ID: 968457274

View in Genome Browser
Species Human (GRCh38)
Location 4:706092-706114
Sequence TGCCAAGGGCTTCCCGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968457274_968457294 22 Left 968457274 4:706092-706114 CCTGGCCCGGGAAGCCCTTGGCA 0: 1
1: 0
2: 1
3: 17
4: 208
Right 968457294 4:706137-706159 AGCCCAGTCAGGACTCCGGGAGG 0: 1
1: 3
2: 2
3: 28
4: 197
968457274_968457292 19 Left 968457274 4:706092-706114 CCTGGCCCGGGAAGCCCTTGGCA 0: 1
1: 0
2: 1
3: 17
4: 208
Right 968457292 4:706134-706156 CCCAGCCCAGTCAGGACTCCGGG 0: 1
1: 3
2: 9
3: 55
4: 427
968457274_968457287 11 Left 968457274 4:706092-706114 CCTGGCCCGGGAAGCCCTTGGCA 0: 1
1: 0
2: 1
3: 17
4: 208
Right 968457287 4:706126-706148 GCCGGCACCCCAGCCCAGTCAGG 0: 1
1: 0
2: 3
3: 20
4: 205
968457274_968457284 -7 Left 968457274 4:706092-706114 CCTGGCCCGGGAAGCCCTTGGCA 0: 1
1: 0
2: 1
3: 17
4: 208
Right 968457284 4:706108-706130 CTTGGCAGGCCCGGGAGGGCCGG 0: 1
1: 0
2: 2
3: 41
4: 530
968457274_968457290 18 Left 968457274 4:706092-706114 CCTGGCCCGGGAAGCCCTTGGCA 0: 1
1: 0
2: 1
3: 17
4: 208
Right 968457290 4:706133-706155 CCCCAGCCCAGTCAGGACTCCGG 0: 1
1: 3
2: 8
3: 45
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968457274 Original CRISPR TGCCAAGGGCTTCCCGGGCC AGG (reversed) Intronic
900159546 1:1217021-1217043 TGCCGGGTCCTTCCCGGGCCTGG - Exonic
900328079 1:2120584-2120606 AGCCAAGGGCTGGCCGGGCACGG - Intronic
900346325 1:2212227-2212249 TGCGGGGGGCTTCCCAGGCCAGG + Intronic
900594977 1:3476548-3476570 GGACTAGGGCTGCCCGGGCCTGG - Intronic
900609802 1:3539706-3539728 AGCCAAGGGCCTCCTGGGCTGGG - Intronic
901836244 1:11925937-11925959 GGCCAACGGCTTCCTGGCCCTGG - Exonic
902939059 1:19786589-19786611 TGCCAAGGGCTGCCCCAGGCAGG + Intronic
903914512 1:26753818-26753840 TGCCAAGGGCATCCCTCACCAGG + Intronic
904160280 1:28518101-28518123 GGCCAAGGGCTCCCCCAGCCCGG + Intronic
904160290 1:28518122-28518144 GGCCAAGGGCTCCCCCAGCCCGG + Intronic
905485390 1:38292434-38292456 TGCCCAGGGCTCCCCAGGCTGGG - Intergenic
915168771 1:153963434-153963456 TGCCCAGGCCTCCCCGGGCCCGG - Exonic
915318835 1:155044867-155044889 TGCCATGCTCTACCCGGGCCAGG - Intronic
915530775 1:156500944-156500966 TCCCCAGGGCTGGCCGGGCCAGG + Intergenic
917074405 1:171188910-171188932 TGCCAAGTGCTTCCCGTTGCTGG - Intronic
922777173 1:228220364-228220386 TGCACAGGGCTTCCTCGGCCAGG - Intronic
1063587502 10:7365809-7365831 TGCCAAGGGTTTTCCGGGGAGGG + Intronic
1064418011 10:15167925-15167947 CGCCGAGGGGGTCCCGGGCCCGG - Intronic
1065699162 10:28407924-28407946 TGAGAAGGGCTTCCTGGGCAGGG + Intergenic
1066602798 10:37125811-37125833 TGTCAAGGTCGTGCCGGGCCCGG + Intronic
1067186225 10:44030209-44030231 TCCCAAGGACTTCAGGGGCCAGG - Intergenic
1067479235 10:46584575-46584597 TGCCAAGGGCCTCCGGCTCCAGG + Exonic
1067615504 10:47757226-47757248 TGCCAAGGGCCTCCGGCTCCAGG - Intergenic
1070535290 10:77372621-77372643 TGCCAAGGTCTTCCGGATCCAGG + Intronic
1070700026 10:78595192-78595214 TGCCAAGGGCTTGCCATACCAGG - Intergenic
1071463117 10:85917182-85917204 TGCCAAGTGCTTGCTGAGCCTGG + Intronic
1072757316 10:98030015-98030037 GGCCAGTGGCTTCCCAGGCCCGG + Intronic
1075213394 10:120510999-120511021 TATCAAGGGCTTCCCAGGCAAGG - Intronic
1075802428 10:125161262-125161284 TCCCGAGGGCCTCCCGGGCGGGG - Intergenic
1076372605 10:129964840-129964862 TGCCCAGGGCTCCCCGGCCAAGG + Intergenic
1076795444 10:132795801-132795823 TGCAAAGGGCTCCCGGCGCCCGG + Intergenic
1077044940 11:540558-540580 TGCCAAGGGCTTGCTGTGACGGG + Intronic
1077464837 11:2728782-2728804 GGCCAAGGGCTGCCAGGACCAGG - Intronic
1077472425 11:2770273-2770295 TGCCCAGGGCTGCCTGTGCCAGG - Intronic
1078010801 11:7571771-7571793 TCCCAAGGGGCTCCTGGGCCGGG + Intronic
1078160335 11:8834632-8834654 TTCCAAGGGCTTCCGGGAGCAGG - Intronic
1078467129 11:11558712-11558734 TGCAAAGTGCTTTCCTGGCCAGG - Intronic
1079087421 11:17456556-17456578 TACCCAGGGCCTCCCGGGGCTGG - Intronic
1080638879 11:34147022-34147044 TGTCTAGGGCTTCCCAGCCCAGG + Intronic
1084297381 11:68221777-68221799 TGCACAGGGCTTCCCAGGCGGGG + Intergenic
1084649140 11:70478371-70478393 TGTCAAGGGCCTGCTGGGCCTGG + Intronic
1084900652 11:72307650-72307672 TGCCATGTGGTTCCAGGGCCTGG - Intronic
1084945200 11:72634520-72634542 TTCCAAGGGCTTCCGCTGCCTGG - Intronic
1085018607 11:73191207-73191229 TCCCTAGGCCTTGCCGGGCCTGG - Intergenic
1085393535 11:76194699-76194721 TCCCCAGCGGTTCCCGGGCCCGG + Exonic
1089008486 11:115113201-115113223 TACCAAAGGCCTCCCTGGCCTGG - Intergenic
1089254760 11:117188422-117188444 GGGCTAGGGCTTCCCAGGCCAGG - Intronic
1090363141 11:126187014-126187036 TGTGAAGGGCGTCCCGGGCTGGG + Intergenic
1090709773 11:129374389-129374411 TGCCGGAGGCTTCCCGGGCGCGG + Intergenic
1090830700 11:130419023-130419045 TCCCCAGGGCTTCCGGAGCCAGG + Intronic
1094197463 12:27764441-27764463 TGCCAAGGGGGTCCGGGGTCCGG - Intronic
1104773341 12:131378537-131378559 TGGCAAGGGCTTCCTGGGAAGGG - Intergenic
1106343851 13:28857081-28857103 TGCCGAGGTCTTCCCTTGCCAGG - Intronic
1106783792 13:33087195-33087217 GGCCATGGGCTTCCAGAGCCTGG - Intergenic
1107687894 13:42922466-42922488 TGCCAAGGGTTTGCGGGGACAGG + Intronic
1113108826 13:106799927-106799949 TTCCAAGTGTTTCCCGGGTCTGG - Intergenic
1114671236 14:24412156-24412178 TGCCCAGCCCTTCCCAGGCCTGG - Intronic
1119610402 14:76056913-76056935 TGCCCAGGGCATCCCCAGCCTGG - Intronic
1121310802 14:92934047-92934069 TGCCGAGGGCATCCTGGCCCAGG - Intronic
1122615012 14:103011199-103011221 TGCCACGGGCCTCCTGGGGCAGG + Intronic
1125920830 15:43524683-43524705 TGACAGGTGCTTCCTGGGCCTGG - Exonic
1126497329 15:49306635-49306657 TGCCTAGGGCTGGCCTGGCCTGG - Intronic
1128514003 15:68330997-68331019 TGCCAAGGGCTCCCACTGCCAGG + Exonic
1131068451 15:89449028-89449050 TGCCAAAGGCATCCCCGGCCTGG + Intergenic
1132221821 15:100110827-100110849 TGCCAAGGTCGTCCGAGGCCAGG - Intronic
1132318296 15:100906372-100906394 TGCCAAGGGCTTTCTGGGGCAGG + Intronic
1132551306 16:554880-554902 TGCCCAGTCCTTCCCGGCCCTGG - Intergenic
1132588208 16:715286-715308 TGCCATGGGGTTCCCGGCCGCGG + Exonic
1132934779 16:2474879-2474901 TGCCGAGGGCATCGGGGGCCCGG - Intergenic
1133253792 16:4503356-4503378 TGCAGAGGGCTTCCTGGGGCAGG - Intronic
1134531878 16:14989860-14989882 GGCCAACGGCTTCCTGGCCCTGG - Intronic
1135991097 16:27219267-27219289 TGCAGAGGCCTTCCTGGGCCTGG - Intronic
1136453949 16:30370091-30370113 CGCCCCGGGGTTCCCGGGCCGGG - Exonic
1137288234 16:47033833-47033855 AGCCCAGGGCTTCCTGGGCCTGG - Intergenic
1137609482 16:49809312-49809334 TTCCAAGGGCCCCCAGGGCCGGG - Intronic
1139601360 16:67989427-67989449 TGCGTAGGGCTTCCAGGGCAGGG + Intronic
1139708433 16:68758384-68758406 TGCGAAGTGCTTCCAGTGCCTGG + Intronic
1141395029 16:83696928-83696950 AGCCAGGGGCTTCCTGGGCCAGG - Intronic
1141502612 16:84454229-84454251 TGCCAAGAGATTCATGGGCCTGG - Intronic
1141681558 16:85547175-85547197 TGCCCAGAGCTTCCCAGGGCTGG + Intergenic
1143055045 17:4156356-4156378 TGCCAAGGGCTTCCCAGAGAAGG + Intronic
1143113474 17:4567094-4567116 TGCCAAGGGCAGCCCTGGCTTGG + Intergenic
1144737849 17:17564841-17564863 TCCCAAGGCCCTCCCTGGCCAGG - Intronic
1145862020 17:28218864-28218886 TGCACAGAGCTTCCCGGGACTGG + Intergenic
1147962558 17:44177044-44177066 TGCCAACGGCTGCGGGGGCCTGG + Exonic
1150217332 17:63477817-63477839 GGCCAAGGGCTTCCAGAGCCCGG - Intergenic
1151377384 17:73699204-73699226 TGCCGAGGGCTTCCCTGGCATGG - Intergenic
1151485282 17:74395098-74395120 GGCCAAGGTCTTCCCAGGACTGG + Intergenic
1151608440 17:75154690-75154712 TCCCAAGGCCTTCCCAGTCCAGG - Intronic
1152287765 17:79422480-79422502 CACCCAGGGCTTCCCGGCCCAGG + Intronic
1152353390 17:79795429-79795451 TTCGAAGGCCCTCCCGGGCCCGG + Exonic
1152552290 17:81035653-81035675 GTCCGAGGGCTTCCGGGGCCCGG - Intronic
1152688795 17:81708121-81708143 TGCCAAGGGCTGCCCAGCACTGG - Intergenic
1154475224 18:14748443-14748465 TGGCAAGGGCGTGCGGGGCCCGG + Exonic
1155158581 18:23177903-23177925 TGCAAAGGGCTTCCCTGAGCCGG - Intronic
1155404433 18:25472487-25472509 TGCCTAGGGTTTCCAGGGCCTGG + Intergenic
1158885580 18:61823887-61823909 AGCCAAGGGCATCCTGTGCCAGG + Intronic
1160735926 19:662477-662499 TGCCTGGGGCGTTCCGGGCCTGG + Intronic
1160806936 19:996056-996078 TGCCTGGGGCTCCCAGGGCCCGG + Intronic
1161270786 19:3388164-3388186 TGCTATGAGCTTCCCGGGCCGGG - Intronic
1163695428 19:18761176-18761198 TGGCAAGGCCGTCCCGGCCCTGG + Intronic
1166309945 19:41957242-41957264 TGCCAAGGCCCTCCAGGTCCTGG + Intronic
1166329648 19:42070438-42070460 TGCCCAGGGCTGCCTGGGCAGGG - Exonic
1166333452 19:42091615-42091637 GGCTAAGGGCATGCCGGGCCAGG + Intronic
1166566811 19:43770443-43770465 TGCCAAGGCCTTGAAGGGCCAGG - Intronic
1167002694 19:46755539-46755561 AGCCTAGGAATTCCCGGGCCCGG + Exonic
1168292255 19:55362391-55362413 TGTCAGGGGCGTCCAGGGCCAGG + Exonic
927108873 2:19850210-19850232 TGCCCAGGGCTTTCCGGCCTGGG - Intergenic
932764716 2:74462372-74462394 GGCCAAGGGCTTCCCGGGTGAGG + Exonic
934219599 2:90070022-90070044 TGCCAATGCCTTCACTGGCCTGG - Intergenic
934567114 2:95347016-95347038 TGCCATGGGCATCCAGGGCATGG + Intronic
935256665 2:101315595-101315617 TGTAAAGGGCTGCCCAGGCCTGG - Intergenic
935783004 2:106524383-106524405 TGCCTTAGGCTTCCCAGGCCTGG - Intergenic
938035112 2:128028464-128028486 GGCCAAGGGATCCGCGGGCCGGG + Intergenic
938465252 2:131520779-131520801 TGCCAAGAGCCGCCTGGGCCTGG + Intergenic
939630274 2:144520479-144520501 TGCCAAAGGCTTGACGGGCGGGG - Intronic
943188051 2:184639367-184639389 TGAAAAGGGCTTCCTAGGCCAGG - Intronic
943256518 2:185600519-185600541 TGCCAAGCAGTTCCAGGGCCAGG - Intergenic
947714245 2:232331892-232331914 TGCCATCGGATTCCCGGGCAAGG - Intronic
947720326 2:232366089-232366111 TGCCATCGGATTCCCGGGCAAGG - Intergenic
947733455 2:232443271-232443293 TGCCATCGGATTCCCGGGCAAGG - Intergenic
947989076 2:234472950-234472972 AGCCTAGGGTTTCCTGGGCCAGG - Intergenic
948147588 2:235719680-235719702 TGCCCAAGGCTTCCTGGGTCAGG + Intronic
948151465 2:235747900-235747922 TGCCAAAGGATTCCTGGGCTGGG + Intronic
948321846 2:237076173-237076195 TGCCTGGGGCTTCCGGGGCTTGG + Intergenic
948362471 2:237432794-237432816 TGCCGATGGCATCCCGGACCTGG - Intergenic
1169197743 20:3692557-3692579 TGCCCTGGGCATCCTGGGCCTGG + Exonic
1170898866 20:20440726-20440748 TGCCAAGGAAGGCCCGGGCCGGG - Intronic
1174254317 20:49243008-49243030 TACCAAGGGCTCGCCGGGCACGG - Intronic
1174594361 20:51671745-51671767 TGCCAGGGGCTGCCAGGGCTAGG - Intronic
1175266092 20:57704323-57704345 TGCCAGGGGCTCCCCGAGGCTGG - Intronic
1175479560 20:59301577-59301599 TGCCCAGGGCTTCCAGGGCTTGG - Exonic
1176299972 21:5094904-5094926 TCCCCAGGGCTTCAGGGGCCAGG - Intergenic
1176664275 21:9669890-9669912 TGCCAAGTGCTTCTAGGCCCTGG - Intergenic
1178387192 21:32162318-32162340 GGCCAGGGGCTTCCCATGCCTGG - Intergenic
1179451814 21:41473299-41473321 TGCCAGGGGCGGCGCGGGCCGGG - Intronic
1179730640 21:43365507-43365529 CACCTAGGACTTCCCGGGCCTGG + Intergenic
1179857050 21:44167007-44167029 TCCCCAGGGCTTCAGGGGCCAGG + Intergenic
1179919440 21:44499670-44499692 AGCCTAGGGCATCCCGGGCCTGG - Exonic
1179957690 21:44750367-44750389 GGCCAAGGGCTTCCGAGCCCTGG - Intergenic
1180169465 21:46050396-46050418 TGCCAAGGGCTGCCAGGGTGCGG - Intergenic
1180843762 22:18970816-18970838 GGCCAAGGGCGCCCCGGCCCCGG + Intergenic
1181121594 22:20670984-20671006 TGGCAGGCGCCTCCCGGGCCGGG + Intergenic
1181993118 22:26852948-26852970 TGCAAAGCCCTTCCCAGGCCAGG + Intergenic
1183103371 22:35597836-35597858 TCCCAATGGCTACCAGGGCCTGG - Intergenic
1183409558 22:37646933-37646955 TGCCCAGGGCTCCCCGGATCAGG - Intronic
1184149680 22:42630890-42630912 TGACAAGGGCTTCGTGGACCTGG - Exonic
1184642292 22:45879123-45879145 GGCCAAGGCCTTCCAGTGCCGGG + Intergenic
1185235500 22:49710467-49710489 TCCCAAATGCTTCCCGAGCCAGG + Intergenic
949635052 3:5973556-5973578 TGCCACGGGGTTCCCTGCCCAGG - Intergenic
950142529 3:10625314-10625336 TGTCATGGGCTTCGGGGGCCTGG + Intronic
953149434 3:40310298-40310320 TGCAAAGGGTATGCCGGGCCAGG + Intronic
953879387 3:46683781-46683803 TGCCAAGGACTCCCAGGGCCAGG - Exonic
954124537 3:48520819-48520841 TCCCAAGGGCTGCCAGGCCCAGG + Intronic
954753083 3:52824547-52824569 TGATTAGGGCTTCCCGGGTCTGG + Exonic
961109631 3:124272996-124273018 TGCCAAGAGCTTCCCAGATCTGG - Intronic
961807531 3:129500082-129500104 TGCCAAATGCTTCTCGGGGCAGG - Intronic
965118483 3:164521295-164521317 TGCCAAGGGCTACCCAGGTGAGG + Intergenic
965367670 3:167820407-167820429 GGGCAGGGGCTTCCTGGGCCTGG - Intronic
968457274 4:706092-706114 TGCCAAGGGCTTCCCGGGCCAGG - Intronic
968890792 4:3367448-3367470 TGTGCTGGGCTTCCCGGGCCCGG + Intronic
968909275 4:3469372-3469394 TGCAAAAGCCTTCCCTGGCCAGG + Intronic
969675072 4:8610108-8610130 TCCCAAGGGCTTCCTGGGGCAGG + Intronic
976180141 4:82391089-82391111 TGCCAAAGGCTGGCCGGGCGCGG - Intergenic
976216581 4:82720854-82720876 TCCAAAGGGCTGTCCGGGCCAGG + Intronic
982073188 4:151713687-151713709 TGCCAAGGGCTGCCAGGTCCTGG - Intronic
985409739 4:189670569-189670591 TGCCAAGTGCTTCTAGGCCCTGG - Intergenic
985655393 5:1129129-1129151 TGCCTAGGGCCTGCCAGGCCAGG + Intergenic
990008587 5:50969436-50969458 TGCGAAGGGCTTCCCGCCCAGGG + Intergenic
992204671 5:74419877-74419899 TTCCAAGGGAGTCCAGGGCCTGG - Intergenic
992939444 5:81749795-81749817 TGACAGTGGCATCCCGGGCCGGG + Intronic
995182083 5:109238724-109238746 AGCCATGGGCTTCCCTGGCTGGG + Intergenic
996697832 5:126418436-126418458 TGGCAAGGGCTTACTGGTCCAGG - Intronic
997283623 5:132663454-132663476 TGCCAAGGGGCTCCCCGCCCTGG - Intergenic
997639828 5:135441883-135441905 TGCCATGGGCTTCCGGGCTCAGG + Intergenic
999192613 5:149759796-149759818 TGCCAAGAGCCCCCTGGGCCAGG + Intronic
999214317 5:149919140-149919162 GGCTCAGGGCTTCCTGGGCCTGG + Intronic
999473031 5:151873242-151873264 TTCCAAGGGCTTCCTGGGGGAGG + Intronic
1002099551 5:176850626-176850648 TGCAAACGGCTTCCCGGGCTCGG - Intronic
1002617966 5:180467295-180467317 TGCCCAGGGCTTCCCGGCTGTGG - Intergenic
1002775719 6:326074-326096 TGCCCTGGGCTTCCCCGTCCTGG + Intronic
1004864491 6:19838692-19838714 CCCCGAGGGCTTCCGGGGCCAGG + Intronic
1006172943 6:32105703-32105725 TGCCAGGATCTTCCCTGGCCTGG - Intronic
1006917897 6:37607534-37607556 GGCCAAGGAATTCCCGGGACTGG - Intergenic
1008025362 6:46629852-46629874 TGCCAACAGTTTCCTGGGCCAGG - Intronic
1011781437 6:90794330-90794352 TGCCAAGTGCTGACCAGGCCTGG + Intergenic
1012530453 6:100229214-100229236 TGGAAAGGTCTCCCCGGGCCCGG - Intergenic
1016440161 6:144075154-144075176 TTCCAAGGGCTTTCAGGTCCAGG + Intergenic
1017750735 6:157488282-157488304 TGCCAGGAGATTCCCAGGCCTGG - Intronic
1019395704 7:816693-816715 GGCCAAGGGCACCCCGGGGCGGG + Intronic
1019511718 7:1421048-1421070 TCCCATGGGCGTCCCGTGCCAGG + Intergenic
1019612179 7:1942139-1942161 TGCTGAGGGCATCCAGGGCCTGG - Intronic
1024566695 7:50687266-50687288 TGCCAATAGATTCCTGGGCCTGG - Intronic
1026584815 7:71647573-71647595 AGCCATGGGCTTCCAGGGCCTGG - Intronic
1026638427 7:72104303-72104325 TGCCTAGGGCTTGCAGGGACAGG + Intronic
1027136642 7:75629209-75629231 TGCCTACTGCTACCCGGGCCTGG - Intronic
1027216722 7:76188548-76188570 TGCCAGGTGCCTCCTGGGCCTGG - Intergenic
1033328442 7:140398337-140398359 TCCGAGGGGCTTCCCGGGTCGGG - Intronic
1034902336 7:154915256-154915278 CGGCCCGGGCTTCCCGGGCCTGG + Intergenic
1035372656 7:158389148-158389170 TGCCGAGGGCTTCAGGGCCCAGG - Intronic
1042643022 8:70956013-70956035 ACCCAGGGGCTTCCCGAGCCAGG - Intergenic
1044613694 8:94118877-94118899 GGCCAATGGTTTCCCTGGCCAGG - Intergenic
1048464607 8:134655050-134655072 TGCAAGGGGCTTCCCAGGCAGGG + Intronic
1048592915 8:135838038-135838060 TGGCAAGGGCTGGCAGGGCCAGG + Intergenic
1049213168 8:141395939-141395961 TGCCAAGGGCCACCCTGGCTGGG + Intronic
1051265743 9:15307037-15307059 TGTCCAGGGCTTCAGGGGCCGGG + Intronic
1057470020 9:95349266-95349288 TGCCCACGGCGTCCCGGTCCTGG + Intergenic
1057619016 9:96619118-96619140 TGCCCGGGGCCTCCGGGGCCGGG - Intronic
1058786711 9:108394926-108394948 TGCCCTGGGATTCCCGGACCTGG - Intergenic
1060265433 9:122109143-122109165 GGCCACTGGCTTCCTGGGCCTGG + Intergenic
1060731504 9:126039733-126039755 TGCCAATCGCTTTCCTGGCCAGG - Intergenic
1060807646 9:126587783-126587805 TTCCCAGGGCTTCCCTGTCCGGG + Intergenic
1061158942 9:128882327-128882349 TGCCCCGGGCGCCCCGGGCCGGG - Intronic
1061924412 9:133798930-133798952 TGCCCTGGGCTTCCCGGGCCAGG - Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062540446 9:137039627-137039649 TGGCAAGGGGTCCCAGGGCCTGG + Exonic
1203661827 Un_KI270753v1:51862-51884 TGCCAAGTGCTTCTAGGCCCTGG + Intergenic
1203673017 Un_KI270755v1:34911-34933 TGCCAAGTGCTTCTAGGCCCTGG + Intergenic
1190335356 X:49258473-49258495 GGCCGAGGGCTTGCCAGGCCTGG + Exonic
1197750321 X:129959510-129959532 TGGCAAGGGCTGCCCAGCCCAGG - Intergenic
1200034583 X:153319300-153319322 TGCCCAGGCCTCCCCGGCCCAGG - Intergenic
1200060218 X:153480711-153480733 TGGAAAGCGCTTCCCAGGCCAGG + Intronic
1200557468 Y:4654414-4654436 TGCCTAGGGCTTCCAGGACTCGG - Intergenic
1200709693 Y:6472465-6472487 TGCCTAGGGTTTCCTGGGTCTGG - Intergenic
1201024419 Y:9692243-9692265 TGCCTAGGGTTTCCTGGGTCTGG + Intergenic
1202178916 Y:22122747-22122769 GGCCTAGGGCTTCCTGGGTCTGG - Intergenic
1202212445 Y:22463647-22463669 GGCCTAGGGCTTCCTGGGTCTGG + Intergenic