ID: 968453687

View in Genome Browser
Species Human (GRCh38)
Location 4:686846-686868
Sequence CGCCCTCGGGGGAGGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 336}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968453687_968453703 17 Left 968453687 4:686846-686868 CCACCCTGCCTCCCCCGAGGGCG 0: 1
1: 0
2: 3
3: 29
4: 336
Right 968453703 4:686886-686908 CAGAGAGCATGCCCTGACCGGGG 0: 1
1: 0
2: 0
3: 10
4: 135
968453687_968453709 30 Left 968453687 4:686846-686868 CCACCCTGCCTCCCCCGAGGGCG 0: 1
1: 0
2: 3
3: 29
4: 336
Right 968453709 4:686899-686921 CTGACCGGGGACCAGCCTGGGGG 0: 1
1: 0
2: 1
3: 12
4: 164
968453687_968453704 27 Left 968453687 4:686846-686868 CCACCCTGCCTCCCCCGAGGGCG 0: 1
1: 0
2: 3
3: 29
4: 336
Right 968453704 4:686896-686918 GCCCTGACCGGGGACCAGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 186
968453687_968453708 29 Left 968453687 4:686846-686868 CCACCCTGCCTCCCCCGAGGGCG 0: 1
1: 0
2: 3
3: 29
4: 336
Right 968453708 4:686898-686920 CCTGACCGGGGACCAGCCTGGGG 0: 1
1: 0
2: 1
3: 17
4: 190
968453687_968453701 15 Left 968453687 4:686846-686868 CCACCCTGCCTCCCCCGAGGGCG 0: 1
1: 0
2: 3
3: 29
4: 336
Right 968453701 4:686884-686906 GTCAGAGAGCATGCCCTGACCGG 0: 1
1: 0
2: 0
3: 10
4: 115
968453687_968453697 -8 Left 968453687 4:686846-686868 CCACCCTGCCTCCCCCGAGGGCG 0: 1
1: 0
2: 3
3: 29
4: 336
Right 968453697 4:686861-686883 CGAGGGCGGGCACCCAGCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 212
968453687_968453706 28 Left 968453687 4:686846-686868 CCACCCTGCCTCCCCCGAGGGCG 0: 1
1: 0
2: 3
3: 29
4: 336
Right 968453706 4:686897-686919 CCCTGACCGGGGACCAGCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 173
968453687_968453698 -7 Left 968453687 4:686846-686868 CCACCCTGCCTCCCCCGAGGGCG 0: 1
1: 0
2: 3
3: 29
4: 336
Right 968453698 4:686862-686884 GAGGGCGGGCACCCAGCGCAGGG 0: 1
1: 0
2: 1
3: 19
4: 171
968453687_968453702 16 Left 968453687 4:686846-686868 CCACCCTGCCTCCCCCGAGGGCG 0: 1
1: 0
2: 3
3: 29
4: 336
Right 968453702 4:686885-686907 TCAGAGAGCATGCCCTGACCGGG 0: 1
1: 0
2: 1
3: 13
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968453687 Original CRISPR CGCCCTCGGGGGAGGCAGGG TGG (reversed) Intronic
900428110 1:2589652-2589674 GGCCCTCAGGGCGGGCAGGGTGG + Exonic
900786869 1:4655040-4655062 CGCCCTCCGGGGCGGCGAGGAGG - Exonic
901155395 1:7134047-7134069 CTACCTGGGGGGAGTCAGGGAGG - Intronic
901426196 1:9183350-9183372 CGCCCTTGGGGTGGGCAGGGAGG + Intergenic
902461070 1:16577285-16577307 CCCCATGGGGGCAGGCAGGGGGG - Intronic
902833969 1:19035001-19035023 CTCCCTGGCAGGAGGCAGGGTGG - Intergenic
902925325 1:19692250-19692272 CTCCATAGGGGGAGGCGGGGAGG - Intronic
903812798 1:26044190-26044212 CTCACTCAGGGGAGGAAGGGGGG + Intronic
904900535 1:33853753-33853775 CTTCTTTGGGGGAGGCAGGGTGG + Intronic
906083103 1:43107449-43107471 AGCCCACGGGGGAGGGAGGGGGG + Intergenic
906511063 1:46410703-46410725 GGCCCTGGGGGGAGGCATGGAGG + Intronic
910237010 1:85047441-85047463 CGCCGGCGCGGGAGGCAGGGTGG + Intronic
911078838 1:93908938-93908960 CGCCCGCGGGCGAGGGAGGGTGG - Intronic
912795146 1:112688874-112688896 AGGGCTCGAGGGAGGCAGGGCGG - Intronic
913521097 1:119647067-119647089 CTCCTGTGGGGGAGGCAGGGCGG + Intronic
913640452 1:120807719-120807741 CCCCATGGGGGCAGGCAGGGGGG + Intronic
913641225 1:120814003-120814025 CCCCATGGGGGCAGGCAGGGGGG + Intronic
914084190 1:144437913-144437935 CCCCATGGGGGCAGGCAGGGGGG - Intronic
914212063 1:145588905-145588927 CCCCATGGGGGCAGGCAGGGGGG - Intergenic
914278024 1:146142618-146142640 CCCCATAGGGGGAGGCAGGCGGG - Intronic
914364023 1:146962273-146962295 CCCCATGGGGGGAGGCAGGCGGG + Intronic
914364781 1:146968560-146968582 CCCCATGGGGGCAGGCAGGGGGG + Intronic
914453165 1:147811280-147811302 CACCTTCCTGGGAGGCAGGGTGG - Intergenic
914486898 1:148118588-148118610 CCCCATGGGGGCAGGCAGGGGGG - Intronic
914538305 1:148587269-148587291 CCCCATGGGGGCAGGCAGGGGGG - Intronic
914539071 1:148593566-148593588 CCCCGTAGGGGGAGGCAGGCGGG - Intronic
914587231 1:149073736-149073758 CCCCATGGGGGCAGGCAGGGGGG - Intronic
914588007 1:149080021-149080043 CCCCGTGGGGGGAGGCAGGCGGG - Intronic
915570645 1:156743543-156743565 CAGCCTCTCGGGAGGCAGGGTGG - Intronic
916144415 1:161726623-161726645 AGCCCTCGCGGGAAGCAGGAAGG + Intronic
917848310 1:179040542-179040564 CGTCCTGGAGGGAGGTAGGGGGG - Intronic
921016950 1:211200804-211200826 CTCCCTGGGGCCAGGCAGGGTGG + Intergenic
1067015557 10:42754682-42754704 CGCCCTCCGGGGAGGGAGCGTGG + Intergenic
1067944911 10:50683362-50683384 CGCCCCCAGAGGAGGCAGGAGGG - Intergenic
1070284930 10:75075995-75076017 CGGCCTCTGGGTGGGCAGGGAGG - Intergenic
1070575288 10:77672845-77672867 GGCCCCTGGGGAAGGCAGGGAGG - Intergenic
1070800818 10:79243507-79243529 CGCCCTCGGAGCGGGCAGCGCGG + Intronic
1070866412 10:79710233-79710255 CGCCCCCGGAGGAGGCAGGAGGG - Intronic
1070880205 10:79848364-79848386 CGCCCCCGGAGGAGGCAGGAGGG - Intronic
1071511078 10:86262931-86262953 TGCTCTCGGGGGAGGGAGGGCGG - Intronic
1071529278 10:86376908-86376930 CGGCCTCTGGGGAGGGAGTGTGG - Intergenic
1071617995 10:87094275-87094297 GGGCCGCAGGGGAGGCAGGGAGG + Intronic
1071633321 10:87232454-87232476 CGCCCCCGGAGGAGGCAGGAGGG - Intronic
1071646770 10:87364672-87364694 CACCCCCGGAGGAGGCAGGAGGG - Intronic
1071826163 10:89328299-89328321 CTACATGGGGGGAGGCAGGGTGG + Intronic
1072051842 10:91712533-91712555 CGTCAGCGGGGGAGGCAGTGTGG - Intergenic
1072237453 10:93465845-93465867 CTCCCTGGGGGGATGCAAGGAGG - Intronic
1073101341 10:101008349-101008371 GGCACTGGGAGGAGGCAGGGTGG + Intronic
1073381931 10:103084655-103084677 CGCACTCTGAGGATGCAGGGGGG - Exonic
1073424239 10:103446657-103446679 GGCCCACAGGGGTGGCAGGGAGG - Intergenic
1074829967 10:117241270-117241292 CGGGCCCGGGGGAGGCAGGGAGG + Intronic
1075092045 10:119449288-119449310 CGCCCTGAGTGGAGGCAGGTGGG + Intronic
1075137185 10:119795260-119795282 CGTCCGCGAGGGAGGTAGGGGGG - Intronic
1075438386 10:122461404-122461426 CGCCCGCGGAGGGGGCAGGGCGG - Intergenic
1075569396 10:123528996-123529018 GGACCTCATGGGAGGCAGGGTGG - Intergenic
1075587140 10:123666273-123666295 CGCCCTCCTGGGAGCCATGGCGG + Intergenic
1075810700 10:125222664-125222686 TGGCCTCTGGGGAGCCAGGGTGG + Intergenic
1075942756 10:126405575-126405597 TTCCCTTGGGGCAGGCAGGGAGG - Intergenic
1076546496 10:131248960-131248982 CGCCCCGGGGAGAGGCAGGATGG + Intronic
1076635561 10:131880112-131880134 AGCCCTGGAGGCAGGCAGGGTGG + Intergenic
1077082249 11:729295-729317 TGCCCTCAGGGCAGGAAGGGGGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077186285 11:1236816-1236838 AGCCCTCGGGGGATGGAGGGAGG - Intronic
1077285129 11:1762210-1762232 AGCTGTCGGAGGAGGCAGGGCGG - Intronic
1077521221 11:3036134-3036156 TCCCCTCATGGGAGGCAGGGAGG + Intronic
1077544947 11:3165181-3165203 CGGCCCGGGGGGCGGCAGGGCGG - Intronic
1078142091 11:8700059-8700081 TGGCCTGGGGGGGGGCAGGGTGG + Intronic
1078143519 11:8708103-8708125 CGTCCTCCTGGGAGGAAGGGTGG - Intronic
1082789242 11:57335775-57335797 CGCGCTGGGGGGACGCGGGGGGG + Exonic
1083319218 11:61835000-61835022 GGCCCTGGGGGCAGGCAGGGAGG - Intronic
1083609863 11:63999610-63999632 GGCCCGCGGGGGAGGGCGGGAGG - Intronic
1084165555 11:67373358-67373380 CGCCCTCGAGAGGGGCCGGGCGG - Intronic
1084174347 11:67415782-67415804 CGCCCCGGGGAGAGCCAGGGAGG + Intronic
1084432655 11:69120163-69120185 AGCCCCCTGGGGAAGCAGGGTGG + Intergenic
1085531628 11:77195282-77195304 GGGCCTCGGGGGAAGCAGGCTGG - Intronic
1089792082 11:120952784-120952806 TGACCTTGGGGCAGGCAGGGCGG - Intronic
1090733400 11:129590827-129590849 AGCCCTGAGGGGAGGCAGGTTGG + Intergenic
1091437504 12:484228-484250 GCACCTCGGGGAAGGCAGGGCGG - Intronic
1091839095 12:3606371-3606393 GGCCCTCAGGGGAAGGAGGGTGG + Intergenic
1092090834 12:5802460-5802482 CACCTGCAGGGGAGGCAGGGAGG + Intronic
1092155406 12:6278834-6278856 CGGCCGCGGGTGAGTCAGGGCGG - Intergenic
1092159847 12:6310383-6310405 CGCCGCCGGGGGAGGCGGCGAGG - Intergenic
1093736410 12:22625311-22625333 CGCCCTCGCGGGAGGGCTGGGGG - Exonic
1095160325 12:38906742-38906764 GGCGCTCGGGTGAGGCAGGAGGG - Intronic
1096073571 12:48788939-48788961 AGCCCGCGGGGGCGGCGGGGCGG - Intronic
1096500524 12:52061771-52061793 AGCCCTTGGGCGGGGCAGGGTGG - Intergenic
1096743789 12:53712740-53712762 GGTCCTCCGGGGAGGAAGGGAGG - Intronic
1098425944 12:70366174-70366196 CGCCCCCGGGCGGGGCGGGGCGG + Intergenic
1102068649 12:109999599-109999621 CGGCCTCAGGGCAGGCAGGCGGG + Exonic
1103373641 12:120438265-120438287 CCCACTCGGGCGAGACAGGGAGG + Intronic
1104747784 12:131220997-131221019 CACCCTGGAGGGAGGGAGGGAGG - Intergenic
1104759546 12:131288757-131288779 CGCCCTGGGGAGAGGGAGGAGGG + Intergenic
1104821167 12:131678455-131678477 CGCCCTGGGGAGAGGGAGGAGGG - Intergenic
1104830830 12:131750107-131750129 GGCCCTGGTGGGAGGCAGGACGG - Intronic
1105443796 13:20435856-20435878 CGCCCTCGCGGGAGGCAGCCGGG + Intronic
1106477767 13:30113110-30113132 CGCCCCGGGTAGAGGCAGGGAGG - Intergenic
1107058635 13:36131732-36131754 CACCGTCGGGGGAGGGAAGGAGG + Intergenic
1107133399 13:36919912-36919934 CGTCCTCGGGGCAGCCTGGGAGG - Intronic
1108227531 13:48304176-48304198 CGCCGTGGCGGGGGGCAGGGAGG - Intronic
1111672359 13:91347752-91347774 CGCCCTCGGGCGAGGCCGAGGGG + Intergenic
1112601102 13:100856773-100856795 TGCCCTCAGGGCAGGCAGAGTGG + Intergenic
1113639181 13:111944903-111944925 TGGCCTCGGAGGAGGCAGGATGG - Intergenic
1113695423 13:112342639-112342661 CTCCCTCCGGGGGGCCAGGGAGG - Intergenic
1114422778 14:22598445-22598467 CGGCCTCCGGGGAGGGCGGGGGG + Intronic
1115852609 14:37599623-37599645 CGCCCGCGGGCGAGGCCGGGTGG - Intronic
1119004245 14:70908700-70908722 CTCCCTGGGGGGAGGGAGCGGGG + Intronic
1119731929 14:76956625-76956647 CCCGCTCGGGGGAGGCCTGGGGG - Intergenic
1119808652 14:77498856-77498878 CGCCCCCGGAGGAGGCGAGGCGG - Intergenic
1122035974 14:98949752-98949774 AGCCCCCAGGGGAGGCAGGGAGG - Intergenic
1122418343 14:101560875-101560897 CGCCCGCGGGCGAGCCAGGAAGG + Intergenic
1122613434 14:103001146-103001168 TGCCCTTGGCGGTGGCAGGGAGG - Intronic
1122938002 14:104968679-104968701 GGCCCTGGGGGCTGGCAGGGAGG + Intronic
1123025065 14:105420320-105420342 CGGCCGCGGGGGTGGCGGGGGGG + Intronic
1123630782 15:22258297-22258319 CCCGCGCGGGGGAGGCCGGGGGG - Intergenic
1124490362 15:30151479-30151501 GGACCCTGGGGGAGGCAGGGTGG + Intergenic
1124616995 15:31249078-31249100 CGCCCTCGCTGGCTGCAGGGAGG - Intergenic
1124753171 15:32386850-32386872 GGACCCTGGGGGAGGCAGGGTGG - Intergenic
1124969631 15:34474228-34474250 CTCACTCAGGGGAGGCATGGTGG + Intergenic
1124974910 15:34522550-34522572 GGACCCTGGGGGAGGCAGGGTGG - Intergenic
1129644669 15:77419652-77419674 CGCCCCCGGGCGCGGCTGGGAGG - Intronic
1129698965 15:77756793-77756815 TGCCCTCTAGGGAGGCAGAGTGG - Intronic
1130282754 15:82532229-82532251 GGACCCTGGGGGAGGCAGGGAGG + Intergenic
1130467529 15:84200021-84200043 CGCCTTGGGGTGTGGCAGGGAGG + Intergenic
1130496737 15:84473521-84473543 CGCCTTGGGGTGTGGCAGGGAGG - Intergenic
1130589820 15:85204619-85204641 CGCCTTGGGGTGTGGCAGGGAGG + Intergenic
1131174666 15:90202064-90202086 CGCCCTCGGGGGCGGCACCGCGG - Intronic
1131487286 15:92831906-92831928 AGCCTCTGGGGGAGGCAGGGCGG + Intergenic
1132101180 15:99024503-99024525 CGCCCTCAGCGGAGGGAGTGGGG + Intergenic
1133069442 16:3235659-3235681 CGCCGTGGGGGGTGGCGGGGTGG - Intronic
1135246583 16:20862308-20862330 CGTCCTCGGGAGATGCTGGGAGG - Exonic
1137328109 16:47461487-47461509 CGCCTTGGCGGGAGGCAGGTGGG + Intronic
1137542868 16:49377096-49377118 CTCTCGCAGGGGAGGCAGGGAGG - Intronic
1138238524 16:55406869-55406891 GGCCCACAGGGGAGTCAGGGAGG + Intronic
1138539763 16:57680654-57680676 CGCCCTCAAGGGAGGCAGCAGGG + Intronic
1139546854 16:67653540-67653562 CAGCCCCGGGGGAGGGAGGGAGG - Intronic
1140985223 16:80152396-80152418 CGAGCTTGGGGGAGGCAAGGAGG - Intergenic
1141620769 16:85235641-85235663 CACCCTCGGGGGGAGGAGGGGGG - Intergenic
1141631567 16:85290886-85290908 TGCTCTCAGGGGAGGCTGGGTGG - Intergenic
1141648196 16:85378480-85378502 GGCCCTGGGGGAAGTCAGGGAGG - Intergenic
1141657173 16:85422451-85422473 GGCCCACGCGGGAGGCAGTGTGG + Intergenic
1141712012 16:85705183-85705205 GGGCCTCTGGGGAGGCAGTGTGG - Intronic
1141906075 16:87027937-87027959 GGCCCTGGGGAGAGGCTGGGGGG + Intergenic
1142175605 16:88643621-88643643 GGGCCTCCGGGGAGGGAGGGAGG - Intronic
1142239541 16:88938953-88938975 CCGCCTCTGGGGTGGCAGGGAGG - Intronic
1142273547 16:89103802-89103824 CTCCCTTGGAGCAGGCAGGGAGG + Intronic
1142378820 16:89720749-89720771 CGGCCCCGGGTGAGGCGGGGCGG - Exonic
1142865791 17:2790789-2790811 GGCCCTCGGGGCAGGACGGGAGG - Intronic
1143119971 17:4600360-4600382 CAGCCTGGGGGCAGGCAGGGTGG + Intronic
1143473816 17:7191999-7192021 TCCCCTGGGGGCAGGCAGGGTGG + Exonic
1143554710 17:7652759-7652781 CACCCTGGGCAGAGGCAGGGAGG - Intronic
1143620883 17:8079714-8079736 TGCCCGCGAGGGAGGCCGGGAGG + Intronic
1143708618 17:8718163-8718185 CGCCCACGGTGGCGGCGGGGAGG + Intergenic
1145206496 17:20987156-20987178 CTACTTGGGGGGAGGCAGGGAGG + Intergenic
1146160028 17:30554781-30554803 GGACCTCGGGGGAGGTAGGGTGG + Intergenic
1146380303 17:32322887-32322909 AGGCCTGGGAGGAGGCAGGGGGG + Exonic
1147393002 17:40121867-40121889 CCGCCTCGAGGGGGGCAGGGAGG - Intergenic
1147853163 17:43458032-43458054 AGCCCTAGGGCGAGGGAGGGTGG + Intergenic
1147986120 17:44308656-44308678 CGCCGCCGGGGGAGGGAGCGAGG + Exonic
1148862694 17:50612825-50612847 CATCCTGGTGGGAGGCAGGGAGG + Intronic
1149905882 17:60526069-60526091 TGCCCCCGGAGGAGGCAGGGCGG - Exonic
1151552865 17:74832044-74832066 CGCAGCCAGGGGAGGCAGGGAGG + Intronic
1151732236 17:75918266-75918288 CGCCCTGAGGGGAGGCGGGAGGG + Exonic
1152011522 17:77721814-77721836 GCCCTTCGGGGGAGGCAGTGGGG + Intergenic
1152196983 17:78924148-78924170 CGCCATGGAGGGAGGCAGGAGGG - Intronic
1152747894 17:82049611-82049633 GGCCCCTGGGGGAGTCAGGGCGG + Intronic
1153814901 18:8783684-8783706 TGCCCACGGGGGAAGCAGGCGGG + Exonic
1154059147 18:11042560-11042582 CGCTGTGGTGGGAGGCAGGGTGG + Intronic
1154281733 18:13009543-13009565 TGCCCTCGGGCCAGGCATGGTGG + Intronic
1154297278 18:13162048-13162070 GACCCCCGTGGGAGGCAGGGAGG - Intergenic
1155053139 18:22165355-22165377 CGGCCACGGGAGAAGCAGGGAGG + Intergenic
1156502031 18:37566182-37566204 CGCCGACGGGGGAGGCGCGGTGG - Intergenic
1157294900 18:46435409-46435431 GGCCCCTGGGGGAGGAAGGGAGG + Intronic
1157556797 18:48618049-48618071 CACCCTCGGAGAAGGCAGTGAGG + Intronic
1159828917 18:73249467-73249489 CACCCAGCGGGGAGGCAGGGTGG - Intronic
1159962655 18:74567562-74567584 CGGCCTCAGGGGAGGTGGGGTGG + Intronic
1160011293 18:75108731-75108753 GGCCCTCGGTGGAGGCAGGGAGG - Intergenic
1160208433 18:76857034-76857056 GGAACTAGGGGGAGGCAGGGAGG - Intronic
1160502736 18:79410436-79410458 CGCCGTGGGGAGCGGCAGGGCGG - Exonic
1160730626 19:640219-640241 CGCCCGCGGGGGAGTCCCGGAGG + Intronic
1160787403 19:907431-907453 AGCCCTCGGGGAAGTCAGAGGGG + Intronic
1161098516 19:2408292-2408314 AGCCGTCGGGGGAGGCAGACGGG - Intronic
1161169062 19:2804056-2804078 CGACCCCAGGGGAGTCAGGGTGG - Intronic
1161321867 19:3645173-3645195 CACCCACGGGGGTTGCAGGGAGG - Intronic
1161709844 19:5841720-5841742 TGCCCTCGTGGGACCCAGGGAGG + Intergenic
1161800320 19:6413970-6413992 AGCCCTCGCGGCAAGCAGGGTGG - Exonic
1161805764 19:6442145-6442167 CACCCTCGATGGAGGCTGGGAGG + Exonic
1162013209 19:7830368-7830390 CGCGCTCGGCGCAGGTAGGGCGG + Intronic
1162395559 19:10416605-10416627 AGCCCCCGCGGGAGGAAGGGTGG + Intronic
1163358520 19:16830113-16830135 GGATCTGGGGGGAGGCAGGGAGG + Intronic
1163567132 19:18058511-18058533 CGCGGTGGGAGGAGGCAGGGCGG + Intergenic
1163721429 19:18899945-18899967 CACCTGCAGGGGAGGCAGGGAGG + Exonic
1163724561 19:18915277-18915299 CGCCATCGGGGGCACCAGGGTGG + Intronic
1164854337 19:31509503-31509525 CACCCTGGGGCCAGGCAGGGTGG + Intergenic
1165321948 19:35091009-35091031 AGCCCTCGGAGCAGGCAGGGCGG - Intergenic
1166870696 19:45868707-45868729 AGGCCTCGGAGGAGGCAGTGGGG + Intronic
1166942040 19:46373167-46373189 TGCCCTCCAGGGAGGCAGCGTGG - Intronic
1167369025 19:49070010-49070032 CTCCCTAGAGGGAGGGAGGGAGG - Exonic
1168317345 19:55490037-55490059 TCCCCTCGGGGGGGGCAGGAGGG - Intronic
1202678290 1_KI270711v1_random:27305-27327 CCCCGTGGGGGGAGGCAGGCGGG - Intergenic
926141520 2:10371128-10371150 AGCCCTGGGGCCAGGCAGGGCGG + Intronic
926141849 2:10372656-10372678 CACCCTCCGGGCAGGCAGGGAGG - Intronic
926220980 2:10935272-10935294 AGACGTCGGGGGAGGGAGGGAGG - Intergenic
926315162 2:11704387-11704409 CCCACCCGGGGGAGGCAGAGCGG + Intronic
927656288 2:24949347-24949369 CCCTCTCTGGGGAGGCAGAGTGG - Intronic
928123153 2:28598518-28598540 CTTCCTGGGGAGAGGCAGGGAGG - Intronic
931511425 2:63000086-63000108 CATCCTGGGGGGAGGCAGGATGG + Intronic
931941305 2:67254780-67254802 GGTCCTCGTGGGAGGCAGCGTGG + Intergenic
932144603 2:69306757-69306779 CTCCGGAGGGGGAGGCAGGGCGG + Intergenic
932226668 2:70046658-70046680 CACCCCTGGGGGAGGGAGGGTGG + Intergenic
932725686 2:74178380-74178402 CGCCCTCGGGGGCGCTCGGGCGG + Intronic
933779843 2:85794049-85794071 AGGGCTGGGGGGAGGCAGGGAGG - Intergenic
933869966 2:86556654-86556676 CTCTCTCGGGGAAGGCGGGGAGG + Intronic
936403182 2:112181731-112181753 TGCCCTCGGGGGCGGCTGCGGGG - Exonic
937157398 2:119730708-119730730 GGCCCTCGGGGGAGGTGGGAAGG + Intergenic
937218651 2:120328741-120328763 GGCCTTTGGGGCAGGCAGGGAGG - Intergenic
937243620 2:120478141-120478163 AGAACTCTGGGGAGGCAGGGAGG - Intergenic
938062452 2:128263898-128263920 CTCCCTCGGGGGAGCCAAGATGG - Intronic
938159669 2:128973860-128973882 GGCCCTGGTGGCAGGCAGGGAGG - Intergenic
938766408 2:134463067-134463089 AGCCCTTGGGGTAGGCAGTGTGG - Intronic
938812103 2:134863041-134863063 CGACCTCCTGGGAGGTAGGGGGG + Intronic
941934772 2:170973993-170974015 TGCCCTCGGAGGAAGCCGGGTGG - Intergenic
946152326 2:217785051-217785073 GCCCCTCGGGGGTGGCAGAGAGG + Intergenic
946821530 2:223634607-223634629 GGCCCTGGGGGTAGGCAGGAAGG - Intergenic
947151843 2:227123584-227123606 CGCCCTAGGGGAAGGGAGTGGGG + Intronic
947875430 2:233464582-233464604 CACCCTCGGGGGAGGCTGTGGGG - Intronic
948726708 2:239938661-239938683 TGCCCTGGGGGGCTGCAGGGTGG + Intronic
948839684 2:240642797-240642819 CCCCCTGGGGGGCGGCAGGTGGG - Intergenic
1168878215 20:1185427-1185449 CGGCCGCTGGGGAGGCGGGGGGG + Intronic
1171207324 20:23291073-23291095 CTGCCTCTGTGGAGGCAGGGAGG - Intergenic
1172696719 20:36828072-36828094 CGCCCTCGGGGGAGGAAGGCAGG + Intronic
1173752396 20:45487527-45487549 CGTCCTCGGGGGATGGGGGGCGG - Intergenic
1174052772 20:47778824-47778846 GGCACTAGGGGGAGGCTGGGGGG + Intronic
1174533963 20:51236799-51236821 GGCCCTTGGGGGAGGCAGCAAGG + Intergenic
1175646391 20:60676549-60676571 CGCCTTCGAGGAAGACAGGGAGG + Intergenic
1175824180 20:61927721-61927743 CTCCCACTGGGGAGCCAGGGAGG - Intronic
1175933355 20:62503738-62503760 TCCTCTCTGGGGAGGCAGGGAGG + Intergenic
1175946227 20:62560117-62560139 CAGGCTGGGGGGAGGCAGGGCGG - Intronic
1176206523 20:63891627-63891649 CACCCTTGGGAGAGGCAGGCAGG + Intergenic
1178416158 21:32406778-32406800 CCCCATCGAGGGAGGCAGGAAGG - Intergenic
1179289803 21:40008518-40008540 GTCCCTCTGGGGAGTCAGGGAGG + Intergenic
1180073324 21:45449534-45449556 CCCCCACGGTGGGGGCAGGGTGG - Intronic
1180187250 21:46145847-46145869 CGCCCCCGGGGGCCGCAGAGCGG + Exonic
1180968977 22:19805132-19805154 AGCCCTCACAGGAGGCAGGGTGG - Intronic
1181652916 22:24270830-24270852 GGCCCGCGAGGGAGGCCGGGCGG + Exonic
1182508644 22:30803169-30803191 CTCCCTGGGGTGAGTCAGGGCGG + Intronic
1183323830 22:37180799-37180821 AGCCCTGGGAGGAGGCAGGAAGG + Exonic
1183903478 22:41022640-41022662 TGCCCGCGGTGGGGGCAGGGAGG + Intergenic
1184175882 22:42788471-42788493 GGACCCTGGGGGAGGCAGGGAGG + Intergenic
1184712752 22:46262842-46262864 GGGCCGCGGGGGAGGCCGGGCGG + Exonic
1185394148 22:50578281-50578303 CGCGCTCGGGTGGGGAAGGGCGG - Intronic
950875253 3:16265354-16265376 GGCCCTCGGGAAAGGCGGGGTGG + Exonic
952962154 3:38599024-38599046 CGCCATCGGAGGAGCCAGGCGGG - Exonic
955001379 3:54930728-54930750 CTACCTCGCCGGAGGCAGGGAGG + Intronic
955400398 3:58587100-58587122 CGCCGCCGGGGGAAGGAGGGGGG + Intronic
958934336 3:100240890-100240912 GGCCATCGGTGCAGGCAGGGTGG - Intergenic
961458293 3:127034896-127034918 CGCCCTCAGGGGCTCCAGGGTGG - Exonic
962259950 3:133895848-133895870 CGCCGGCGGAGGAGGCAGGCGGG - Intergenic
966886787 3:184381378-184381400 CGCCCTGCGGGGAGGGAGGCAGG + Intronic
967811941 3:193767933-193767955 AGCCCCCAGGGGATGCAGGGGGG + Intergenic
968453687 4:686846-686868 CGCCCTCGGGGGAGGCAGGGTGG - Intronic
968556019 4:1246920-1246942 AGCCCTTGGGGGAGGCAGACAGG + Intronic
969053239 4:4386995-4387017 AGCCCCCGGGAGAGGCAGGAAGG + Exonic
969235908 4:5864954-5864976 TGGGCTGGGGGGAGGCAGGGAGG + Intronic
969626932 4:8310442-8310464 GGCCCTCGGCGTGGGCAGGGTGG - Intergenic
970120283 4:12745964-12745986 GGGCCTTGGGGGACGCAGGGAGG + Intergenic
972437926 4:39052364-39052386 AGCCCTCTGGGGAGGCTGAGGGG - Intronic
975106856 4:70577333-70577355 AGCCTTCAGGGGAGGCTGGGGGG + Intergenic
978556673 4:109988618-109988640 TGCACTTGGAGGAGGCAGGGGGG - Exonic
978618707 4:110619529-110619551 CGCCGTCTGGGGCGACAGGGAGG - Intronic
980990584 4:139735462-139735484 CGACCTCCGGGGGGGGAGGGTGG + Intronic
982525049 4:156467381-156467403 TGCCCTCGGGTGGGGGAGGGGGG - Intergenic
984715072 4:182917472-182917494 AGCCCTGAGGGGAGGGAGGGAGG + Intronic
985493602 5:192895-192917 CTCCCTCGAGGGAGACTGGGAGG - Intronic
985524766 5:396241-396263 CATCCTCAGGGGAGGCATGGGGG + Intronic
986347154 5:6846140-6846162 AGGCCTCGGGGGTGGCGGGGAGG - Intergenic
987088051 5:14487749-14487771 CGCGCCAGGGGGAGGCAGGGAGG - Exonic
988941442 5:36151911-36151933 GGCCCACGGGGTAGGCGGGGAGG - Exonic
990925029 5:61011246-61011268 CTTCCTCTGGGGAGGCAGCGGGG - Intronic
990953412 5:61320496-61320518 TGCCCACGGGTGAGGCAGGCAGG - Intergenic
992473178 5:77077497-77077519 CGCCCTCGGGGGCCGCAGCGGGG + Exonic
992866369 5:80960656-80960678 CGCCCTCGAGGGAGCCAGCTGGG + Exonic
995764676 5:115602361-115602383 GCCCCTCGGGGGCGGCGGGGTGG - Exonic
996623364 5:125538040-125538062 TGCCCTCGCTGGAGGCTGGGAGG + Intergenic
997177775 5:131796983-131797005 CGCCCATGGGGGTGGCGGGGCGG - Exonic
997292396 5:132747392-132747414 CGCCGCCGGGGGAGGTGGGGAGG - Intergenic
997844685 5:137275964-137275986 AGGGCTCAGGGGAGGCAGGGAGG - Intronic
998077877 5:139251038-139251060 ACCCCGCGGGAGAGGCAGGGCGG - Intronic
998132844 5:139659896-139659918 AGCCCCCCGGGAAGGCAGGGAGG + Intronic
998308511 5:141102655-141102677 CGCCTCCGGGAGAGGCAGGTAGG - Exonic
998316720 5:141189324-141189346 CGCCTCCGGGAGAGGCAGGTAGG - Exonic
998317352 5:141194558-141194580 CGCCTCCGGGAGAGGCAGGTAGG - Exonic
998318984 5:141210913-141210935 CGCCTCCGGGAGAGGCAGGTAGG - Exonic
998319549 5:141216129-141216151 CGCCTCCGGGAGAGGCAGGTAGG - Exonic
998382773 5:141737527-141737549 AACCCTGGGGGCAGGCAGGGTGG - Intergenic
999062817 5:148654178-148654200 CACCCGAGGGGGCGGCAGGGAGG - Intronic
999327095 5:150650212-150650234 CGCCCTGGAGGGAGACACGGGGG - Exonic
1001082113 5:168675081-168675103 CACCCTCGGCGGGGGCTGGGAGG + Intronic
1002466177 5:179410015-179410037 GGCCCTCGGTGGAGGCCAGGAGG + Intergenic
1003058145 6:2841560-2841582 AGCCCGCGAGGGAGGGAGGGAGG - Intronic
1003111718 6:3256679-3256701 CGCCCTTGCAGTAGGCAGGGTGG + Intronic
1003152984 6:3568530-3568552 CCCCCTCGGGGGAGGCAGGCAGG + Intergenic
1003212419 6:4079342-4079364 GCCCCGCGGGGGAGGCCGGGCGG - Exonic
1003544895 6:7051424-7051446 CGCCCTCGGGGGACGCCGCCTGG - Intergenic
1007733780 6:43967873-43967895 CTTCCCCGGGGGAGGCAGGCTGG - Intergenic
1016937261 6:149456621-149456643 CACCCTGGGGGGCGGCGGGGCGG - Intronic
1017647785 6:156555098-156555120 GACCCTCGGGGGTGGCAGTGAGG - Intergenic
1018400264 6:163414432-163414454 GCCCCGCCGGGGAGGCAGGGAGG + Intronic
1019565680 7:1677883-1677905 TGTCCTTGGGGTAGGCAGGGAGG + Intergenic
1020094860 7:5362600-5362622 GGTCCGCGGGGGAGGCTGGGTGG - Intronic
1021313266 7:19117479-19117501 GGCGCGCGGGGGAGGCGGGGAGG + Exonic
1021912336 7:25398847-25398869 TGCCCTTGGGGTAGGCAGTGAGG - Intergenic
1022103015 7:27180319-27180341 GGCCCTCCTGGGGGGCAGGGAGG - Intergenic
1023819514 7:43972768-43972790 CCCCCCCGGGGGGAGCAGGGTGG + Intergenic
1024229651 7:47354456-47354478 AGCCCTGGGGTGGGGCAGGGGGG + Intronic
1025821322 7:64967568-64967590 CGTCCGGGAGGGAGGCAGGGGGG - Intergenic
1029351435 7:100015741-100015763 CGGCCTCTGGGGTGGGAGGGCGG + Intronic
1029437849 7:100572834-100572856 CGCCCCCGGGGGACCAAGGGAGG + Intronic
1029744567 7:102509737-102509759 CCCCCCCGGGGGGAGCAGGGTGG + Intronic
1029762558 7:102608899-102608921 CCCCCCCGGGGGGAGCAGGGTGG + Intronic
1029821232 7:103149416-103149438 CGTCCTCGGCGGAGCCAGCGCGG - Intronic
1030176646 7:106661021-106661043 CGCCCTCGGAGGGGGAGGGGCGG - Intergenic
1030729739 7:112972237-112972259 AGCACTCGGGGTAGGGAGGGAGG + Intergenic
1032078248 7:128846232-128846254 TGCCCTCGGGGCAGGAGGGGTGG + Intronic
1034223194 7:149460837-149460859 CACCCTCGGGCGAGGCCGGGAGG + Exonic
1034279019 7:149838688-149838710 CGGGCTCGGGCGAGGCGGGGCGG + Intronic
1034508882 7:151519074-151519096 CGCCCGCGGCGAAGGCGGGGAGG + Intronic
1034531677 7:151699800-151699822 GGCCCTCAGAGGAGGCAGTGGGG + Intronic
1035422696 7:158742526-158742548 CTCCCTCTGGGGACGCCGGGTGG - Intronic
1035527835 8:327463-327485 CTCCCTCGGGGTAGGCAAAGTGG - Intergenic
1035611056 8:964750-964772 GGCCCTCGGGGGAGGGTAGGTGG - Intergenic
1037481944 8:19313739-19313761 AGCCGTCGGGGAAGGGAGGGAGG - Exonic
1037841109 8:22245593-22245615 CACCCTCGGGGGAGTCAAGAAGG + Exonic
1037892121 8:22628945-22628967 CCCACTCTGGGGAGGCTGGGGGG + Intronic
1038577332 8:28716556-28716578 GGCCTTCGGGGGAGGGAGGCCGG - Exonic
1039476432 8:37841590-37841612 GGGCCGCGGGAGAGGCAGGGGGG - Exonic
1039854237 8:41398646-41398668 CTTCCTCAGGGCAGGCAGGGGGG + Intergenic
1040950991 8:52939241-52939263 CGAACTCGGGGGAGGCAGACAGG + Exonic
1045248578 8:100464554-100464576 AACCCTGAGGGGAGGCAGGGAGG - Intergenic
1048423039 8:134295908-134295930 GGCACTCACGGGAGGCAGGGAGG - Intergenic
1048466105 8:134665848-134665870 GGACCTCAGGGGAGGCAGAGGGG - Intronic
1048981633 8:139705678-139705700 CGCCCTGGGGCGAGGGAGCGGGG + Intergenic
1049154757 8:141059739-141059761 AGCCCCCGTGGGAGGCAGGATGG + Intergenic
1049532651 8:143162160-143162182 AGCCCTCCGGGGAGCCAGGGTGG + Intergenic
1049650320 8:143763863-143763885 AGCCCTAGGGGCAGGCAGAGTGG + Intergenic
1049657996 8:143807268-143807290 CTCACTCGAGGGTGGCAGGGGGG - Intronic
1049675423 8:143886884-143886906 AGCCCCTGGGGGAGGCGGGGTGG - Intergenic
1049748346 8:144272424-144272446 GGCCCTCTGGGGAGGCCGGCTGG - Intronic
1055611680 9:78031302-78031324 CTGCCTCGGGGGAGCGAGGGCGG - Exonic
1056243284 9:84669925-84669947 CGCCCCAGGGGGAGACAGTGAGG - Intronic
1057361093 9:94374505-94374527 CGGCCTGTGGGGAGGCGGGGCGG + Intergenic
1059841909 9:118227001-118227023 CTCCCTCTGGGGAGGGAGTGTGG + Intergenic
1060675499 9:125510688-125510710 CAACCTGGGGGAAGGCAGGGTGG + Intronic
1061061754 9:128254109-128254131 GGACCCTGGGGGAGGCAGGGAGG - Intronic
1061630115 9:131866996-131867018 CCCCATCGGGGGAGCCTGGGGGG - Intronic
1062336916 9:136075334-136075356 CAGCCTCGGGGGAGCTAGGGAGG - Intronic
1062439776 9:136564494-136564516 CTCCCGCTGGAGAGGCAGGGAGG + Intergenic
1062502686 9:136858123-136858145 AGCCCTCGGGGGAGGGGGAGGGG - Intronic
1062518523 9:136947734-136947756 CGGCCTGGGTGGGGGCAGGGAGG + Intronic
1062614965 9:137392212-137392234 TGGCCTCGGGGGAGGGAGAGAGG + Intronic
1062699585 9:137891953-137891975 TGCTCTCAGGGGAGACAGGGAGG - Intronic
1187941938 X:24391166-24391188 TGCTCCCAGGGGAGGCAGGGAGG + Intergenic
1188388413 X:29590454-29590476 ATCACTCGGGAGAGGCAGGGAGG - Intronic
1190292010 X:48999502-48999524 AGCCTTTGGGGGAGGCAGGAAGG + Exonic
1195740921 X:108063742-108063764 CACCCTGGGGGCAGGCAGAGAGG + Intronic
1195743699 X:108092066-108092088 CTCCCTAGGCGGTGGCAGGGAGG - Intronic
1196645893 X:118116920-118116942 CGCCTGCGCGGGAGGCAGGGTGG + Intronic
1197745956 X:129932357-129932379 CGTGCTCGGGGGAGTGAGGGCGG - Intergenic
1198321339 X:135521381-135521403 CGCCTTAGGCGGGGGCAGGGGGG - Intronic
1198750335 X:139932264-139932286 CGCCCCCGGGTCAGGCAGGCCGG - Intronic