ID: 968461232

View in Genome Browser
Species Human (GRCh38)
Location 4:726047-726069
Sequence CGCCCGCGGCTGCCCACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 187}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968461232_968461246 15 Left 968461232 4:726047-726069 CCAGCAGTGGGCAGCCGCGGGCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 968461246 4:726085-726107 CAGAGGCTGGCGGGCAGGAATGG 0: 1
1: 0
2: 3
3: 79
4: 600
968461232_968461248 24 Left 968461232 4:726047-726069 CCAGCAGTGGGCAGCCGCGGGCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 968461248 4:726094-726116 GCGGGCAGGAATGGTCTCGTGGG No data
968461232_968461239 -9 Left 968461232 4:726047-726069 CCAGCAGTGGGCAGCCGCGGGCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 968461239 4:726061-726083 CCGCGGGCGGGATGGGCTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 134
968461232_968461245 10 Left 968461232 4:726047-726069 CCAGCAGTGGGCAGCCGCGGGCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 968461245 4:726080-726102 TGGGGCAGAGGCTGGCGGGCAGG 0: 1
1: 1
2: 6
3: 100
4: 900
968461232_968461242 2 Left 968461232 4:726047-726069 CCAGCAGTGGGCAGCCGCGGGCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 968461242 4:726072-726094 ATGGGCTGTGGGGCAGAGGCTGG 0: 1
1: 0
2: 7
3: 90
4: 850
968461232_968461237 -10 Left 968461232 4:726047-726069 CCAGCAGTGGGCAGCCGCGGGCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 968461237 4:726060-726082 GCCGCGGGCGGGATGGGCTGTGG No data
968461232_968461243 5 Left 968461232 4:726047-726069 CCAGCAGTGGGCAGCCGCGGGCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 968461243 4:726075-726097 GGCTGTGGGGCAGAGGCTGGCGG No data
968461232_968461241 -2 Left 968461232 4:726047-726069 CCAGCAGTGGGCAGCCGCGGGCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 968461241 4:726068-726090 CGGGATGGGCTGTGGGGCAGAGG 0: 1
1: 0
2: 2
3: 70
4: 668
968461232_968461240 -8 Left 968461232 4:726047-726069 CCAGCAGTGGGCAGCCGCGGGCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 968461240 4:726062-726084 CGCGGGCGGGATGGGCTGTGGGG 0: 1
1: 1
2: 0
3: 13
4: 233
968461232_968461244 6 Left 968461232 4:726047-726069 CCAGCAGTGGGCAGCCGCGGGCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 968461244 4:726076-726098 GCTGTGGGGCAGAGGCTGGCGGG 0: 1
1: 1
2: 9
3: 77
4: 740
968461232_968461247 23 Left 968461232 4:726047-726069 CCAGCAGTGGGCAGCCGCGGGCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 968461247 4:726093-726115 GGCGGGCAGGAATGGTCTCGTGG 0: 1
1: 0
2: 0
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968461232 Original CRISPR CGCCCGCGGCTGCCCACTGC TGG (reversed) Intronic
900156044 1:1203657-1203679 CGGCCGCGGCTGGGCCCTGCAGG - Exonic
900180473 1:1308896-1308918 CGCCCGCTTCTGCCCGCAGCGGG + Exonic
900414966 1:2530635-2530657 CCCCAGCGGCTTCCCACTGCTGG + Intergenic
901629044 1:10639307-10639329 GGCCGGCGGCCGCCGACTGCAGG + Exonic
903185970 1:21629250-21629272 CGGCCGTGGCTGCCCAGTGGCGG + Intronic
904822773 1:33256297-33256319 CGCCCGGCGCTGCCCACTCGCGG + Intergenic
905451591 1:38060394-38060416 CCCCCGGGGCTGCCCAGGGCAGG + Intergenic
906950896 1:50333728-50333750 CAGCCGCGGCTGCCCCCTACTGG + Intergenic
907905851 1:58783440-58783462 CGCCGCCGGCCGGCCACTGCAGG - Exonic
915001722 1:152600371-152600393 CCCCCACTGCTGCCCACTGTGGG - Intronic
915327104 1:155086220-155086242 CGCCCTCTGGTGGCCACTGCTGG + Intronic
915977561 1:160400850-160400872 CACCCGCCGCTGCGAACTGCCGG - Exonic
918072423 1:181142647-181142669 TGCCCGATGCTGCCCCCTGCAGG + Intergenic
919759162 1:201086086-201086108 AGCCCAGGGCTGCCCTCTGCTGG - Intronic
920666054 1:207963700-207963722 GGCCCGCGGCTGCCCTCTCGTGG + Intergenic
924648682 1:245903815-245903837 GTCCCGAGGCTGCACACTGCAGG + Intronic
1065240232 10:23696243-23696265 CGTCCTCGCCTGCCCTCTGCAGG - Intronic
1067777340 10:49173083-49173105 GGCCTGCGTTTGCCCACTGCAGG + Intronic
1071226783 10:83539693-83539715 TGCCCCCAGCTGCCCACAGCTGG - Intergenic
1073051673 10:100671173-100671195 CGCACGCGGCCGCCCCCTGGTGG - Intergenic
1074801445 10:117004981-117005003 GGGCCGCGGCTGCCCACACCTGG + Intronic
1075344316 10:121670968-121670990 GGCCCTCAGCTGCCCACTGTAGG - Intergenic
1075768880 10:124917026-124917048 CGCGCGCGGCTCCCGGCTGCCGG - Intergenic
1076680669 10:132169710-132169732 CCACAGCCGCTGCCCACTGCAGG - Intronic
1076845886 10:133069423-133069445 CGCCCGCCTCTGCCCAGGGCAGG + Intergenic
1076881238 10:133240185-133240207 CGCCAGAGGCTGCCCGCAGCAGG - Exonic
1077448180 11:2612960-2612982 CACCAGTGGCTGCACACTGCAGG - Intronic
1077479643 11:2807632-2807654 CGCCCGCCTGTGCCCACCGCCGG - Intronic
1077494557 11:2880609-2880631 CCTCCGGGGCTCCCCACTGCTGG + Intergenic
1077596652 11:3537756-3537778 CACCCGAGGCTGCTCACAGCAGG + Intergenic
1078369910 11:10735961-10735983 AGCCCTCTGCTGCCCTCTGCTGG + Intergenic
1081669002 11:44933018-44933040 CTCCCGCTGCTGCCCACAGGTGG - Exonic
1081977128 11:47242804-47242826 CCCTCACCGCTGCCCACTGCAGG - Exonic
1083448610 11:62727426-62727448 CGCGCGCGCCTGCCCGCGGCTGG - Intergenic
1084252568 11:67911730-67911752 CGCCCGAGGCTGCTCACAGCAGG + Intergenic
1088598106 11:111454864-111454886 CGCCCCCTGCTGCCAACAGCTGG - Intronic
1089537383 11:119169023-119169045 TACCCGCGGCTGCCCAGTTCCGG - Exonic
1092422819 12:8346529-8346551 CACCCGAGGCTGCTCACAGCAGG + Intergenic
1095261667 12:40105637-40105659 CGCCCGCGCCCGCGCTCTGCAGG + Exonic
1097277534 12:57823608-57823630 GGCCCGCAGCTGCCCAAGGCTGG + Exonic
1097982150 12:65745306-65745328 CGCCAGCGGGTTGCCACTGCTGG - Intergenic
1098750985 12:74292974-74292996 CGCCAGAGGCTGCCCACAGCAGG - Intergenic
1101983559 12:109428204-109428226 TGCCCACGGCTGCCCCCTGGTGG - Intronic
1102555445 12:113723805-113723827 AGCCCCTGGCTGCCCACCGCAGG - Intergenic
1102569526 12:113819030-113819052 CGCCCGCTAGTGCCCACTGCTGG + Intronic
1103321029 12:120093061-120093083 AGCCGGCTGCTGCCCTCTGCAGG + Exonic
1103565269 12:121812135-121812157 GGCCCGCGGGCGCCCCCTGCTGG + Intronic
1104450457 12:128864542-128864564 CTCCCATGGCTGCCCACTCCTGG - Intronic
1104961271 12:132489734-132489756 CGCCCGCAGGTGCCCACGGAGGG + Exonic
1112432538 13:99363493-99363515 CGGCCTGGGCTGCCCACTGCTGG - Intronic
1112613242 13:100976520-100976542 CCCCAGCGGGTTCCCACTGCTGG - Intergenic
1115877270 14:37874822-37874844 TGCCCTCTGCTGCCCTCTGCTGG + Intronic
1119223829 14:72929079-72929101 CGCCCGGGGCTGCTCCCTACTGG + Intronic
1122062966 14:99148972-99148994 CACACGCTGCTGCACACTGCAGG - Intergenic
1122918734 14:104870929-104870951 TGCCCACCGCTGCCCCCTGCCGG + Intronic
1123097677 14:105774143-105774165 CTCCAGGGGCTGCCCCCTGCTGG + Intergenic
1124692774 15:31839231-31839253 GGCCAGCGCCTGCCCACTGTGGG - Intronic
1125283992 15:38072941-38072963 CAGCCGCGGCTACCCTCTGCAGG - Intergenic
1128149643 15:65355178-65355200 CCCCCGCGGGGCCCCACTGCAGG + Intronic
1128242124 15:66108227-66108249 CGTCCAGGGCTGCCCACTCCAGG - Intronic
1130596693 15:85254284-85254306 CGGCCGCGGCTGCCACATGCAGG + Intergenic
1132588374 16:715816-715838 CGCACGCAGCGGCCCCCTGCCGG - Exonic
1132671837 16:1105248-1105270 CGGTCTCCGCTGCCCACTGCTGG + Intergenic
1133295071 16:4747646-4747668 AGCCCGCCCCTGCCCACTCCTGG - Intronic
1134126335 16:11618695-11618717 CCCCCGCGGCCGGCCAGTGCGGG - Intronic
1136395702 16:29991433-29991455 CCCCCGAGGCTGCCCGCCGCAGG - Intronic
1136497894 16:30655042-30655064 CGGCCGCGGCGGCACACTGTGGG + Exonic
1139952697 16:70679867-70679889 CGCCCTCCGCAGCGCACTGCTGG - Exonic
1142132401 16:88437075-88437097 CCTCCGCGCCTGCCCCCTGCGGG - Exonic
1142586898 17:979576-979598 CGCCCGCGGCATCTCGCTGCTGG - Exonic
1142806165 17:2372321-2372343 TGCCCACCGCTGCCCACCGCAGG + Exonic
1142864031 17:2779632-2779654 CGCCCTCCTCTGCCCAGTGCTGG - Intronic
1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG + Intronic
1145413261 17:22692551-22692573 TGCCCGCGACAACCCACTGCGGG - Intergenic
1146398413 17:32486462-32486484 CGCCCGCAGCTGCCGGCCGCGGG - Intergenic
1147018308 17:37510279-37510301 CGCCCAGGCCTTCCCACTGCAGG + Intronic
1147382230 17:40062817-40062839 GGCTCGCGGCTGCTCCCTGCAGG - Exonic
1151906755 17:77053983-77054005 CCCCTGGGGCTGCCCACTCCAGG - Intergenic
1151983102 17:77526082-77526104 CGACGGGGGCTGCCCCCTGCTGG - Intergenic
1152128511 17:78461765-78461787 AGCCCTCGTCTGCCCAGTGCAGG - Intronic
1152356806 17:79811513-79811535 CGCCCGGCGATGCCCCCTGCTGG + Intergenic
1152636360 17:81432154-81432176 CTGCAGCGGCTGTCCACTGCTGG + Intronic
1152658468 17:81530770-81530792 GGCCCGAGGATGCCAACTGCAGG - Intronic
1153457875 18:5298509-5298531 CACCCGGGACTGCACACTGCGGG - Intergenic
1156008468 18:32470547-32470569 CCCCCCCGGCTGCCCGCGGCCGG - Intergenic
1156275837 18:35581873-35581895 CGCCCGCGGCTGGGCAGTCCCGG + Intronic
1159945957 18:74445131-74445153 GGCCCGCAGCTGCCCAGAGCTGG + Intronic
1160554472 18:79716941-79716963 CCACCAGGGCTGCCCACTGCAGG - Intronic
1160820128 19:1053999-1054021 TGCCCGCAGCTGCCATCTGCAGG - Exonic
1161316178 19:3618712-3618734 TGCCCGCTGCTGCCCCCTGGTGG + Intronic
1161410698 19:4115606-4115628 AGTCCGCGGCTGCACACTTCAGG + Intronic
1161470718 19:4455679-4455701 CCCCAGCTGCTCCCCACTGCAGG + Intronic
1161850066 19:6733514-6733536 CGCCCCCTGCAGGCCACTGCGGG - Intronic
1162701086 19:12515147-12515169 CAGGCGCTGCTGCCCACTGCAGG + Intronic
1163005273 19:14393504-14393526 AGCTCCCAGCTGCCCACTGCTGG - Intronic
1163369985 19:16896516-16896538 CGCCAGCGCCTGCCGCCTGCGGG - Exonic
1164145682 19:22511163-22511185 TGCCCCAGGCTGCACACTGCTGG + Intronic
1164551040 19:29212820-29212842 CGCCCGCGGCCGCTCCCTGCTGG + Intronic
1165928476 19:39342060-39342082 CGCGCGAGCCTGCCCCCTGCGGG + Intronic
1166686700 19:44800664-44800686 TGCCCTCTGCTGCCCCCTGCTGG - Intergenic
1166790655 19:45396686-45396708 CCCCCGCGGCAGCCCCCTGGCGG - Exonic
1166852369 19:45766868-45766890 GGCCCGCTGCTGCTCACTGGGGG - Exonic
1166947456 19:46405755-46405777 CAGCCCCGGCTGCCCATTGCTGG + Intergenic
1167258144 19:48443136-48443158 CGCCCGCGCCTGGCCCCAGCAGG - Exonic
1167684848 19:50949860-50949882 TGCTCACGGCCGCCCACTGCAGG - Exonic
1168242991 19:55096517-55096539 CGCCCGCAGCTGCCACGTGCAGG + Intronic
925168108 2:1731634-1731656 CGTCTGTGGCTGCCCACTTCTGG - Intronic
926880413 2:17539065-17539087 CGCCCGCGGCTGTCCCCTCTCGG - Intergenic
930153511 2:48081449-48081471 CGGCTGCAGGTGCCCACTGCCGG + Intergenic
933975651 2:87507144-87507166 GGCCAGAGGCTGGCCACTGCTGG - Intergenic
934926926 2:98388619-98388641 AGCCCCCGGCTGCCCACCGGAGG - Intronic
935301672 2:101698177-101698199 CGGCCCCGGCTGCCGGCTGCCGG - Intronic
935896715 2:107746927-107746949 CTCCAGCGGGTTCCCACTGCTGG + Intergenic
936318173 2:111443669-111443691 GGCCAGAGGCTGGCCACTGCTGG + Intergenic
936467182 2:112764226-112764248 AGCGCGCAGCTTCCCACTGCTGG + Intronic
936938285 2:117859000-117859022 CGCCCACCCCCGCCCACTGCAGG + Intergenic
942460252 2:176163456-176163478 GGCCCTGGGCTGCCCACTTCTGG - Intronic
948636978 2:239344925-239344947 CCCCCAGGGCTGCCCACCGCAGG + Intronic
1170226495 20:13996113-13996135 CGCCCGGGGCTGCCGCCTGGGGG - Intronic
1172872582 20:38144882-38144904 GCCCCTCAGCTGCCCACTGCAGG - Intronic
1172902269 20:38343958-38343980 CCCCTGCAGGTGCCCACTGCTGG - Intergenic
1173519975 20:43692135-43692157 GGCCCCCTGCTGCCCCCTGCAGG + Exonic
1174873887 20:54207813-54207835 CGCCCCCTGCTGCCCGCGGCCGG + Intergenic
1175418621 20:58817444-58817466 CTCCCGTGGGTCCCCACTGCCGG - Intergenic
1176039454 20:63056592-63056614 AGCCCTCTGCTGCCCTCTGCTGG - Intergenic
1176119182 20:63446391-63446413 CGCCCACGTCTGCCGTCTGCTGG + Intronic
1176809696 21:13525274-13525296 GGCCAGCCGCTGCCCTCTGCGGG + Intergenic
1178280509 21:31278494-31278516 CCCCTGGGGCTGCCCGCTGCTGG + Intronic
1178365384 21:31985605-31985627 CCCTGCCGGCTGCCCACTGCCGG - Intronic
1179893361 21:44348956-44348978 CACCCGCAGCTGCGCCCTGCTGG - Intergenic
1181061956 22:20285893-20285915 GGCCCTCTGCTGCCCTCTGCCGG + Intergenic
1181574782 22:23786965-23786987 CGCCAGCGCCTGCGCACTGAGGG + Exonic
1182401033 22:30078206-30078228 CGCCCCAGGATGCCCAGTGCTGG - Intergenic
1182904000 22:33920891-33920913 CCCGCGCGGCGGCCCACTCCTGG - Intronic
1183601589 22:38843516-38843538 CGCCCGCCGCGTCCCCCTGCTGG + Exonic
1183979919 22:41533393-41533415 AGCACGCGGCTGCCCCCTGCTGG + Intronic
1184412112 22:44331542-44331564 CGCCCGCGGGAGCCGCCTGCTGG + Intergenic
1185270496 22:49927379-49927401 TCCCCGCCGCTGTCCACTGCAGG - Exonic
1185408509 22:50671233-50671255 GGCCTGCGTTTGCCCACTGCTGG - Intergenic
949090902 3:27815-27837 CACCCCCGGCACCCCACTGCTGG + Intergenic
953179825 3:40584717-40584739 GTCCCGCTGCTGCCCCCTGCAGG - Intergenic
954444714 3:50540491-50540513 CATCTGCGACTGCCCACTGCAGG - Intergenic
954618528 3:51983026-51983048 CTCCAACGGCTCCCCACTGCAGG - Intronic
956144901 3:66182702-66182724 CCCCCCCCGCCGCCCACTGCAGG - Intronic
957209291 3:77239507-77239529 CCCCAGCGCCTTCCCACTGCTGG + Intronic
961900254 3:130203085-130203107 CACCCGAGGCTGCTCACAGCAGG + Intergenic
967975747 3:195033975-195033997 CACCCGCGGCTTCCCACTTCAGG + Intergenic
968461232 4:726047-726069 CGCCCGCGGCTGCCCACTGCTGG - Intronic
968725621 4:2246593-2246615 CTCTCTCAGCTGCCCACTGCTGG + Intergenic
968940587 4:3635475-3635497 CCCCGGCTGCTGTCCACTGCAGG - Intergenic
980774568 4:137421433-137421455 CTCCACCAGCTGCCCACTGCGGG + Intergenic
984852772 4:184168584-184168606 GGCCCGCCACTGCCCTCTGCTGG + Intronic
985073699 4:186191982-186192004 GGCCCGCGCCTACCCACTGGTGG + Exonic
985664940 5:1177204-1177226 CCCCCGGGGTTGCCCACGGCGGG + Intergenic
989744305 5:44809397-44809419 CGCCTGCGACTGCCTGCTGCAGG + Exonic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
999113405 5:149141465-149141487 CGCTCGCTGCTGCCACCTGCTGG - Intronic
1001425435 5:171619330-171619352 GGCCCTGGGCTGGCCACTGCAGG - Intergenic
1002712683 5:181204718-181204740 GGGCAGCGGCTGCCCGCTGCGGG - Exonic
1006170144 6:32087725-32087747 GGCTCACGGCTACCCACTGCGGG - Intronic
1006377527 6:33679873-33679895 CACCCGCAGCTGACCAATGCAGG + Exonic
1011309961 6:85970877-85970899 CTCCCAAGGCTTCCCACTGCAGG + Intergenic
1013349529 6:109292593-109292615 AGCCGACGGCTGCTCACTGCAGG + Intergenic
1014632259 6:123802736-123802758 AGCCCGCTGCTGCCACCTGCGGG - Intergenic
1018905201 6:168071920-168071942 CTCCCGGGCCTCCCCACTGCTGG + Intronic
1019281150 7:200913-200935 AGCCCCAGGGTGCCCACTGCTGG + Intronic
1019440700 7:1044784-1044806 CTCTGGCCGCTGCCCACTGCGGG + Intronic
1019516725 7:1443340-1443362 CACCCCCTGCTGACCACTGCGGG + Intronic
1019701804 7:2477789-2477811 TGCCCAGGGCTGCCCCCTGCAGG - Intergenic
1024963728 7:55004243-55004265 CGCTGGCGGCTCCACACTGCAGG - Intergenic
1024993817 7:55255700-55255722 GGACCGCGGGTGCCCTCTGCGGG + Intronic
1027269312 7:76511432-76511454 TGCCCGCTGCTCCCCACTCCTGG + Intronic
1027320023 7:77005327-77005349 TGCCCGCTGCTCCCCACTCCTGG + Intergenic
1027868251 7:83674310-83674332 CCCCAGCGGCTTGCCACTGCTGG - Intergenic
1032785784 7:135198213-135198235 CGCCCAGGGCTGACCACTCCTGG - Intronic
1034207554 7:149330896-149330918 AGCCAGTGACTGCCCACTGCAGG + Intergenic
1035018005 7:155783044-155783066 AGCCACCGTCTGCCCACTGCAGG - Intergenic
1039079648 8:33722406-33722428 CGCCAGAGGCTGCCCATAGCAGG + Intergenic
1039589641 8:38735660-38735682 AGCCCAGGGCTGCCCACTGTAGG - Intronic
1049610877 8:143554159-143554181 CGCCCGTGGCTGTCCGCTGCAGG - Intronic
1049646632 8:143738639-143738661 CGCCCGTTGCTGCGCACAGCAGG - Intergenic
1049759778 8:144326728-144326750 CGGCCGCCACTGCCCCCTGCCGG + Exonic
1049775325 8:144401308-144401330 CAGCCGTGGCTGCCGACTGCCGG + Intronic
1054109911 9:61096957-61096979 CGAGCGCGGGTGCCCACTGGGGG + Intergenic
1054610946 9:67234168-67234190 CGAGCGCGGGTGCCCACTGGGGG - Intergenic
1057623251 9:96655189-96655211 CGCCAGGGGCTGCCCGCTGTCGG + Exonic
1059414630 9:114155425-114155447 TGCCCCCTGCTGCCCCCTGCCGG - Intergenic
1059960075 9:119556239-119556261 TTCCCGCAGCTGCCCTCTGCTGG - Intergenic
1060295013 9:122337491-122337513 CCACAGAGGCTGCCCACTGCAGG - Intergenic
1061589864 9:131591345-131591367 AGCCCACGGCTGCCATCTGCTGG - Intronic
1062028748 9:134352499-134352521 TGACCACTGCTGCCCACTGCTGG - Intronic
1186455834 X:9709163-9709185 GGCGCGCTGCTGCCCCCTGCTGG + Intronic
1190337391 X:49270475-49270497 CTCCCGCTCCTGCCCACGGCGGG - Exonic
1195960264 X:110378806-110378828 CGACCCCCGCTGCCCACTGCTGG + Intronic
1198627348 X:138591817-138591839 CTCCAGTGGCTGCCAACTGCTGG + Intergenic
1199858871 X:151781717-151781739 CTCCCATGGCTGCCCATTGCAGG + Intergenic
1200766641 Y:7085811-7085833 GGCGCGCTGCTGCCCCCTGCTGG + Intronic
1200962949 Y:9011734-9011756 CCCCCGTGGGTGGCCACTGCTGG + Intergenic