ID: 968453454

View in Genome Browser
Species Human (GRCh38)
Location 4:685933-685955
Sequence GTGTCAGCTCGGCTGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968453444_968453454 22 Left 968453444 4:685888-685910 CCACAAGGACGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 8
4: 78
Right 968453454 4:685933-685955 GTGTCAGCTCGGCTGTGGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 168
968453450_968453454 10 Left 968453450 4:685900-685922 CCAGAGGGTTCGCTGGGTGGGCG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 968453454 4:685933-685955 GTGTCAGCTCGGCTGTGGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 168
968453449_968453454 11 Left 968453449 4:685899-685921 CCCAGAGGGTTCGCTGGGTGGGC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 968453454 4:685933-685955 GTGTCAGCTCGGCTGTGGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968453454 Original CRISPR GTGTCAGCTCGGCTGTGGCC TGG Intronic
900466093 1:2826176-2826198 GAGACAGCTTGGCTGTGGTCAGG + Intergenic
900928306 1:5719769-5719791 GTGTCGGCTAGGCAGTGGGCAGG + Intergenic
900946234 1:5832856-5832878 GTGTCAGATCCGATGAGGCCTGG - Intergenic
902348180 1:15834813-15834835 GTGGCAGCTCGGATGCAGCCCGG + Intergenic
902715923 1:18272681-18272703 GTGTCCCCTCGGCTCTTGCCAGG + Intronic
903846314 1:26281525-26281547 GTGTCTGGTTGGTTGTGGCCTGG + Intronic
906614062 1:47223187-47223209 ACTTCAGCTTGGCTGTGGCCTGG - Intronic
907314968 1:53562503-53562525 GAGCCAGTTCGGCTGTGGTCTGG - Intronic
909350899 1:74652344-74652366 GTGTCAGCTACACTGTGGTCTGG + Intronic
910212620 1:84808948-84808970 GTGTCAGCTGTACTGTGGACAGG + Intergenic
910595082 1:88972364-88972386 GTGTCACCTTGGCTATGCCCTGG - Intronic
910928195 1:92417534-92417556 GTCTCAGCTTGACTGTGACCTGG - Intergenic
911651293 1:100391819-100391841 CTGTCAGCCAGGCTGTGGGCTGG + Intronic
915367362 1:155323640-155323662 GTGCCAGCTCGGGGCTGGCCAGG - Intronic
916420581 1:164634312-164634334 GTGTCAGCTGGTGTGGGGCCAGG - Intronic
919504726 1:198384933-198384955 GTGTAAGGTTGGCCGTGGCCAGG + Intergenic
922484737 1:225964873-225964895 GTGTCAACTTGATTGTGGCCGGG + Intergenic
922815156 1:228443522-228443544 GTGTCAGCAGGGCTGGGGTCTGG - Intergenic
924384718 1:243490343-243490365 GTGGCAGTGCGGCTGTGGCTCGG - Intronic
924418680 1:243886506-243886528 GGGTCAGATCTCCTGTGGCCTGG + Intergenic
1063069804 10:2649690-2649712 GAGTCAGCTCGGCTATGGCCTGG - Intergenic
1067300709 10:45006220-45006242 ATGTCAGCTCCACTTTGGCCTGG - Intergenic
1067519509 10:46986313-46986335 GTGTCAACTTGGCTGAGCCCTGG - Intronic
1069550890 10:69363236-69363258 GGGTTAGCTAGGCTGTGGCATGG + Intronic
1069839134 10:71328186-71328208 GTGTCAGCAGGGCTGGGACCCGG + Intronic
1069982477 10:72261815-72261837 GTGTCAGCAAGGCTGGAGCCAGG - Intergenic
1071130758 10:82390881-82390903 GGGACAGCTCTGATGTGGCCTGG + Intronic
1072804598 10:98416692-98416714 GTGTCTGCTCCTCTGAGGCCAGG - Exonic
1073470792 10:103720927-103720949 AAGTGAGCTCAGCTGTGGCCAGG - Intronic
1073540352 10:104312670-104312692 GGGGCAGCTCGGCTGTGATCAGG - Exonic
1075483086 10:122798932-122798954 CAGGCAGCTGGGCTGTGGCCTGG + Intergenic
1076633184 10:131865283-131865305 GTGTCTACTTGGCTGTGGCATGG + Intergenic
1077356829 11:2122637-2122659 GTTTCAGGCCGGCTGAGGCCTGG + Intergenic
1081710520 11:45212815-45212837 TGGTCAGCTCGGCCATGGCCTGG - Intronic
1081998007 11:47377206-47377228 ATGTCAGCCCGGCTCTGGTCGGG + Intronic
1083417316 11:62534132-62534154 TTGTCGGCTGGGCTGTGGCCGGG - Intronic
1083687962 11:64388641-64388663 GTGACGGCTGGGCTGGGGCCTGG + Intergenic
1084424195 11:69075716-69075738 GCGTCAGCCTGGCCGTGGCCAGG + Intronic
1084425686 11:69083538-69083560 GGGTCAGCTACTCTGTGGCCTGG - Intronic
1084728966 11:71061073-71061095 GCGTCAGTTCTGCTGTGCCCAGG + Intronic
1091754229 12:3041209-3041231 GTGTCCTCTTGGCTGTGGCCAGG + Intergenic
1092945229 12:13448149-13448171 CTGTCACCTCGACTGTGGCAAGG + Intergenic
1093715639 12:22378211-22378233 TTGTCTGCTTGGCTGTGGTCAGG - Intronic
1097744696 12:63288165-63288187 GTGTCGTCTTGGCTTTGGCCCGG + Intergenic
1101881571 12:108629373-108629395 ATGCCTGCTCAGCTGTGGCCTGG - Intronic
1102072895 12:110036374-110036396 GCGTCTGCTCGCCTGTGTCCAGG - Intronic
1102243689 12:111341769-111341791 GTTTCAGGTAGGCTGGGGCCAGG - Exonic
1102453742 12:113058441-113058463 GTGTCTGCTCACCTGTGTCCTGG - Exonic
1104985253 12:132592967-132592989 GTGTCAGGAAGGCTGAGGCCTGG - Intergenic
1105822273 13:24090249-24090271 TTCTCTGCTCTGCTGTGGCCAGG + Intronic
1106143856 13:27034844-27034866 GTGTCAGCTTGACTGGGGCGCGG - Intergenic
1109251162 13:60022520-60022542 GTGTCAGCAGGGCTGCTGCCTGG + Intronic
1118267582 14:64309789-64309811 GTGAAAGCTCGTCTCTGGCCAGG + Intronic
1120905234 14:89614679-89614701 TTGTCACCTGGGCTGTGCCCAGG - Intronic
1122660820 14:103293760-103293782 GTGTCAGCACAGCTGAGGCTGGG - Intergenic
1122774799 14:104112343-104112365 GTGTCAGCTGGGAACTGGCCTGG - Intronic
1123843246 15:24270079-24270101 GTGGCAGCTCCGCTGGGGCTGGG - Intergenic
1123858325 15:24436296-24436318 GTGGCAGCTCCGCTGGGGCTGGG - Intergenic
1123862953 15:24486760-24486782 GTGGCAGCTCCGCTGGGGCTGGG - Intergenic
1124021886 15:25932964-25932986 GTGACAGCCCGGCTGTGCACCGG - Intergenic
1124042972 15:26121840-26121862 GTGTCATCTCTGCTGTCGTCTGG + Intergenic
1127179445 15:56399388-56399410 GTGGCAGCTTGGCTGTGGGAGGG + Intronic
1129652924 15:77504403-77504425 GAGCCAGCTCAGCTGTGGCAGGG - Intergenic
1131072790 15:89476671-89476693 GCATCAGCTGGGCTGGGGCCTGG - Intronic
1135043548 16:19136209-19136231 GGTTCAGCTCTGCTGGGGCCAGG - Intronic
1136577600 16:31133646-31133668 GTTTAAGCAGGGCTGTGGCCTGG - Intronic
1138451993 16:57098520-57098542 GGGGCAGCCAGGCTGTGGCCAGG + Intronic
1141790794 16:86232745-86232767 GTCTCAGAGCAGCTGTGGCCAGG - Intergenic
1142178466 16:88655872-88655894 GCGTCACCCCTGCTGTGGCCGGG - Intronic
1143518097 17:7430000-7430022 GTGTGAGCTTGGATGTGGGCTGG - Intergenic
1145010497 17:19365071-19365093 GAGACAGCTCTGCTGGGGCCAGG - Intronic
1146868359 17:36358353-36358375 GTGTCATCTGGGCTGTCGACAGG + Intronic
1147071232 17:37958978-37959000 GTGTCATCTGGGCTGTCGACAGG + Intergenic
1147082758 17:38038503-38038525 GTGTCATCTGGGCTGTCGACAGG + Intronic
1147098702 17:38162474-38162496 GTGTCATCTGGGCTGTCGACAGG + Intergenic
1148497010 17:48059071-48059093 GTGGCAGGTCGGCTGAGTCCAGG - Exonic
1150144623 17:62757673-62757695 ACGTCAGCAGGGCTGTGGCCTGG - Intronic
1151240593 17:72754663-72754685 GTGTCACCCCGGCTGCGGCCCGG - Intronic
1152851773 17:82640853-82640875 CTGCCAGCTCGGCTGTGTCTGGG - Intronic
1152855677 17:82663666-82663688 GTGCCAGCGGGGCTGTGGTCGGG - Intronic
1154110558 18:11564993-11565015 CAGACAGCACGGCTGTGGCCAGG - Intergenic
1155555177 18:27010963-27010985 GTGACAGGTCTGCTGAGGCCAGG + Intronic
1156387960 18:36623891-36623913 ATGTGAGCTCGGCTGAGGCAAGG - Intronic
1156469072 18:37366342-37366364 ATGTCAGCTCTCCTGTGTCCAGG + Intronic
1157354505 18:46919969-46919991 GTGTAAGCTCCTCTGTGGCAGGG - Intronic
1157876231 18:51276227-51276249 CTGTCGGCTCAGCTGGGGCCAGG + Intergenic
1160341672 18:78094559-78094581 GGGTCAGCAGGGCTGTGACCAGG + Intergenic
1168294122 19:55370400-55370422 GGGTCAGCTGGGCCGCGGCCTGG + Intronic
926721642 2:15965646-15965668 GGGACTGCTCGACTGTGGCCAGG + Intergenic
927476791 2:23419890-23419912 GTCCCAGCTCGGCTGTTGACTGG + Intronic
927678129 2:25121903-25121925 GTGTCTGCTCTGATGTTGCCGGG + Intronic
927881287 2:26691938-26691960 GTGTCAGCTCATGTGTGCCCAGG + Intergenic
927888312 2:26731900-26731922 CTGTCAGCTGGGGTGTGTCCAGG - Exonic
929347416 2:40902819-40902841 GTGTCAGCTTGGCTGAGCCATGG - Intergenic
930672689 2:54168122-54168144 GTGTCAAATCTGCTGTGTCCAGG + Intronic
932293959 2:70609004-70609026 GTGACATCAAGGCTGTGGCCAGG - Intronic
940243287 2:151586655-151586677 GTGTCAGCTTGGCTGGGGCATGG + Intronic
940244243 2:151597208-151597230 GTGTCAGCTTGGCTGGGGCATGG + Intronic
940245199 2:151607754-151607776 GTGTCAGCTTGGCTGGGGCATGG + Intronic
941299624 2:163785216-163785238 GTGTCAGCTTGACTGTGCCATGG + Intergenic
942116551 2:172735086-172735108 GTCTCGGTTCTGCTGTGGCCCGG + Intergenic
943046935 2:182870876-182870898 GAGTCAGAATGGCTGTGGCCAGG + Intergenic
947731608 2:232434500-232434522 GAGGCAGCTGGGGTGTGGCCAGG + Intergenic
948208507 2:236175808-236175830 GTGGCTGCTGTGCTGTGGCCTGG - Intergenic
948590700 2:239047811-239047833 GTGTTTGCCCGGCTGTGGGCAGG + Intergenic
1169201108 20:3710638-3710660 GGGTCAGCTCTGCTATGGCCAGG + Intergenic
1171187018 20:23129957-23129979 ATGTCAGCCAGACTGTGGCCTGG + Intergenic
1172814828 20:37678142-37678164 GTGCCAGCACGTCTGTGGCACGG - Intergenic
1178472512 21:32905960-32905982 GTGTCAGCTTGGCTGGGACATGG + Intergenic
1178976608 21:37226314-37226336 GTGGCAGCTCAGCTGTGGAAGGG + Intronic
1179609149 21:42538160-42538182 GTGCCAGCTGTGCTGTGACCTGG + Intronic
1180206616 21:46264955-46264977 GTGTCCCCTTGGGTGTGGCCTGG - Intronic
1180218856 21:46345160-46345182 GTGGCAGCACTGCTGTGGCGTGG + Intronic
1180991798 22:19941616-19941638 GTGTCCGCGCGGCGGTGGCCAGG - Exonic
1181343020 22:22198114-22198136 GAGTCAGCAGGGCTGTGTCCTGG + Intergenic
1183336206 22:37248206-37248228 GTGTGAGCTGGGCGGTGGCTGGG - Intergenic
1184112995 22:42406117-42406139 GTGTCAGGTGAGCTGTGGACTGG - Intronic
1184193794 22:42912783-42912805 GTTTCATCTCGGCTGCGGACAGG - Intronic
1184866642 22:47205232-47205254 GTGTGAGCTTGGAGGTGGCCAGG - Intergenic
1184874813 22:47267550-47267572 GTGTCTGCCCTGCTGAGGCCAGG + Intergenic
1185066310 22:48633278-48633300 GTTCCAGCATGGCTGTGGCCTGG + Intronic
1185276519 22:49952282-49952304 GTGTCAGCTCTGCTGAGGCCGGG - Intergenic
949822647 3:8133027-8133049 GTCTCAGCTTCCCTGTGGCCAGG + Intergenic
949896704 3:8772638-8772660 GTGTCAGCTTGGCTGGGCCATGG - Intronic
951966361 3:28390036-28390058 GTGTCAGCTTGGCTGGGCCATGG - Intronic
957950409 3:87118670-87118692 ATGTCACCTTGGCTATGGCCAGG - Intergenic
959502724 3:107125025-107125047 GTGTCATCTCAGCACTGGCCAGG + Intergenic
962154624 3:132933097-132933119 GTGTCAGCTTGGCTGAGTCTAGG + Intergenic
963843015 3:150127258-150127280 GTGTCATCTCAGCAGTGGCTGGG + Intergenic
964358693 3:155871719-155871741 GTGCCAGCTCGCCCGAGGCCTGG + Intronic
966750623 3:183318130-183318152 TGGGCAGCTCTGCTGTGGCCAGG + Exonic
968008269 3:195257373-195257395 GTGTCAGCTCGGCAGGAGCCAGG + Intronic
968453454 4:685933-685955 GTGTCAGCTCGGCTGTGGCCTGG + Intronic
968746389 4:2362704-2362726 GTGGCAGCACGGCTGTGCCTGGG - Intronic
969306785 4:6330373-6330395 GTGTCAGCTTGGCTGGGCCAAGG + Intronic
969648646 4:8449113-8449135 GTGTCAGCACTGCTGGGACCTGG + Intronic
969714333 4:8861095-8861117 GCGCCAGCTCCGCTGTGTCCGGG - Intronic
970450676 4:16164081-16164103 GGGACAGCTGGGCTGGGGCCTGG + Intronic
972235846 4:37133378-37133400 GTGACAACTTGGCTGTGGCCAGG - Intergenic
975647822 4:76563015-76563037 GTCTCAGTTCTGCTGTGGTCTGG + Intronic
977055567 4:92186350-92186372 GTATCAGCTTGGTTGTGACCTGG + Intergenic
984925855 4:184806077-184806099 GTGTGAGCCAGGCTTTGGCCAGG + Intronic
985418846 4:189763328-189763350 GTGTTAGCTCAGCCGTGTCCTGG - Intergenic
991569920 5:68043181-68043203 GTCACAGCCCTGCTGTGGCCAGG + Intergenic
992197512 5:74354586-74354608 TCCCCAGCTCGGCTGTGGCCAGG + Intergenic
994141543 5:96347147-96347169 GTGCCAGCCCTGGTGTGGCCAGG + Intergenic
997984660 5:138492586-138492608 GGGGCAGCTCGGCTGAAGCCAGG - Intergenic
1000859031 5:166434102-166434124 GTGTCTGCTCTCATGTGGCCAGG - Intergenic
1002451878 5:179323415-179323437 GTGTCAGCATGGCTGAGGGCAGG + Intronic
1003171346 6:3724145-3724167 GTGTCATCTCTGCTGCGGTCAGG - Intronic
1007071262 6:39040044-39040066 CTGGCAGCTCAGCTGTGGCTGGG - Intergenic
1010252921 6:73727096-73727118 GTGTCCACTCTGCTGTGGGCAGG + Intronic
1013318226 6:108961351-108961373 GTGTCCTCTCTGCTCTGGCCAGG + Intronic
1015995416 6:138991371-138991393 GCGTCATCTCGCCTGTGGCCAGG - Intergenic
1017607102 6:156146219-156146241 ATGTAAGCTCCGCTGTGTCCTGG - Intergenic
1020257495 7:6510288-6510310 GTGACTGCTGGGCTGGGGCCTGG + Exonic
1020274813 7:6617467-6617489 GTGTCAGGCAGGCTGAGGCCAGG + Intronic
1023944141 7:44790140-44790162 GTGACAGCTAGACTCTGGCCTGG + Intergenic
1027249516 7:76390232-76390254 CCGCCAGCTGGGCTGTGGCCAGG - Exonic
1027251304 7:76400451-76400473 TCGCCAGCTGGGCTGTGGCCTGG - Exonic
1030148135 7:106377053-106377075 GTGTCACCTTGACTGGGGCCCGG - Intergenic
1032084700 7:128877768-128877790 GTCTCAGAGGGGCTGTGGCCTGG - Exonic
1032132121 7:129238654-129238676 GTGTCAGAACCTCTGTGGCCGGG + Intronic
1034137951 7:148788873-148788895 GTGTCAGCTCTACTGGGGCAAGG + Intronic
1035201806 7:157272532-157272554 CCGACTGCTCGGCTGTGGCCTGG + Intergenic
1035790206 8:2297339-2297361 TTGTCAGCTCGGCAGTGACCAGG + Intergenic
1035802599 8:2424366-2424388 TTGTCAGCTCGGCAGTGACCAGG - Intergenic
1037465160 8:19152533-19152555 GAGTCAGCCCAGCTGTGGCCTGG - Intergenic
1038395241 8:27241618-27241640 GCGTCAGATGGGCTGTGGCCGGG - Intronic
1040280252 8:46037315-46037337 CTGCCACCTAGGCTGTGGCCTGG - Intergenic
1044070772 8:87756971-87756993 GTGCCATCTTGGTTGTGGCCAGG - Intergenic
1046718462 8:117592605-117592627 CTGTCAGATCAGCTGGGGCCTGG - Intergenic
1048251074 8:132867113-132867135 GTGTCAGCCAGGCTCTGCCCTGG + Intronic
1049384335 8:142333637-142333659 GGGTCAGCTCTGCCCTGGCCAGG - Intronic
1053287276 9:36858021-36858043 GTGGCTGCTGGGCTTTGGCCAGG - Intronic
1057772737 9:97983026-97983048 GTCTCAGCGCGGCGGGGGCCGGG + Intergenic
1060213666 9:121725509-121725531 GTGTACGCTCTGCTGTGGGCAGG + Intronic
1060770378 9:126327467-126327489 GTGTCCTCTCTGCTGTGCCCAGG - Intronic
1061985322 9:134127184-134127206 GTGCCAGCTCAGCTGTCTCCTGG + Intergenic
1062210058 9:135358736-135358758 GTGGCAGCCCCTCTGTGGCCGGG - Intergenic
1062485550 9:136773371-136773393 GTGCCAGTTCGGGAGTGGCCTGG + Intergenic
1185626561 X:1486915-1486937 GGGTCAGCCTGGCTGTGACCGGG - Intronic
1188439097 X:30197099-30197121 GTGTCAGCTTGACTGGGGTCAGG + Intergenic
1190817224 X:53939205-53939227 GTCTCTGCTTTGCTGTGGCCAGG + Exonic
1195469058 X:105212376-105212398 GTGGCAAAGCGGCTGTGGCCAGG + Intronic
1199825525 X:151495104-151495126 GTGTCAGCTTGACTGTGGTAAGG - Intergenic