ID: 968459796

View in Genome Browser
Species Human (GRCh38)
Location 4:718836-718858
Sequence GCCTGGCCAGAGATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 426}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968459792_968459796 -7 Left 968459792 4:718820-718842 CCTGGGGTCAGTTCCTGCCTGGC 0: 1
1: 0
2: 2
3: 57
4: 367
Right 968459796 4:718836-718858 GCCTGGCCAGAGATGGAGCAGGG 0: 1
1: 0
2: 3
3: 39
4: 426
968459787_968459796 16 Left 968459787 4:718797-718819 CCATGGGGGAGGCAACTTTACTG 0: 1
1: 0
2: 1
3: 7
4: 109
Right 968459796 4:718836-718858 GCCTGGCCAGAGATGGAGCAGGG 0: 1
1: 0
2: 3
3: 39
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968459796 Original CRISPR GCCTGGCCAGAGATGGAGCA GGG Intronic
900759571 1:4461910-4461932 GCCCGGGCAGAGAAGCAGCACGG - Intergenic
901035138 1:6331862-6331884 GCCTGGTCAGACACGGAGCTGGG + Intronic
901061059 1:6472087-6472109 GCCAGGGCAGAGGTGGAGAAGGG - Intronic
901092489 1:6651306-6651328 GCCTGGCCAGGGCTGGGACAAGG + Intronic
903002728 1:20277794-20277816 TCCTGGCCAAAGATGGCCCATGG - Intergenic
903163689 1:21506923-21506945 GCCAGGGCAGAGCTGGAGGATGG + Intergenic
903275465 1:22218621-22218643 GCGTGGCCAGAGAAGTAGGAGGG - Intergenic
903320742 1:22541668-22541690 GCCTGGGCAGAGCTGGGGGATGG + Intergenic
903575057 1:24334560-24334582 GCCTGGCCAAAGCTGCAGGAGGG + Intronic
903767284 1:25742900-25742922 GCCTGGCCAGGGAGTGAGGAAGG - Intronic
904480564 1:30790658-30790680 GCCTGGCCAGTCATCTAGCAGGG + Intergenic
904976614 1:34461599-34461621 GCAGGGCCAGAGGTGGGGCAGGG + Intergenic
905653567 1:39672035-39672057 GCCGGGTCAGAGCCGGAGCATGG - Exonic
905802599 1:40854778-40854800 GTGTGGCCAGGGATGGAGCAGGG + Intergenic
907383730 1:54111833-54111855 GCCTTGCCAGAGAGGGAGGCCGG - Intronic
908301116 1:62761711-62761733 GCCTGGCGAGAATTCGAGCATGG - Intergenic
908769532 1:67583494-67583516 GTCTGCCCAGAGATAGAGCCAGG + Intergenic
910025047 1:82639802-82639824 GCCTGTCCAGGGGTGGAGCCGGG + Intergenic
910295082 1:85636413-85636435 GCGTGGCCAGAGCAGGAGCAAGG - Intergenic
911062541 1:93760695-93760717 GCCTGCCCACAGAAGGAGCCTGG - Intronic
911488212 1:98528598-98528620 ACATGGCCAGAAAAGGAGCAGGG - Intergenic
911793923 1:102053507-102053529 CCTTGGCCAGAGCTGGAGCTGGG + Intergenic
912106621 1:106285329-106285351 GCCTGCACAGAGAAGGAGAAAGG + Intergenic
913957282 1:143318073-143318095 GCAAGGCCAGAGAAGGACCATGG + Intergenic
914051596 1:144143437-144143459 GCAAGGCCAGAGAAGGACCATGG + Intergenic
914127601 1:144823104-144823126 GCAAGGCCAGAGAAGGACCATGG - Intergenic
915059195 1:153166111-153166133 GACTGGGCAGAGAAGGAGCTAGG - Intergenic
916705555 1:167345661-167345683 GGCAGAACAGAGATGGAGCAAGG + Intronic
917482426 1:175423733-175423755 GCCTGAGCAGGGCTGGAGCATGG + Intronic
918796398 1:188902568-188902590 CCCTGGACTGAGATGGAGAATGG + Intergenic
918998074 1:191788988-191789010 ACATGGCAAGAGATGGAACATGG - Intergenic
920247695 1:204600792-204600814 GCCTGGCCAGGGCTGGAGTCTGG - Intergenic
920631701 1:207659159-207659181 TGCTGGCCAGACATGGAGGATGG + Intronic
920646560 1:207808028-207808050 GCCAGGCCTGAGATGGAGCCGGG - Intergenic
921033497 1:211354308-211354330 GCCTGCCCAGGGCTAGAGCATGG + Intronic
921195913 1:212757590-212757612 CCATGGCAAGAGATGGAGCAAGG + Intronic
921933690 1:220776915-220776937 CCCTGGCCTGAGATGCAGCCAGG - Intronic
1063278458 10:4597726-4597748 CCCAAGCCAGAGATGCAGCAGGG + Intergenic
1063664330 10:8052282-8052304 GACTGGCCGGGGATGGAGAAGGG - Intergenic
1066107992 10:32172292-32172314 GCTGTGCCTGAGATGGAGCAGGG + Intergenic
1066426032 10:35308581-35308603 GTCTGGACAGAGAGGGAGCCTGG + Intronic
1066615047 10:37285329-37285351 GCCTGGCCAGAATTCGAGCGCGG + Intronic
1066696091 10:38078794-38078816 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
1067042523 10:42962587-42962609 GGCTGGCCAGGGATGCAGCCCGG - Intergenic
1067186752 10:44035853-44035875 GCCAGAGCAGAGATGCAGCAAGG - Intergenic
1067409661 10:46053327-46053349 CCCAGGCCTGAGATGAAGCAGGG + Intergenic
1067731913 10:48818893-48818915 GCCTGGCCAGGGAGAGATCAAGG + Intronic
1068889309 10:62132312-62132334 ACATGGCCAGAGAAGGAGGAAGG - Intergenic
1068941999 10:62689520-62689542 GCCTGGCCAGAGCAGGGGCCTGG + Intergenic
1068955851 10:62818187-62818209 GCCCGGCGAGAGCTGGCGCACGG - Intronic
1069025616 10:63537732-63537754 GCCAGGCCACAGATGGAGGCAGG + Intronic
1069693736 10:70371894-70371916 CCCTGGCTAGAGCTGGAGCCAGG - Intronic
1070353050 10:75611747-75611769 CCCTGGCCAGAAATTGAGCTTGG + Intronic
1070735675 10:78862084-78862106 TACTGCCCAGAGATGGGGCAGGG - Intergenic
1071321651 10:84466077-84466099 GCCTGGAAGGAAATGGAGCAGGG - Intronic
1071566306 10:86673086-86673108 TCCTGGGCAGAGGTGGAGCCTGG - Intronic
1072200879 10:93157795-93157817 ACATGGCAAGAGAAGGAGCAAGG - Intergenic
1073451176 10:103610264-103610286 ACCTGGCCAGAGATGTGGCCTGG - Intronic
1075096865 10:119477730-119477752 GCCTCCCCAGAGAGGGAGCTGGG + Intergenic
1075504987 10:123013667-123013689 GCCTGGCTAGAAATCGAGCGCGG + Intronic
1076372968 10:129966904-129966926 GCCAGGCCAGGGATGGGGAAGGG + Intergenic
1076761687 10:132608912-132608934 GCTGGGCCAGAGGTGGAGCTGGG + Intronic
1076825419 10:132964852-132964874 GCCTGGCCACAGTGGGAGGAGGG - Intergenic
1077508146 11:2941591-2941613 GCCTGCCCAGCGATGGGGCTGGG + Intergenic
1078101257 11:8331757-8331779 CCCTGGCCAGAGCTGCATCATGG - Intergenic
1079284635 11:19117506-19117528 CCCTGGCCAGGGATGGAGGCTGG - Intronic
1080275759 11:30501944-30501966 GCCTCCCCAGGGATGGAGAAGGG + Intronic
1080792057 11:35530195-35530217 CCAAGGCCAGAGATGGAGAAGGG + Intronic
1081243164 11:40731371-40731393 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1081993831 11:47351342-47351364 GCCTGGCCACAGAGGGCACACGG - Exonic
1083286280 11:61661208-61661230 ACATGGCCAGAGGGGGAGCAAGG + Intergenic
1083328718 11:61886862-61886884 GCCTGGCCTGAGCTGGAGGAGGG - Intronic
1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG + Intronic
1084655133 11:70510609-70510631 TCCTGGACAGAGGAGGAGCAGGG - Intronic
1085036267 11:73302135-73302157 ACCTGGACAGAGATGGGGCCAGG + Intergenic
1086408127 11:86516893-86516915 GAGTGGCCAGAGAAGGGGCATGG + Intronic
1086682548 11:89690774-89690796 GATTGGCCAGTGATGGATCAAGG - Intergenic
1086694232 11:89824709-89824731 GGCAGTGCAGAGATGGAGCAGGG - Intergenic
1086711914 11:90019802-90019824 GGCAGTGCAGAGATGGAGCAGGG + Intergenic
1087073097 11:94101260-94101282 CCCTGGGCTGAGATGGAGTAGGG - Exonic
1087789532 11:102391839-102391861 GCCAGGCCAGGGAATGAGCACGG - Intergenic
1088097033 11:106113327-106113349 GCCTGGGCACAGATGTAGCAAGG - Intergenic
1088598658 11:111457433-111457455 GCCAGGCCAGGCATGGAGGAGGG - Intronic
1088938913 11:114434279-114434301 ACATGGCCAGAGCAGGAGCAAGG + Intronic
1089850775 11:121494538-121494560 GACTGCTCAGAGATAGAGCAAGG + Intronic
1090253364 11:125266007-125266029 ACCTGGCCAGTTATGGAGCTGGG - Intronic
1090716913 11:129439165-129439187 GAGAGGCCAGAGACGGAGCAGGG + Intronic
1090953000 11:131490036-131490058 GCATGGCGAGAGAGGAAGCAAGG + Intronic
1091280408 11:134378659-134378681 GGCTTGCCAGCGAGGGAGCAGGG + Intronic
1091314660 11:134605073-134605095 ACATGGCCAGAGAAGGAACAAGG + Intergenic
1091829738 12:3540960-3540982 GCCAGGCCAGGCCTGGAGCAGGG + Intronic
1091934164 12:4422324-4422346 TTCTGGCAAAAGATGGAGCAGGG + Intergenic
1092061156 12:5551601-5551623 GACTGGGCAGAGATGGTGTATGG - Intronic
1092077881 12:5688286-5688308 GCCTGGCCTGAACTGGAGAACGG + Intronic
1092545849 12:9450595-9450617 GCCCGGCGAGAAATGGAGCACGG + Intergenic
1092782484 12:11999884-11999906 GTCAGGCCAGAACTGGAGCAAGG - Intergenic
1093040292 12:14370939-14370961 CCCTGGCCAGAAAAGGAGTAAGG - Intronic
1094507106 12:31071478-31071500 GCCCGGCGAGAAATGGAGCACGG - Intergenic
1095171106 12:39037552-39037574 TCCTGTCCTGAGATGAAGCAGGG + Intergenic
1095838698 12:46668730-46668752 GCATGACAAGAGTTGGAGCAAGG + Intergenic
1096138899 12:49225952-49225974 GCGTGGCCAGAGCTGGGTCAGGG + Intronic
1097066210 12:56322727-56322749 GCCAGGGCAGAGGAGGAGCATGG - Exonic
1099930963 12:89074094-89074116 GCCTGGCTGAAGAAGGAGCAAGG + Intergenic
1100543630 12:95580957-95580979 TCATGACCAGAGCTGGAGCACGG - Intergenic
1101079544 12:101169259-101169281 CCTTGGCTAGAGATGAAGCAAGG + Intronic
1101254445 12:102963838-102963860 GCCTAGGCAGGGATGGAGCAGGG - Intergenic
1101317563 12:103643445-103643467 GGCTGGCCATTGAAGGAGCAGGG - Intronic
1101424672 12:104578009-104578031 GCCTGTTCAGGGCTGGAGCACGG + Intronic
1101469445 12:104982963-104982985 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1101831009 12:108256677-108256699 GCCTGCCCAGAGATTGGCCAAGG + Intergenic
1102001266 12:109559361-109559383 GCCTGGCCAAGGAGGGATCAAGG + Intronic
1102519886 12:113471645-113471667 GCCAGGCCAGAGATTGCCCAAGG - Exonic
1102542476 12:113632293-113632315 ACCTGGCCTGTGATGGAGCCAGG - Intergenic
1102590783 12:113955366-113955388 GTCTGGCCAGAGGTGGGGCTAGG + Intronic
1103844540 12:123892304-123892326 CCATGGCCAGAGTGGGAGCAAGG + Intronic
1103947533 12:124534905-124534927 GCCTGGCCTGAGAAGGTGCCTGG - Intronic
1104584285 12:130035502-130035524 CCCTGGCCAGAAATGGAGGGTGG + Intergenic
1105308416 13:19185291-19185313 GCAGGGCCAGAGAGGCAGCATGG + Exonic
1105704945 13:22962858-22962880 GCCTGGAGAGAGAGGGAGCCAGG + Intergenic
1105857904 13:24388042-24388064 GCCTGGAGAGAGAGGGAGCTAGG + Intergenic
1107659337 13:42623201-42623223 GACTGGCCAGAGATGGACCTAGG + Intergenic
1108770375 13:53693504-53693526 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1109242135 13:59902336-59902358 ACATGGCCAGAGAAGGAGTAAGG - Intronic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1112961773 13:105135796-105135818 GCCTTACCAGAGATATAGCAGGG + Intergenic
1114125806 14:19723921-19723943 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1115301195 14:31887414-31887436 ACCTGGGCAGTGATGGAACAGGG + Intergenic
1117269531 14:54127906-54127928 GCCTGGCCTAATATGGAGGAGGG - Intergenic
1118324106 14:64769840-64769862 GGCTGGCCAGAGAGAGAGGAGGG - Intronic
1118369515 14:65125535-65125557 GCATAGCCAGAGCTGGAGCAAGG + Intergenic
1119731614 14:76954852-76954874 GGATGGGCAGAGATTGAGCAAGG - Intergenic
1122623563 14:103073146-103073168 CCCTGACCAGAGATGGAGGGTGG - Intergenic
1122688199 14:103519857-103519879 GCCTGCCCAGAAATGAAGCCCGG - Exonic
1122700315 14:103583996-103584018 GCATGCCCAGAGAGGGCGCAGGG - Intronic
1122784060 14:104155823-104155845 GGCTGGCCTGAGATGGGGGAGGG + Intronic
1122832059 14:104403188-104403210 CCATGGCCAGAGAAGGAGGAAGG - Intergenic
1123009498 14:105340924-105340946 ACGTGGCCAGAGACGGGGCAAGG - Intronic
1202931085 14_KI270725v1_random:31972-31994 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1123421344 15:20139706-20139728 GCAAGGCCAGAGAAGGACCATGG + Intergenic
1123443784 15:20307085-20307107 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1123530570 15:21146246-21146268 GCAAGGCCAGAGAAGGACCATGG + Intergenic
1124132183 15:27000647-27000669 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1125913914 15:43467609-43467631 GCCTGGCCACAAAGGGAGAATGG - Intronic
1126366686 15:47901811-47901833 TCCTGGCATGAGGTGGAGCATGG + Intergenic
1127157456 15:56143099-56143121 GCATGGGGAGGGATGGAGCAGGG - Intronic
1127644235 15:60944228-60944250 AACTGGTCTGAGATGGAGCATGG + Intronic
1129030333 15:72612840-72612862 ACCTGGCCAGAGCTGGTGCCAGG + Intergenic
1129209908 15:74062450-74062472 ACCTGGCCAGAGCTGGTGCCAGG - Intergenic
1129460546 15:75698197-75698219 GCCTGCCCAGACCTGGAGCCAGG - Intronic
1129469084 15:75740373-75740395 ACCTGGCCAGAGCTGGTGCCAGG + Intergenic
1129512524 15:76135360-76135382 ACATGGCCAGAGATGGTGCCGGG + Intronic
1129724315 15:77893839-77893861 GCCTGCCCAGACCTGGAGCCAGG + Intergenic
1130577772 15:85107512-85107534 GCTTGGACAGGGATAGAGCAGGG + Intronic
1130734889 15:86537556-86537578 GGCTGGCCAGAGATGGAGAGTGG + Intronic
1131371010 15:91881900-91881922 ACCTGGCCAGGGATGGAGCAGGG - Intronic
1131763178 15:95646324-95646346 GCCAGGACAGAGATTAAGCAAGG + Intergenic
1132291265 15:100705425-100705447 TCCTGGCCAGAGACAGCGCAGGG + Intergenic
1132386126 15:101401239-101401261 GCGTGGGCAGCGATGGAGGATGG + Intronic
1132513198 16:353937-353959 GGCTGGCCAGAGCTGGTGCTGGG - Intergenic
1132558832 16:584367-584389 GCCTCGACATAGATGGTGCAGGG + Intergenic
1133221569 16:4321170-4321192 GCGTGGCAGGAGATGGAGCTGGG + Intronic
1134252307 16:12582934-12582956 GCCTCACCAGAGTTGGAGGAGGG - Intergenic
1135271904 16:21076991-21077013 GACTGGCAAAAGATGGGGCAGGG - Intronic
1135850669 16:25960171-25960193 ACATGGCCAGAGAGTGAGCAAGG - Intronic
1135876507 16:26205393-26205415 TCCTGGCCAGAGATGGTGACAGG - Intergenic
1135993931 16:27234343-27234365 GACTGGCCAGAGATGGAGGAGGG - Intronic
1136549691 16:30976407-30976429 GCCTTGCCAGAGCTGGGGCCTGG + Intronic
1136862714 16:33712867-33712889 GCAGGGCCAGAGCTGGGGCAGGG - Intergenic
1138676406 16:58654622-58654644 GCCTGGCCCGAGGGAGAGCATGG - Intergenic
1138965888 16:62083736-62083758 ACCTGCCCAGAGATGGAGGATGG + Intergenic
1139347788 16:66315481-66315503 CTCTGGCCAGAGAAGGAGAAAGG + Intergenic
1139649780 16:68356461-68356483 GCCGGGCCACACATGGGGCAGGG - Intronic
1139968232 16:70757428-70757450 GGCTGCCCAGAGCAGGAGCAAGG - Intronic
1141125255 16:81396589-81396611 ACATGGCAAGAGAGGGAGCAAGG + Intergenic
1142265897 16:89063854-89063876 GCCAGTCCAGAGAAGGAGGAAGG + Intergenic
1203124190 16_KI270728v1_random:1561009-1561031 GCAGGGCCAGAGCTGGGGCAGGG - Intergenic
1142482462 17:227408-227430 GCCTGGCCTGGGATGGTCCAGGG + Intronic
1142860615 17:2758628-2758650 GGCTGGCCATGGCTGGAGCATGG - Intergenic
1142995113 17:3755391-3755413 GCCTGGCCAGAGATGCAGGCGGG + Intronic
1143006428 17:3838218-3838240 ACCTGACCAGAGATAAAGCATGG + Intronic
1143067861 17:4263931-4263953 GCCGGGCCAGACATGGCGGAAGG - Intronic
1143384783 17:6522551-6522573 TCCTGGCTGGAGATAGAGCAAGG + Intronic
1144121441 17:12157771-12157793 GCATGGCCAGAGCAAGAGCAAGG - Intergenic
1145267107 17:21385147-21385169 ACCTGGCCTGAGATGCATCAGGG + Intronic
1145271861 17:21409127-21409149 GCTTGGTCAGAGATGGGGCCTGG + Intronic
1145310073 17:21696592-21696614 GCTTGGTCAGAGATGGGGCCTGG + Intronic
1145397237 17:22505826-22505848 ACCTAGCCAGGGAGGGAGCAGGG + Intergenic
1147120040 17:38330484-38330506 GCCTGGCTCGAGCTGGGGCAGGG + Exonic
1147600155 17:41740241-41740263 GGCTGGCCTGATATGGAGCTGGG + Intergenic
1147953067 17:44117703-44117725 CCCTGGGGAGAGATGGAGCAGGG + Exonic
1148387333 17:47243688-47243710 GATTGGTCTGAGATGGAGCATGG + Intergenic
1149006356 17:51810372-51810394 GCCTGGACAGGAATGGGGCATGG + Intronic
1150318201 17:64187660-64187682 GCCTGGCCGGACAGTGAGCAAGG - Intronic
1151126897 17:71855125-71855147 GGCTGACCAGAGAGGGAGGAAGG - Intergenic
1151404416 17:73877481-73877503 TCCTGGCTACAGCTGGAGCAAGG + Intergenic
1151405926 17:73886153-73886175 GTGTGGCCTGAGATGGAGCATGG - Intergenic
1151444094 17:74152089-74152111 GCAGGGCTACAGATGGAGCAAGG - Intergenic
1151902223 17:77023940-77023962 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1151998759 17:77631413-77631435 GCCAGGACAGAGAAGGTGCAGGG + Intergenic
1152678306 17:81652988-81653010 GCCTGAGCAGGGATGGAGGAGGG - Intronic
1152784658 17:82241514-82241536 CCCTGCCCTGAGAGGGAGCAGGG - Intronic
1153311607 18:3682218-3682240 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1153951060 18:10058159-10058181 GCCTGGCCTGAGATGCATCTAGG + Intergenic
1155318146 18:24592606-24592628 GCCTGGCCTTAGAGGCAGCATGG - Intergenic
1155992003 18:32287613-32287635 ACCTAGCCAGTGATGGACCAGGG + Exonic
1157595975 18:48863841-48863863 GCCAGGCCAGGGAAGGAGGAAGG - Intergenic
1158517667 18:58144341-58144363 ACGTGGCCAGAGCAGGAGCAAGG + Intronic
1159420185 18:68208445-68208467 ACATGGCCAGAGAGGGATCAAGG + Intergenic
1160110055 18:76018268-76018290 GTCTTGACAGAGATGGTGCATGG - Intergenic
1160282287 18:77502740-77502762 GATGGGCCAGAGATGGGGCAGGG - Intergenic
1161865416 19:6829139-6829161 GCCTGGGCAGGGATGGTGCCAGG + Intronic
1162178282 19:8847800-8847822 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1162684317 19:12369141-12369163 TTCTGGCCAGAGAAGGAGAAGGG + Intergenic
1163025840 19:14511509-14511531 ACCTGATCAGAGATGCAGCATGG + Intergenic
1163114618 19:15181418-15181440 GCAGGGCCAGGGAAGGAGCAGGG - Intronic
1163834895 19:19567260-19567282 ACAAGGCCAGAGCTGGAGCAAGG - Intronic
1164485245 19:28650359-28650381 GGCTGGCCAGAGAGGGAGTCTGG - Intergenic
1164511909 19:28904383-28904405 CCCTGGCCAGGCATGGCGCACGG - Intergenic
1164714267 19:30379998-30380020 AGCTGGCCAGTGATGGAGCAGGG + Intronic
1166368897 19:42290836-42290858 GCCCGGCCAGAGGTGGGGAAGGG - Exonic
1166558112 19:43715072-43715094 GCCTGGGCAGAGAGGAAGCCCGG + Intergenic
1166912966 19:46173957-46173979 GTCTGGGCAAAGATGGAGCTGGG + Intergenic
1166952494 19:46438867-46438889 GCCTGGCAGCAGAGGGAGCAAGG + Intergenic
1166952689 19:46440281-46440303 GCCTGGCAGCAGAGGGAGCAAGG + Intergenic
1167484338 19:49752418-49752440 ACCTGGCAAGAGCAGGAGCAAGG - Intronic
1167612487 19:50514142-50514164 GGCCGGCCAGAGAGGGGGCAGGG - Intronic
1167724314 19:51200298-51200320 GCATGGCCAGAGAAGTGGCAGGG - Intergenic
1168207835 19:54865359-54865381 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1168697017 19:58409223-58409245 GCCAGGGCAGAGTTGGAGGAGGG + Intronic
1202690993 1_KI270712v1_random:95861-95883 GCAAGGCCAGAGAAGGACCATGG + Intergenic
926231281 2:11005899-11005921 ACCTGGCCAGCAAGGGAGCAGGG + Intergenic
926757843 2:16250331-16250353 GCCCGGCCACTGAGGGAGCAGGG + Intergenic
927667294 2:25041772-25041794 GCCTGGACAGAACTGGAGGAGGG + Intergenic
927968541 2:27288213-27288235 GCCTGGCCAGTGATGAATGATGG - Intronic
928289770 2:30026901-30026923 TCCTGGCCAGAGCGGGAGCTGGG + Intergenic
929825910 2:45309617-45309639 TCCTGGCCAGGGCTGGGGCAGGG + Intergenic
932498580 2:72160184-72160206 GCGTAGCCAGGGATGGAGGAGGG + Intergenic
933300349 2:80533620-80533642 GCATTGCCAGAGATGGATCCTGG + Intronic
933524329 2:83416493-83416515 GCCAGGGCAGGGAGGGAGCAGGG + Intergenic
933850715 2:86364542-86364564 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
933955401 2:87358090-87358112 GCAAGGCCAGAGAAGGACCATGG - Intergenic
934239586 2:90254301-90254323 GCAAGGCCAGAGAAGGACCATGG - Intergenic
934273606 2:91562439-91562461 GCAAGGCCAGAGAAGGACCATGG + Intergenic
934462026 2:94217641-94217663 GCAAGGCCAGAGAAGGACCATGG - Intergenic
937199028 2:120185113-120185135 GCCTTGCCTGAGATAGACCATGG - Intergenic
937223549 2:120355571-120355593 ACCTGGCCAGAGATGGTGCATGG - Intergenic
937315707 2:120930869-120930891 CCCTACCCAGAGCTGGAGCATGG - Intronic
937322916 2:120971634-120971656 GCCTGGTCAGAACAGGAGCAAGG + Intronic
937326587 2:120993113-120993135 GTAGGGCCAGAGACGGAGCAGGG + Intergenic
937667178 2:124500654-124500676 GCCTGGCTAGAGTTAGATCAAGG + Intronic
938066367 2:128284010-128284032 GCCTGGACGGAGCTGGAGCAGGG + Intronic
938137393 2:128770446-128770468 GCCAGGCCAGAGCTGTGGCAGGG + Intergenic
938254713 2:129847531-129847553 GCCTGCCCAGGGCTGGGGCAGGG - Intergenic
938320568 2:130359620-130359642 GCCTGTCGAGAGATAGAGAATGG + Exonic
939181654 2:138810096-138810118 TCCTGGCCACAGAAGGAGCCAGG - Intergenic
940904504 2:159157079-159157101 GCAAGGCCAGAGAGGGAGCAGGG + Intronic
941231420 2:162916183-162916205 GCCTTGCCAGGGAGGGAGGAAGG + Intergenic
944897546 2:204180479-204180501 GCCTGTCCAGAAAGGGATCACGG + Intergenic
944999045 2:205329059-205329081 GGCATGCCAGAGAAGGAGCAGGG - Intronic
947652965 2:231802923-231802945 GCCTGGCCTGGGCTGGGGCAGGG - Intronic
947742051 2:232489118-232489140 GGGTGGCCAGAGATGGAGGCAGG - Intergenic
948257559 2:236578917-236578939 TCCTGGCCAGGGAGGGAGAAGGG + Intronic
948613855 2:239185608-239185630 GGCTGGTGAGTGATGGAGCAGGG - Intronic
948642294 2:239383391-239383413 GCCTCTCGGGAGATGGAGCAGGG + Intronic
948758276 2:240172195-240172217 GCCTGACTGGAGATGGGGCAGGG - Intergenic
948790134 2:240372643-240372665 GCCAGGCCATGGAGGGAGCAGGG + Intergenic
948904073 2:240969541-240969563 GCCTGGCCAGGGATGGGGTCAGG + Intronic
948947311 2:241227474-241227496 CCCTGGGCAGAGATGAGGCAGGG - Exonic
1169571498 20:6911465-6911487 GCCTAGCCAGAGCTCAAGCAAGG - Intergenic
1169621278 20:7509134-7509156 ACATGGCAGGAGATGGAGCAGGG + Intergenic
1170099691 20:12685394-12685416 TTCTAGCAAGAGATGGAGCAGGG - Intergenic
1170714339 20:18818956-18818978 ACATGGCCAAAGAAGGAGCAAGG + Intronic
1170892669 20:20389239-20389261 CCCTGGAGAGAGACGGAGCAAGG + Intergenic
1171409452 20:24936258-24936280 AGCTGGCCAGAGCTGGAGCAGGG - Intergenic
1171948972 20:31404117-31404139 GAATGGAAAGAGATGGAGCAAGG + Intergenic
1172845637 20:37928411-37928433 GGCTGGGCAGTGGTGGAGCAGGG - Intronic
1173176994 20:40771949-40771971 CTCTGGCCAGAGATGGAACTGGG + Intergenic
1173813122 20:45968361-45968383 GTCTGGGCAGAGATGGGGAAGGG + Exonic
1173884323 20:46444030-46444052 TCCTGGCCAGGAATGGAGGAGGG - Intergenic
1174756343 20:53162285-53162307 GCCCGGCCAGGGATGGGGCGGGG + Intronic
1175096982 20:56548969-56548991 ACATGGCCAGAGGAGGAGCAAGG - Intergenic
1175174520 20:57102871-57102893 GCCTGGCGAGACCTGGGGCAGGG + Intergenic
1175925315 20:62468549-62468571 GCCTGGCCCCAGATGAAGCAGGG - Intronic
1175986155 20:62765076-62765098 GCCGGGGCAGAGAAGGAGCCGGG - Intergenic
1176857644 21:13985102-13985124 TCCAGGGCAGAGATGGAGCCAGG - Intergenic
1178082205 21:29077321-29077343 GCCAGGCGAGAAATTGAGCACGG + Intergenic
1180084588 21:45502129-45502151 GCCCAGCCCGAGAGGGAGCACGG + Intronic
1181354213 22:22289112-22289134 GCAAGGCCAGAGAAGGACCATGG + Intergenic
1181355368 22:22293437-22293459 GCCAGTCCAGAGAGAGAGCAGGG + Intergenic
1181675759 22:24450664-24450686 GCCTGGCTAGGGAAGGAGCAAGG + Intergenic
1182485364 22:30635757-30635779 GCCGGGCCTGAGCTGGAGCCGGG + Exonic
1182722184 22:32412011-32412033 GCCGGGCCGGGGACGGAGCACGG + Intronic
1182732949 22:32509957-32509979 GCCTGGCCTGATTTGGAGCTTGG + Intergenic
1182979024 22:34650720-34650742 GCTTGGCCAGAGCAGGAGCAAGG + Intergenic
1183225712 22:36548662-36548684 GCCTGGTGAGAGACAGAGCAGGG + Intergenic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184053669 22:42029059-42029081 GCCTTGCCAGAGTGGGAGAATGG - Intronic
1184150538 22:42635797-42635819 GGGTGGCCAGAAATAGAGCAAGG + Intronic
1184161727 22:42701093-42701115 GCCTGGTCAGACAGGGACCAAGG + Intronic
1184247199 22:43241707-43241729 GCCTGGCCACAGTAAGAGCAGGG - Intronic
950523794 3:13511680-13511702 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
950826128 3:15823342-15823364 GCCAGGCCACAGATGGTCCACGG - Intronic
952400782 3:32961347-32961369 GGGTGGTAAGAGATGGAGCAGGG + Intergenic
953888219 3:46731611-46731633 CGCTGGCAAGAAATGGAGCAAGG + Intronic
953957083 3:47240022-47240044 GACTTGGGAGAGATGGAGCAGGG - Intronic
954105909 3:48409855-48409877 GCCTGGGCTGAGAGGGAGCATGG - Intronic
954131471 3:48563274-48563296 GCCAGGCCAGAGACAGAGAAGGG + Intronic
954160159 3:48715592-48715614 GCCTGGGTAGGGAGGGAGCAAGG - Intronic
957134459 3:76267996-76268018 GCATGACCAGAGATGTGGCAAGG + Intronic
960948212 3:122981399-122981421 GCCTGGCCACACATGAACCAAGG - Intronic
960999535 3:123364579-123364601 GACTGGCCAGAGATGAGACAAGG + Intronic
962414501 3:135169654-135169676 GCCTGGCCAAAGAGGGGGTAGGG + Intronic
962754732 3:138458788-138458810 ACCTGGGCAGAGATGGGACAGGG + Intronic
964161709 3:153653688-153653710 GCATGGTAAGAGAGGGAGCAAGG - Intergenic
965086319 3:164103501-164103523 ACATGGCCAAAGAAGGAGCACGG - Intergenic
965582029 3:170278826-170278848 ACATGGCAAGAGAGGGAGCAAGG + Intronic
966954233 3:184857254-184857276 GGCTGGCCAGATTTGGCGCATGG - Intronic
968080887 3:195846305-195846327 CCCTGGCCTGTGAGGGAGCAGGG + Intergenic
968094732 3:195920921-195920943 CCCAGGTCAGAAATGGAGCAGGG - Intergenic
968459796 4:718836-718858 GCCTGGCCAGAGATGGAGCAGGG + Intronic
968502726 4:958522-958544 TCCTCACCAGAGATGGACCAGGG + Exonic
968510590 4:993803-993825 GCCTGGTCCAAGCTGGAGCAGGG + Intronic
968683850 4:1942681-1942703 GGCTGTCCAGAGCTGCAGCAGGG + Intronic
968916898 4:3500541-3500563 GCCTGGCCAGGGATGGAGTTGGG - Intronic
969070759 4:4536663-4536685 GTGAGGCCAGAGAGGGAGCAGGG + Intronic
969439337 4:7208148-7208170 GCCAGGCCAGGGAGGGAGCTGGG - Intronic
969519125 4:7665607-7665629 GCCTGGACTGTGATGGAGGAAGG - Intronic
969526368 4:7706081-7706103 GCCTGGACAGAGATGAGGCTGGG + Intronic
969526457 4:7706405-7706427 GCCTGGACAGAGATGAGGCTGGG + Intronic
969526474 4:7706475-7706497 GCCTGGACAGAGATGAGGCTGGG + Intronic
969526536 4:7706707-7706729 GCCTGGACAGAGATGAGGCTGGG + Intronic
969526549 4:7706761-7706783 GCCTGGACAGAGATGAGGCTGGG + Intronic
970402745 4:15733656-15733678 ACATGGCCAGAGAAGGAGGAAGG + Intronic
970899943 4:21147120-21147142 GCCTGGCCTGAGCTGGAGGGAGG + Intronic
976589479 4:86834870-86834892 ACATGGCCAGAGAGGGAGCAAGG + Intronic
976636644 4:87293030-87293052 TCCTGGCCAGGAATGGAGGAGGG + Intergenic
977470687 4:97438247-97438269 GCCTGGCAAGAAATTGAGCGTGG + Intronic
977600333 4:98928674-98928696 GCCTGGAGTGAGATGGAGGAGGG - Intronic
980760881 4:137233065-137233087 GACTTGTAAGAGATGGAGCATGG - Intergenic
982683304 4:158458777-158458799 GCCTGACCAGAGATGCTGTATGG + Intronic
983737595 4:171082394-171082416 ACATGGCCAGAGAAGGAGCAAGG - Intergenic
984527766 4:180876861-180876883 GCATGGCAAGAGCAGGAGCAGGG - Intergenic
984901756 4:184592064-184592086 GCCCGGCGAGAAATTGAGCACGG - Intergenic
985764047 5:1767731-1767753 ACCAGGCCAGAGAAGGACCAGGG + Intergenic
986631610 5:9779209-9779231 ACATGACAAGAGATGGAGCAAGG - Intergenic
986824334 5:11504597-11504619 GCCAGGCCAGCGATTGGGCATGG + Intronic
987243430 5:16024381-16024403 CCATGGCCAGAGCAGGAGCAAGG - Intergenic
989559693 5:42836567-42836589 GCCTGGCAAGAATTCGAGCATGG - Intronic
991317613 5:65327144-65327166 ACATGGCAAGAGAGGGAGCAAGG - Intronic
993570514 5:89533083-89533105 GCCTGGCAATAGTTGGCGCATGG - Intergenic
994277987 5:97862830-97862852 GCCAGGACAAAGATGGAGGAGGG - Intergenic
994584602 5:101690533-101690555 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
995782189 5:115789308-115789330 ACATGGCGAGAGAGGGAGCAAGG - Intergenic
997625719 5:135329418-135329440 GTCTGGCCAGAGAGTGAACAGGG + Intronic
997976944 5:138446297-138446319 GCCAGGCCAGAGCTGCAGCTGGG + Exonic
998004577 5:138648637-138648659 TCCTGCCCAGAGATGGAGAGGGG - Intronic
998892203 5:146758022-146758044 ACCTGTCCAGATATGGAGCTTGG + Intronic
999323798 5:150630717-150630739 GGCTGGGCAGGGATGGAGGAGGG - Intronic
999609286 5:153351704-153351726 GACTGCCCAGAGATGGAGCCAGG - Intergenic
1000677034 5:164133377-164133399 ACATGGCCAGAGAAGGAGCAAGG - Intergenic
1002326860 5:178415462-178415484 GCCTGTGCAGAGAGGCAGCAGGG - Intronic
1002681616 5:180969632-180969654 GCCTGGCAAGAAATCGAGCAGGG + Intergenic
1002806103 6:575521-575543 GCATGGCAGGAGATGGAGCGAGG - Intronic
1003323608 6:5075044-5075066 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1003938286 6:10998090-10998112 ACATGGCAAGAGAGGGAGCAAGG - Intronic
1004246811 6:13985855-13985877 ACATGGCCAGAGAGGAAGCAAGG - Intergenic
1004565306 6:16790380-16790402 ACATGGCCAGGGAAGGAGCAAGG + Intergenic
1005912882 6:30326563-30326585 GCCTGGCCAGAGCCGGGGCCTGG + Intronic
1006389002 6:33747714-33747736 GACTGGGGAGAGATGGGGCAGGG + Intergenic
1006394447 6:33777955-33777977 GCCTGGCCTGAGCAGGAGCTGGG - Intronic
1006460689 6:34155897-34155919 GCCTGGACAGACATGGCACAGGG - Intergenic
1006660122 6:35634473-35634495 GCGTGGCCAGAACTGGAGCTTGG + Intronic
1006941248 6:37753698-37753720 GCCTGGCCAGAGACCAGGCAGGG + Intergenic
1006941264 6:37753732-37753754 GCCTGGCCAGGGAGCGGGCAGGG + Intergenic
1006941293 6:37753800-37753822 GCCTGGCCAGGGAGCGGGCAGGG + Intergenic
1006941322 6:37753868-37753890 GCCTGGCCAGGGAGCGGGCAGGG + Intergenic
1006941349 6:37753936-37753958 GCCTGGCCAGGGAGCGGGCAGGG + Intergenic
1006941363 6:37753969-37753991 GCCTGGCCAGGGAGCGGGCAGGG + Intergenic
1006941375 6:37754002-37754024 GCCTGGCCAGAGAGCGGGCAGGG + Intergenic
1006941388 6:37754035-37754057 GCCTGGCCAGAGAGCAGGCAGGG + Intergenic
1008572525 6:52829355-52829377 GCCCGGCCAGAAATCGAGCGCGG + Intergenic
1009922262 6:70076552-70076574 GCCTGGCCAGTGAGGGACCAGGG + Intronic
1012051065 6:94344440-94344462 GCCAGGCCAGAGCAGGTGCACGG + Intergenic
1013001243 6:106024211-106024233 GCCTGGCAGGCTATGGAGCATGG + Intergenic
1015329234 6:131957821-131957843 GCCTGGTTAGAGGTGGAGAAGGG + Intergenic
1017718998 6:157232154-157232176 GCCTGGCCAGAGCTGGGGAAGGG + Intergenic
1018200072 6:161386546-161386568 CCCTGGGCAGATATGGAACAGGG - Intronic
1018554148 6:165033325-165033347 ACATGGCAAGAGAGGGAGCAAGG + Intergenic
1018566662 6:165161943-165161965 GCCTGGCAGTAGCTGGAGCATGG + Intergenic
1018844518 6:167546629-167546651 CCCTGGCTGGACATGGAGCATGG + Intergenic
1018891939 6:167989040-167989062 CCCTGGCCAAAGATGGAGACTGG - Intergenic
1018949057 6:168366702-168366724 GTGTGGCCAGATATGGCGCAGGG - Intergenic
1019086241 6:169480235-169480257 GCCTGGCGAGAATTCGAGCATGG - Intronic
1020120559 7:5500869-5500891 GCCTGGCCCGAGAAGGGGCTGGG + Exonic
1021396566 7:20156241-20156263 GACTGGCAGGTGATGGAGCATGG - Intronic
1021820380 7:24492277-24492299 GGCTGGCTAGAGGTGGGGCAGGG + Intergenic
1022735437 7:33071347-33071369 ACATGGCCAGAGAAGGAGCAGGG - Intergenic
1023867038 7:44243222-44243244 GCCTGGCCTGAGTTGGTGCGGGG - Intronic
1023880874 7:44320820-44320842 GCCTGGCCCGAGGTGGGGAAGGG - Intronic
1023935461 7:44736946-44736968 GGCTGGCAAGGGCTGGAGCAAGG + Intergenic
1024815382 7:53262929-53262951 GCCTGTCCAGAGATAGGGAAAGG + Intergenic
1025835026 7:65085965-65085987 GGCTGGCCAGAGAGGGAGATGGG - Intergenic
1025904798 7:65775444-65775466 GGCTGGCCAGAGAGGGAGGTGGG - Intergenic
1026454365 7:70557858-70557880 GCCCTTCCAGAGCTGGAGCAGGG + Intronic
1028216521 7:88140066-88140088 ACATGGCAAGAGAGGGAGCAGGG + Intronic
1029278095 7:99419526-99419548 CCCAGGCCCGAGTTGGAGCACGG + Exonic
1032666705 7:134043976-134043998 GCCTGATCGGTGATGGAGCATGG + Intronic
1033349601 7:140551386-140551408 GCCTGGCCAGAGAACCCGCATGG - Intronic
1034279947 7:149846286-149846308 GCTTGGCTGGAGAGGGAGCATGG + Intronic
1034393556 7:150803379-150803401 GCCTGGGGAGAGATTGAGCCAGG - Exonic
1034680071 7:152921961-152921983 GCATGGTGGGAGATGGAGCATGG + Intergenic
1035837073 8:2765863-2765885 GTCAGGCCACAGAAGGAGCATGG - Intergenic
1036103761 8:5817369-5817391 CCCTGAGCAAAGATGGAGCATGG - Intergenic
1036565964 8:9938306-9938328 GCAAGGTCAAAGATGGAGCATGG - Intergenic
1036646207 8:10612565-10612587 GCCTATGCATAGATGGAGCAGGG - Exonic
1036658735 8:10693967-10693989 GCCTGGCCTGGGTGGGAGCAAGG - Intronic
1036717788 8:11142606-11142628 ACATGGCAAGAGCTGGAGCAAGG - Intronic
1037662437 8:20939460-20939482 GCCGGGCAGGAGATGGAGGATGG + Intergenic
1038278521 8:26141866-26141888 ACATGGCCAGAGAGGGAGCAAGG - Intergenic
1039721244 8:40167000-40167022 TCCTGGCAAAAGATGGAGAAAGG + Intergenic
1040548723 8:48422304-48422326 GCGTGGTCTGAGATGGAGCCAGG + Intergenic
1041087359 8:54269160-54269182 TGCTGGCCAGAGAGGGAGCCCGG + Intergenic
1043102219 8:76060612-76060634 GCCCGGCGAGAAATTGAGCATGG + Intergenic
1043533498 8:81175580-81175602 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
1045239936 8:100391365-100391387 GCATGGCCAGAGAAGCAACATGG - Intronic
1045430762 8:102112846-102112868 ACATGGCCAGAGAGGAAGCAAGG - Intronic
1045475693 8:102550403-102550425 GCCTGGGCAGAGGTGGGGGAAGG + Intergenic
1045598485 8:103685313-103685335 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1046621222 8:116531243-116531265 GCCCGGCAAGAAATTGAGCACGG - Intergenic
1048331178 8:133471771-133471793 ACCTGGCCAGAGTTGGTGCTAGG + Intronic
1048367597 8:133752209-133752231 GCTTGGCAAGCAATGGAGCATGG + Intergenic
1048378657 8:133844917-133844939 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1049592510 8:143469010-143469032 GCCTGGCCAGGGAGGCAGCAGGG - Intronic
1049605912 8:143529119-143529141 GCCTGGCCAGAGGTTGGGCCTGG + Intronic
1051565262 9:18490175-18490197 GCCTGGCCAGAGCTGGAAGCAGG + Intronic
1053692503 9:40593324-40593346 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1054272314 9:63044209-63044231 GCAAGGCCAGAGAAGGACCATGG + Intergenic
1054303745 9:63394242-63394264 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1054402523 9:64720752-64720774 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1054436133 9:65205083-65205105 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1054494259 9:65816604-65816626 GCAAGGCCAGAGAAGGACCATGG + Intergenic
1054961966 9:70979243-70979265 ACCTGGCCAGACATGGGGCGCGG + Intronic
1056070429 9:82981174-82981196 GCCTGGACCTAGATGAAGCAAGG + Exonic
1058556619 9:106175479-106175501 GCTTGGCCAGGGAGGTAGCAGGG + Intergenic
1060757534 9:126224063-126224085 GTCTGGCCAGAGATAGAGTCAGG - Intergenic
1061087027 9:128405340-128405362 GCCCAGGCAGAGATGGGGCAGGG - Intergenic
1061451276 9:130668137-130668159 ACCTGGGCACAGATGGATCAAGG - Exonic
1061988695 9:134145685-134145707 CCCTGGCCAGAGAGGGGACAGGG - Intronic
1062073254 9:134570483-134570505 GGCTGGCAGGAGATGGATCAGGG + Intergenic
1062418400 9:136465961-136465983 GTCTGGCCTGCCATGGAGCAAGG - Exonic
1062627053 9:137448104-137448126 GCCTGGACAGAGTTGGAGCTAGG - Exonic
1203623151 Un_KI270749v1:139401-139423 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1188006891 X:25021717-25021739 GCCTGGGGGGAGATGGAGCAGGG - Intergenic
1189072835 X:37883018-37883040 GCTAGTCCATAGATGGAGCAGGG + Intronic
1189654352 X:43226439-43226461 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1189699217 X:43699431-43699453 ACCCAGCCAGAAATGGAGCAAGG + Intronic
1190455802 X:50626825-50626847 GCCTGCCCACAGCTTGAGCAGGG - Intronic
1192152420 X:68720442-68720464 GCCTGCCGGGAGATGGTGCAGGG + Intronic
1193412806 X:81184287-81184309 ACTTGGCCAGAGCAGGAGCAAGG - Intronic
1194306665 X:92257129-92257151 ACATGGCCAGAAAAGGAGCAAGG + Intronic
1198176962 X:134166075-134166097 CCCAGGCCAGGGATGGAGCGTGG - Intergenic
1199331278 X:146562677-146562699 GAATGGCCAGAGAAGGAGAATGG + Intergenic
1199494025 X:148433103-148433125 ATCTGGCCAGAGATGGAGAGTGG - Intergenic
1199653253 X:149969217-149969239 GCCTGGACAAAGAAGCAGCATGG - Intergenic
1199721227 X:150543921-150543943 GCGTGGGCAGGGATGGAGCCTGG + Intergenic
1199738578 X:150709697-150709719 ACATGGCCAGAGTGGGAGCAAGG + Intronic
1199984262 X:152939044-152939066 GGAGGGCCACAGATGGAGCAGGG + Intronic
1200955331 Y:8938531-8938553 GCCTGGCAAGAATTCGAGCATGG - Intergenic
1201070618 Y:10144586-10144608 GCACAGCCAGAGATGGAGCTTGG - Intergenic