ID: 968456753

View in Genome Browser
Species Human (GRCh38)
Location 4:704295-704317
Sequence CACGTTATCCGGGTGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968456753_968456763 5 Left 968456753 4:704295-704317 CCTCCTCCCACCCGGATAACGTG No data
Right 968456763 4:704323-704345 CCAGTGCTGGAGATCTCAGCAGG No data
968456753_968456759 -8 Left 968456753 4:704295-704317 CCTCCTCCCACCCGGATAACGTG No data
Right 968456759 4:704310-704332 ATAACGTGTCCACCCAGTGCTGG No data
968456753_968456764 23 Left 968456753 4:704295-704317 CCTCCTCCCACCCGGATAACGTG No data
Right 968456764 4:704341-704363 GCAGGCCCCCAGCCCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968456753 Original CRISPR CACGTTATCCGGGTGGGAGG AGG (reversed) Intergenic
No off target data available for this crispr