTAAGCTCCACTATGG - Intronic
1011498016 6:87955674-87955696 ACCAAGTGTCAGCAAGGATGTGG - Intergenic
1012871527 6:104678266-104678288 ATAAAGTGTCTGCTGGACTGGGG + Intergenic
1016333887 6:142983119-142983141 ACAAGGTGGCAGCGAGGCTGGGG - Intergenic
1016493147 6:144629710-144629732 GCAAAGTTTCAGCTCAGATGAGG - Intronic
1018202091 6:161404418-161404440 ACAAAGTGTCACTGGGGCTGTGG - Intronic
1019084746 6:169465393-169465415 AAAAAGTGTCAGTGAGGCTGTGG + Intronic
1026645490 7:72164535-72164557 TGAAGGTGTCAGCTGGGCTGTGG - Intronic
1027629460 7:80584401-80584423 ACAAAGTGTCAGTTAGACAGGGG + Intronic
1028211287 7:88077772-88077794 GCAAGGTGGCAGCTAGGCTGGGG + Intronic
1030294414 7:107907324-107907346 ATAAACTGTCAGCAAGGCTGAGG - Intronic
1031383450 7:121116888-121116910 ACATAGTGTCAGCTTGGCTAAGG + Intronic
1032010894 7:128347144-128347166 ACAAAATATTAGCTGGGCTGTGG + Intergenic
1032352915 7:131182352-131182374 AGAGAGTGACAGCTTGGCTGTGG - Intronic
1032940226 7:136780355-136780377 GCAAGGTGGCAGCTAGGCTGGGG - Intergenic
1033960075 7:146903756-146903778 ACAAAGATTCAGCTAGACTGGGG + Intronic
1034208948 7:149345549-149345571 GCAAGGTGGCAGCTAGGCTGGGG - Intergenic
1035575039 8:698988-699010 CCAAAGTCTCGGCTCAGCTGTGG + Intronic
1036593633 8:10192402-10192424 TCAAGGTGTCAGCTGGGCTGCGG - Intronic
1037465161 8:19152538-19152560 ACAATGAGTCAGCCCAGCTGTGG - Intergenic
1038079131 8:24112660-24112682 ACCAAATGTCAGCAAGGCTGTGG - Intergenic
1040865689 8:52047053-52047075 GCAAAGTGGCAGCGAGGCTGGGG - Intergenic
1041545960 8:59043041-59043063 ACAAAGTTTCAGCTAGACAGAGG - Intronic
1044817149 8:96125044-96125066 CCAAAGTGTCAACTGTGCTGAGG - Intergenic
1047008868 8:120649759-120649781 GCAAGGTGGCAGCTAGGCTGGGG - Intronic
1047407546 8:124597932-124597954 TCAAAATGTCAGCAGGGCTGAGG - Intronic
1047837940 8:128714764-128714786 GCAAAGTGGCAGCGAGGCTGGGG + Intergenic
1050143431 9:2540153-2540175 ACAAAATCTCAGCTCATCTGAGG - Intergenic
1051350243 9:16192163-16192185 ACAAACTGTGAGCACGTCTGTGG + Intergenic
1052714495 9:32098937-32098959 ACAAGGTGGCAGCAAGGCTGGGG + Intergenic
1053463923 9:38291121-38291143 TCAAGGTGTCAGCAGGGCTGTGG - Intergenic
1058114696 9:101071494-101071516 ACATAGTGTCAGCTCCAGTGGGG + Intronic
1058902990 9:109458199-109458221 ACAAATGGTCATCTCGACTGGGG + Intronic
1059960050 9:119556130-119556152 CCAAAGTCTCAGGGCGGCTGTGG + Intergenic
1185709569 X:2292360-2292382 CCAAAGTGTCATCTGGCCTGAGG - Intronic
1186396336 X:9212587-9212609 GCAAGGTGTCAGCTGGGCTATGG + Intergenic
1186950430 X:14618676-14618698 TCAAAGTGTCAGCTGGGATGAGG + Intronic
1189679442 X:43500192-43500214 ACAAAGTGTCAGCATTGCTAGGG - Intergenic
1191187591 X:57629802-57629824 ACAAGGTGGCAGCGAGGCTGGGG + Intergenic
1191683563 X:63866048-63866070 GCAAGGTGGCAGCTGGGCTGGGG - Intergenic
1191814126 X:65224798-65224820 ACAAGGTGGCAGCGAGGCTGGGG + Intergenic
1195391415 X:104366360-104366382 GCAAAGTGGCAGCGAGGCTGGGG - Intergenic
1197012571 X:121584572-121584594 AAAAAGTGTCATCTTGTCTGGGG - Intergenic
1197202964 X:123764878-123764900 ACAAACTGTCAGCTAGCCTAAGG - Intergenic
1201570292 Y:15406533-15406555 ACAATGTGGCAGCTAGGCTGGGG + Intergenic
1201945908 Y:19509791-19509813 ATAAAGTGGCAGCAAGGCTGGGG - Intergenic