ID: 968460736

View in Genome Browser
Species Human (GRCh38)
Location 4:723595-723617
Sequence GCCCCACACAACCAGACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 114}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968460736_968460743 3 Left 968460736 4:723595-723617 CCTTCAGTCTGGTTGTGTGGGGC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 968460743 4:723621-723643 GTCCTCACCCCCAGGTGAGGGGG No data
968460736_968460742 2 Left 968460736 4:723595-723617 CCTTCAGTCTGGTTGTGTGGGGC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 968460742 4:723620-723642 GGTCCTCACCCCCAGGTGAGGGG 0: 1
1: 0
2: 2
3: 16
4: 196
968460736_968460741 1 Left 968460736 4:723595-723617 CCTTCAGTCTGGTTGTGTGGGGC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 968460741 4:723619-723641 GGGTCCTCACCCCCAGGTGAGGG 0: 1
1: 0
2: 4
3: 20
4: 212
968460736_968460740 0 Left 968460736 4:723595-723617 CCTTCAGTCTGGTTGTGTGGGGC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 968460740 4:723618-723640 AGGGTCCTCACCCCCAGGTGAGG 0: 1
1: 0
2: 0
3: 28
4: 182
968460736_968460739 -5 Left 968460736 4:723595-723617 CCTTCAGTCTGGTTGTGTGGGGC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 968460739 4:723613-723635 GGGGCAGGGTCCTCACCCCCAGG 0: 1
1: 1
2: 3
3: 50
4: 424
968460736_968460751 24 Left 968460736 4:723595-723617 CCTTCAGTCTGGTTGTGTGGGGC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 968460751 4:723642-723664 GGCCTTGTAGGGCAGATTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 129
968460736_968460750 13 Left 968460736 4:723595-723617 CCTTCAGTCTGGTTGTGTGGGGC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 968460750 4:723631-723653 CCAGGTGAGGGGGCCTTGTAGGG 0: 1
1: 0
2: 1
3: 11
4: 150
968460736_968460748 12 Left 968460736 4:723595-723617 CCTTCAGTCTGGTTGTGTGGGGC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 968460748 4:723630-723652 CCCAGGTGAGGGGGCCTTGTAGG 0: 1
1: 0
2: 2
3: 19
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968460736 Original CRISPR GCCCCACACAACCAGACTGA AGG (reversed) Intronic
900362150 1:2294353-2294375 GCCACACACAGCCAGCCTGATGG - Intronic
902529194 1:17079495-17079517 TGCCCACAGACCCAGACTGAAGG - Intronic
905809047 1:40898730-40898752 TCCCCACCCAACCTGACTGTGGG - Intergenic
908590830 1:65631209-65631231 ACCCTTCACAACCAGACTGAGGG - Intronic
909092204 1:71240146-71240168 GCCACACAAAAACAGACTGAAGG - Intergenic
913131609 1:115842717-115842739 CCACCACACATCCATACTGATGG + Exonic
915827362 1:159092450-159092472 GGCCCACATTATCAGACTGAAGG + Intronic
915930143 1:160055272-160055294 GCCCCACACAGCCAGTCTAGGGG + Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
917794458 1:178522411-178522433 GCCCCAAAGTCCCAGACTGAGGG + Exonic
918708320 1:187696308-187696330 GCCCCACACAGCCACAGTGCTGG - Intergenic
920572897 1:207031398-207031420 ACCCCACACTCACAGACTGAGGG - Intronic
920740557 1:208577653-208577675 GCCAAACACAAGCAGAATGAGGG - Intergenic
922241085 1:223755868-223755890 GCCCCCCACAGCCAGCCTGCAGG + Intronic
1063830683 10:9948915-9948937 GACCCAGACAACTAGACTGAAGG - Intergenic
1065909982 10:30294356-30294378 GCACCACATTAACAGACTGAAGG - Intergenic
1069856669 10:71444816-71444838 GCCCCATACACCCACACTCAGGG + Intronic
1070329922 10:75409493-75409515 GCCCGACACAACCAGACGCGCGG + Intergenic
1077285002 11:1761714-1761736 GCCCCACACACCCAACCTGGGGG + Intronic
1077333118 11:1992056-1992078 GCCACACACAGCCAGGCTCAGGG + Intergenic
1079747870 11:24155744-24155766 GCTCCACAGAAACAGACTCATGG - Intergenic
1080578528 11:33622480-33622502 GCCCCACAGAACCAGAGTTAAGG + Intronic
1083612804 11:64012141-64012163 CTCTCACACAACCTGACTGATGG - Intronic
1084164678 11:67370048-67370070 GGCCCACAGAACCAGAAAGAGGG + Intronic
1084194588 11:67517184-67517206 GCCACACACAATCAGGATGAAGG - Intergenic
1084565442 11:69925981-69926003 CCCCCCCACAACCCCACTGATGG - Intergenic
1085150153 11:74245901-74245923 GACCCATACAACAAGACTGTTGG + Intronic
1087354998 11:97081478-97081500 GCCCCACTCAAACATGCTGATGG + Intergenic
1091205280 11:133816746-133816768 GCCCCACACAACTATAAGGAAGG + Intergenic
1202816100 11_KI270721v1_random:47235-47257 GCCACACACAGCCAGGCTCAGGG + Intergenic
1091837568 12:3596354-3596376 TCCCCTCACTACCACACTGACGG + Intergenic
1094797698 12:33994956-33994978 GCCCCACCCTAGAAGACTGAAGG - Intergenic
1101182573 12:102235392-102235414 GCCCCACTCCACCACAGTGATGG + Intergenic
1101822670 12:108195934-108195956 GGCCCACAAAGCCAGAGTGAAGG - Exonic
1102461790 12:113104357-113104379 GCTGCACACAACCAGACGGAAGG - Intronic
1103885619 12:124198128-124198150 GGCAAACATAACCAGACTGAAGG + Intronic
1111003680 13:82219829-82219851 GCTCCAGACAACCAAAATGATGG + Intergenic
1111841042 13:93451396-93451418 GCCACACAAAACCAGACAGCAGG - Intronic
1114766360 14:25375173-25375195 CACTCACACAACCAGCCTGAAGG + Intergenic
1118082037 14:62372059-62372081 GCCTCACACAAAAAGACAGAGGG - Intergenic
1121330067 14:93044175-93044197 GTCCCACACCACCAGCCTCATGG - Intronic
1122090413 14:99334735-99334757 GCCTCACACAGCCAGAAAGAGGG - Intergenic
1122470150 14:101960941-101960963 GCCACACACTACCAGAGGGAAGG + Intergenic
1122648673 14:103212579-103212601 GCCCCACATTACCTGAATGAAGG - Intergenic
1126274929 15:46866089-46866111 GCCCAACACATTCATACTGAAGG + Intergenic
1129922253 15:79329280-79329302 GCCCCAAACAGCTAGACTGCAGG + Intronic
1131833123 15:96366739-96366761 GCCCCCCACAACCAGCGTGTCGG - Intergenic
1132584838 16:701605-701627 GCCCCACCCACCCAGCCAGACGG + Intronic
1132787013 16:1662664-1662686 GCCCCACACACTCACACTGATGG - Exonic
1133283697 16:4680921-4680943 TCCCCACAAAACCAGGTTGAGGG - Intronic
1135752552 16:25068612-25068634 GCCCCACACTGCAAGACTGCAGG - Intergenic
1136429440 16:30188143-30188165 AGCCCACCCAACCAGACTGTGGG + Intronic
1140245288 16:73242833-73242855 ACCCCACACCTCCACACTGATGG - Intergenic
1141256665 16:82408842-82408864 ACCCTACACAACCAAGCTGACGG - Intergenic
1142471222 17:164334-164356 GCCCCACACCTCCAGATGGAGGG + Intronic
1142969616 17:3602452-3602474 GACCCAGAAAACCACACTGATGG - Intergenic
1143389832 17:6553749-6553771 GCCCCACCCCGCCAGAGTGAAGG + Intronic
1145086286 17:19943926-19943948 ACCCCACACAACTAGAGTCATGG + Intronic
1149850409 17:60030506-60030528 GCCCCACACCTCCAGACACAGGG - Intergenic
1149859757 17:60116018-60116040 GCCCCACACCTCCAGACACAGGG + Intergenic
1151579844 17:74971842-74971864 GCCCCTCACCAGCTGACTGAGGG + Intronic
1161314511 19:3611570-3611592 GCCCCACCCAGCCTGGCTGAGGG + Exonic
1162630681 19:11924962-11924984 GCCCCGCAGAGCCAGACTGACGG - Intergenic
927099841 2:19779657-19779679 TCCCCAAGCAGCCAGACTGATGG - Intergenic
928456753 2:31429255-31429277 TCCCCACACAACCACACCTAGGG + Intergenic
928934184 2:36657608-36657630 GCCCCATACACCCTGTCTGAAGG + Intergenic
929930144 2:46248733-46248755 GACCCACTCAACCCGACAGAAGG - Intergenic
930118053 2:47736817-47736839 GTCCCACACCACCACACTAAAGG + Intronic
932262442 2:70338010-70338032 GGCCCACCCAATTAGACTGAAGG + Intergenic
933213913 2:79604391-79604413 GCCCCAGCCTACTAGACTGAGGG + Intronic
936269243 2:111036306-111036328 GCCCCACACAAGTGGCCTGAGGG + Intronic
1172325168 20:34028993-34029015 GACCCACACAGCCAGACTAATGG - Intronic
1172902387 20:38344597-38344619 TCCCCACACCACCAGTCTGATGG - Intergenic
1173306040 20:41850831-41850853 GCCCCAAACGACCAGACTCCTGG + Intergenic
1173974063 20:47173966-47173988 GCCCCAAACAAGAAGTCTGAAGG + Intronic
1174642697 20:52058427-52058449 GTCCCACACAATCTGAATGATGG + Intronic
1176722260 21:10402274-10402296 GCGACACACAAACAGCCTGAGGG - Intergenic
1179657353 21:42853505-42853527 GCCCCACACCCCCAGGCTTATGG + Intronic
1180038598 21:45264297-45264319 GCCCCCACCAACCTGACTGAGGG + Exonic
1182873271 22:33667282-33667304 GCCCCAAACAACAAGCCAGAAGG + Intronic
1183251179 22:36731603-36731625 GCCCCACACATCCATACTCTTGG + Intergenic
1183615122 22:38939450-38939472 GCCACACACAAACAGAATCAAGG - Intergenic
1183967632 22:41452117-41452139 GTCCCACACAACGAGGCTGAGGG + Intergenic
1185032736 22:48453208-48453230 GCACCACCCACCCAGCCTGAGGG - Intergenic
950571475 3:13802927-13802949 GCCTCCCCCAACCAGACTGGGGG - Intergenic
951838877 3:27012086-27012108 TCCCCACACAAGCATCCTGAGGG + Intergenic
953172063 3:40515926-40515948 GCCCCCCACCATCAGTCTGAAGG - Exonic
959509877 3:107198739-107198761 GCCCCACACAATGAGAATGTTGG + Intergenic
962430138 3:135311496-135311518 TCCCCACCCAACCACACTGGTGG + Intergenic
968460736 4:723595-723617 GCCCCACACAACCAGACTGAAGG - Intronic
969449179 4:7263401-7263423 GCATCACAGAACCAGAATGACGG - Intronic
975792227 4:77966293-77966315 GCTCCACACAATCACACTGTTGG + Intergenic
976413698 4:84747057-84747079 CCACCAGACAACCAGAATGAAGG + Intronic
976997656 4:91455659-91455681 GACGCCCCCAACCAGACTGAAGG + Intronic
980582321 4:134771148-134771170 GCCCCACACAACCAAAAAAAAGG - Intergenic
981398673 4:144285704-144285726 CCCCAACACAAACAGACTCATGG - Intergenic
984827125 4:183935548-183935570 TCCCCACACTACCAAACTGCTGG - Intronic
987812500 5:22856431-22856453 GCCAGACCCAACCAGACTGATGG + Intergenic
993742968 5:91562858-91562880 GCCCCAGACTACCAGCCCGATGG - Intergenic
995301193 5:110585339-110585361 GCCCCACATAACCAGGATGAAGG - Intronic
997624225 5:135320642-135320664 GCCTCACACCACCAGAAAGATGG - Intronic
1001067094 5:168544164-168544186 GACCCACACAACCAAAAAGAAGG + Intergenic
1002051424 5:176573821-176573843 GCCCCTCAGAACCAGGATGAGGG - Intronic
1002273175 5:178086326-178086348 GCCCCAGAAACCCAGACTGGCGG + Intergenic
1003880674 6:10477069-10477091 GCCCCACAGAAGCAGAGTGCGGG - Intergenic
1006174005 6:32110846-32110868 GCCACACACACCCAGACACACGG - Intronic
1009769898 6:68132382-68132404 ACCCCATACAAACAGAATGATGG - Intergenic
1017204479 6:151790092-151790114 GCCCATCACAACCAGCCAGAGGG - Intronic
1018050910 6:160006623-160006645 CCCCCACAGCACCAGGCTGATGG - Intronic
1020360704 7:7323847-7323869 GCCCCACAGAGCAAGGCTGAGGG - Intergenic
1029893100 7:103952251-103952273 GACCCAAAGAATCAGACTGAAGG - Intronic
1032324729 7:130916568-130916590 GCCTCACCCAACCACCCTGACGG - Intergenic
1038506580 8:28090145-28090167 GCCCTTCACAACCAGGCTCAAGG - Intronic
1040440013 8:47431302-47431324 TCCAAATACAACCAGACTGAAGG + Intronic
1046722315 8:117634307-117634329 GGCACACACAAACAGAATGATGG + Intergenic
1049251518 8:141591632-141591654 GCAACACACACCCAGGCTGAGGG - Intergenic
1049251523 8:141591656-141591678 GCAACACACACCCAGGCTGAGGG - Intergenic
1049251569 8:141591880-141591902 GCAACACACACCCAGGCTGAGGG - Intergenic
1049272188 8:141701641-141701663 TCCCCACCCCACCAGGCTGATGG + Intergenic
1049550394 8:143255229-143255251 GCCCCACAGTTCCAGAGTGAGGG - Intronic
1054901780 9:70376853-70376875 GCCCTACAAAACCAGACTATAGG + Intergenic
1061034172 9:128104284-128104306 GACCCACACAACGACACTGGTGG + Intronic
1061850662 9:133413044-133413066 GCCCCAGACACCCCGACTGCTGG + Intronic
1061972079 9:134050344-134050366 GCCCCACCCATCCGGACTCAGGG + Intronic
1061991245 9:134159807-134159829 TCCCCCCAGAACAAGACTGAAGG - Exonic
1062059572 9:134487701-134487723 GTCCCTCACCAGCAGACTGAAGG - Intergenic
1062060684 9:134493680-134493702 GCCCCACCCAGCCTGTCTGAAGG - Intergenic
1062483292 9:136762353-136762375 GCCTCACTCCACCAGCCTGAGGG + Intronic
1190366050 X:49695776-49695798 GCCACACACCACCAGACCGAGGG + Intronic