ID: 968461375

View in Genome Browser
Species Human (GRCh38)
Location 4:726885-726907
Sequence GGTCCCCGCAGGCCTCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 270}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968461370_968461375 0 Left 968461370 4:726862-726884 CCGGCAGTGCTGGCCCAGAGCTC 0: 1
1: 1
2: 8
3: 28
4: 369
Right 968461375 4:726885-726907 GGTCCCCGCAGGCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 270
968461366_968461375 22 Left 968461366 4:726840-726862 CCTGTCCAGTTTCATGGACTTGC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968461375 4:726885-726907 GGTCCCCGCAGGCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 270
968461365_968461375 23 Left 968461365 4:726839-726861 CCCTGTCCAGTTTCATGGACTTG 0: 1
1: 0
2: 1
3: 34
4: 193
Right 968461375 4:726885-726907 GGTCCCCGCAGGCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 270
968461364_968461375 24 Left 968461364 4:726838-726860 CCCCTGTCCAGTTTCATGGACTT 0: 1
1: 0
2: 2
3: 18
4: 181
Right 968461375 4:726885-726907 GGTCCCCGCAGGCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 270
968461368_968461375 17 Left 968461368 4:726845-726867 CCAGTTTCATGGACTTGCCGGCA 0: 1
1: 0
2: 0
3: 4
4: 54
Right 968461375 4:726885-726907 GGTCCCCGCAGGCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 270
968461363_968461375 25 Left 968461363 4:726837-726859 CCCCCTGTCCAGTTTCATGGACT 0: 1
1: 0
2: 1
3: 16
4: 215
Right 968461375 4:726885-726907 GGTCCCCGCAGGCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968461375 Original CRISPR GGTCCCCGCAGGCCTCCCTC AGG Intronic
900097128 1:944391-944413 GGGGCCTGCAGGCCTCCCCCTGG + Exonic
900103311 1:971924-971946 GGGACCCACTGGCCTCCCTCAGG + Intronic
900131242 1:1088225-1088247 GACCCCCGCATGCCTCCCCCAGG + Intronic
900294116 1:1940120-1940142 GGGCCTCGGAGGCCTCTCTCTGG + Intronic
900643766 1:3699493-3699515 GGGCTCAGCTGGCCTCCCTCTGG - Intronic
901459525 1:9383275-9383297 GGTCCCCGCAGGTCCCCCCTGGG - Intergenic
901642956 1:10702310-10702332 GGTCCACAGAGGCCTCCCACTGG + Intronic
901822888 1:11841536-11841558 AGTCCCAGCAGGCATCCCTGGGG + Exonic
902663623 1:17922337-17922359 GGACCTTGCAGCCCTCCCTCTGG + Intergenic
903172477 1:21562811-21562833 GGTCAGCGGAGGCCTCTCTCCGG - Intronic
904260229 1:29283783-29283805 GGTCCCCCCAGGCCTGCCTTCGG + Intronic
904681907 1:32235061-32235083 AGTCCCCACAGGCCTCCACCAGG + Intergenic
907527880 1:55064234-55064256 GCTCCCCGCAGGCCACCTTTGGG - Exonic
910615662 1:89195413-89195435 CTTCCCTGCAGGCTTCCCTCTGG - Exonic
910632405 1:89369535-89369557 CTTCCCTGCAGGCTTCCCTCTGG + Exonic
916226948 1:162497937-162497959 GGGCCCGGCCGGCCTGCCTCAGG + Exonic
916505952 1:165428576-165428598 GGTCTCTGCAGACGTCCCTCAGG - Intronic
917674263 1:177304340-177304362 GGTCCCCAAGGGCCTCCCTGTGG - Intergenic
918001614 1:180502495-180502517 GGTCTCCTCCGGCTTCCCTCCGG + Exonic
919279673 1:195472570-195472592 AGTCCTCGCAGGCTTTCCTCAGG - Intergenic
921914652 1:220593869-220593891 GGCCCCCTCAGCCCTCACTCTGG + Intronic
921936648 1:220802207-220802229 TGTCCACCCAGGACTCCCTCTGG + Intronic
922505024 1:226121502-226121524 GGACCCCGCAATCGTCCCTCCGG + Intergenic
922571570 1:226637548-226637570 GGTCCCTGATGGCCTGCCTCTGG + Intronic
922696996 1:227735738-227735760 GGGCCCCCCAGCTCTCCCTCTGG - Intronic
924511255 1:244730664-244730686 GGGCCCCACAGGCCGCGCTCCGG + Intergenic
924560944 1:245156050-245156072 GGTCCCCGGTGGCCTCCTCCTGG - Intronic
924722681 1:246637994-246638016 TGTCACCCCAGGGCTCCCTCTGG - Intronic
1062855363 10:777406-777428 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855400 10:777503-777525 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855437 10:777603-777625 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855455 10:777652-777674 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855473 10:777701-777723 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855491 10:777750-777772 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855509 10:777799-777821 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855527 10:777848-777870 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855545 10:777897-777919 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855563 10:777946-777968 CGACCCCACAGGCCTCCCCCTGG + Intergenic
1063120721 10:3103963-3103985 GGGCCCCACTGGCCTCCCGCCGG - Intronic
1063788349 10:9410108-9410130 GGTAGCCGCATTCCTCCCTCTGG - Intergenic
1064694979 10:17956040-17956062 GGTCCTCACAGACCTCCCTGAGG - Intronic
1065104852 10:22372537-22372559 GGTCCCCAGCAGCCTCCCTCAGG + Intronic
1067067517 10:43112241-43112263 CGCCCCTGCAGGCCTCCCTTGGG - Intronic
1067139964 10:43648642-43648664 GCTCGCGGCTGGCCTCCCTCGGG + Exonic
1067204595 10:44202003-44202025 GGTCCCAGCAGGCCCACCCCAGG - Intergenic
1067849827 10:49747383-49747405 GGTCCCTGCCTTCCTCCCTCAGG - Intronic
1069615990 10:69806413-69806435 GGTCCCCTCAGATCTGCCTCTGG - Intronic
1069757625 10:70782783-70782805 GGTCCCAGCAGGCCTCCAGTGGG - Intronic
1071467068 10:85951009-85951031 GGCCCCTGCAGGACTCCATCTGG + Intronic
1073184848 10:101609706-101609728 AGACCCCACTGGCCTCCCTCGGG + Intergenic
1074721739 10:116271138-116271160 GGTCCCCGCCCGCCGCACTCAGG - Intronic
1076231067 10:128820556-128820578 GGTGGCGTCAGGCCTCCCTCAGG - Intergenic
1076817666 10:132922777-132922799 GGCCACTGCAGGCCTTCCTCTGG - Intronic
1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG + Intronic
1076924701 10:133476471-133476493 TGTCCCCACATGCCTCCCTTTGG + Intergenic
1077101372 11:823999-824021 GCTCCACGCAGGCCTCCAGCAGG - Exonic
1077233357 11:1468496-1468518 GCACCCAGCAGGCCTCTCTCTGG + Intergenic
1078576079 11:12503760-12503782 GGTCATCACAGGCCTCACTCTGG - Intronic
1082076827 11:47981136-47981158 GGTCCCCGCAAGTCGCCTTCCGG - Intronic
1082622756 11:55444464-55444486 TGTCCTCCCAGGCCTCTCTCAGG + Intergenic
1083876126 11:65525214-65525236 GGCCCGGGCAGGCCGCCCTCTGG - Exonic
1084456390 11:69270293-69270315 GGTCCCTGTGGGACTCCCTCCGG - Intergenic
1084561008 11:69905363-69905385 GGTCTCTGCTGGCCTCACTCTGG - Intergenic
1085266781 11:75242066-75242088 GGTCCCGGCACGCCTCGCGCAGG - Exonic
1088352895 11:108909613-108909635 GGTTCCCACAGGCCCCTCTCAGG - Intronic
1089560452 11:119340706-119340728 GCTCCCCGATGGCCTCCTTCGGG + Exonic
1090178495 11:124673337-124673359 GGACCCCGAAGGCCTCTTTCTGG + Intronic
1091402465 12:189226-189248 CGTCCCCGCCGCCCTCCCCCGGG - Intergenic
1091807788 12:3367989-3368011 AGACCCGGCAGGCCTCCCTGTGG - Intergenic
1091979387 12:4853203-4853225 TGGCCCCGCAGGCCAGCCTCTGG - Intergenic
1092143981 12:6202090-6202112 GGTCCCCACAAGCCTCCTTAGGG + Intronic
1092868792 12:12787331-12787353 GGTCCCCGCAGCCCTGCCAGCGG - Exonic
1096487645 12:51994485-51994507 GGTCCCCGAAGGAAACCCTCAGG - Intronic
1102526016 12:113512763-113512785 GGTCACAGCAGGCCTGGCTCTGG + Intergenic
1102768170 12:115451258-115451280 TGTGCCTGCTGGCCTCCCTCGGG - Intergenic
1103967516 12:124649413-124649435 GGGTCCCCCAGGCCACCCTCAGG - Intergenic
1105740339 13:23316753-23316775 GGTGGCAGCAGTCCTCCCTCTGG - Intronic
1108064649 13:46564643-46564665 AGTTCCTGCACGCCTCCCTCAGG - Intronic
1108676048 13:52739002-52739024 GGTCCCCGCGCGCCGCCCTCTGG + Intronic
1110106626 13:71685117-71685139 TGTCCCCACAGCCCTCACTCTGG + Intronic
1112368364 13:98774220-98774242 GCTCCCCGTAGGCTGCCCTCAGG - Intergenic
1113659115 13:112092679-112092701 GATGCCAGCAGGCCTCCCTGTGG + Intergenic
1113874427 13:113585222-113585244 GGTCCCCGCGGGCCGCCGTGGGG - Intronic
1113943463 13:114030316-114030338 GGTTCCTGCGGGCCTCCATCCGG - Intronic
1114236913 14:20832015-20832037 TGTCACCCCAGGGCTCCCTCTGG - Intergenic
1114627652 14:24139723-24139745 GATCCCCGCAGGCCACCTACAGG - Intronic
1117743856 14:58847265-58847287 GGTCCTCTCTGGCCTCCCTGAGG + Intergenic
1118772609 14:68952236-68952258 GCCTCCAGCAGGCCTCCCTCTGG - Intronic
1118942326 14:70349220-70349242 TGTCACCCCAGGGCTCCCTCCGG + Intronic
1119479771 14:74952040-74952062 GGCCCCCTCAGGGCCCCCTCAGG + Intronic
1122352212 14:101102862-101102884 GATCCCCCCAGGGCTCCCTGGGG - Intergenic
1122877919 14:104677359-104677381 GGTCCCGCCAGCGCTCCCTCTGG - Intergenic
1122913252 14:104843941-104843963 GGGCCGCGCACGCCTCCCGCAGG + Intergenic
1123035801 14:105471436-105471458 GGTCCGCCCAGGCCTCGCTCAGG + Intergenic
1124332512 15:28832486-28832508 GGTCCGCGCAGGCCCCCGTTCGG - Intergenic
1124552560 15:30695111-30695133 TGTCCTCCCAGGTCTCCCTCTGG + Intronic
1124678681 15:31710555-31710577 TGTCCTCCCAGGTCTCCCTCTGG - Intronic
1125522547 15:40356241-40356263 GGGCCCTGCGGGCCTCCCCCTGG + Exonic
1129814619 15:78540704-78540726 GGCCCCCGCCGGCCGCCGTCGGG + Intronic
1131174474 15:90201374-90201396 GGGCACCGCAGTCCTCCCGCCGG - Exonic
1131268932 15:90935053-90935075 AGCCACCGCAGGCCTCCCTCTGG + Intronic
1136592713 16:31227012-31227034 GGGCTCCACAGGCCTTCCTCTGG - Intergenic
1138093560 16:54195039-54195061 GACCCCAGCAGGCCTCCCTGTGG - Intergenic
1138561381 16:57802626-57802648 CGCCCCCGCAGGTCTCCCGCCGG + Intronic
1139589509 16:67925808-67925830 GGTAGCCCCAGGCCTTCCTCAGG + Intronic
1139636364 16:68260718-68260740 GGTCCCCTGAGGCCCCCCTAGGG + Exonic
1139974155 16:70795686-70795708 GCTCCCAGCAGCCCTCCCTGGGG + Intronic
1140457628 16:75114267-75114289 GGTCTGGGCTGGCCTCCCTCGGG + Intronic
1142145490 16:88491263-88491285 GGCGCCCACAGGCCCCCCTCGGG + Intronic
1142530393 17:575794-575816 GGTCCCAGAAGACTTCCCTCAGG + Intronic
1142604963 17:1076534-1076556 GCTCCCCGCAGCCCTCTCTTGGG + Intronic
1144774638 17:17779190-17779212 GGTGGCCCCAGGCCTGCCTCTGG + Intronic
1146372830 17:32275912-32275934 GGGCCCCTCATGCCTCCATCTGG + Intronic
1148683274 17:49486682-49486704 AGTCTCTGCAGGCTTCCCTCAGG - Intergenic
1151475326 17:74341842-74341864 GGTGACCGTGGGCCTCCCTCTGG + Intronic
1151930611 17:77229554-77229576 GTGCCCCGGAGCCCTCCCTCTGG + Intergenic
1152195505 17:78916050-78916072 GCTGCTCCCAGGCCTCCCTCAGG + Intronic
1152398515 17:80049813-80049835 GGTGGCCACAGGTCTCCCTCCGG - Intronic
1152687359 17:81701158-81701180 GGCACCCGCAGGGCACCCTCAGG + Intronic
1152930983 17:83109756-83109778 CTTCCCAGCAGGCCTCCCACTGG + Intergenic
1153238824 18:3013045-3013067 GCTCCTCGCAGGCGTCCCTCCGG - Intronic
1160679873 19:407752-407774 GGGCCCCGCCAGCCTCCCTGGGG + Exonic
1160791390 19:925323-925345 GGGTCCCGCCGGCCTCCCTCTGG - Intergenic
1160984802 19:1833613-1833635 GGCCTCCGCAGCCCTCCCCCTGG - Intronic
1161172471 19:2819924-2819946 GCCCCCCGCAGGCGCCCCTCAGG - Exonic
1161399638 19:4061565-4061587 CTCGCCCGCAGGCCTCCCTCTGG + Intronic
1161571010 19:5030923-5030945 GGTCACCTCAGGCCTCCTACTGG - Intronic
1162113435 19:8413576-8413598 GGACCCCGGAGACCTCCCACCGG - Intronic
1164784143 19:30916464-30916486 GGCCCTCGCAGGCCTCCGTCAGG - Intergenic
1168685703 19:58347850-58347872 TGTCCCCGCACCCCTCCCCCAGG + Intronic
1202709101 1_KI270714v1_random:6894-6916 GAGCCCCTGAGGCCTCCCTCTGG + Intergenic
924991612 2:317420-317442 GGACCATCCAGGCCTCCCTCAGG - Intergenic
925885898 2:8393577-8393599 GGACCCCGCAGGCCTAGCTCTGG + Intergenic
925984602 2:9206320-9206342 GGTCCCCGCAGGGTGCCCGCCGG + Intergenic
926093210 2:10063804-10063826 GGTCCCAGCAGTCCTGCCCCAGG - Intronic
930198440 2:48530598-48530620 GCGCCCCTCACGCCTCCCTCGGG + Intronic
933167701 2:79094056-79094078 TGTCACCTCAGGGCTCCCTCTGG - Intergenic
933902932 2:86862120-86862142 GGACACCGCCGGCCTCCCCCAGG + Intergenic
935777613 2:106487149-106487171 GGACACCGCCGGCCTCCCCCAGG - Intergenic
937310027 2:120896355-120896377 GGGCCCCTCTGGGCTCCCTCTGG - Intronic
938072889 2:128317733-128317755 GGTCCCCGCCCGCTGCCCTCGGG - Intronic
938290109 2:130144561-130144583 GGGCCACGCGGGTCTCCCTCTGG + Intronic
938303480 2:130231881-130231903 GGGACCTGCAGGCCTCCCCCTGG - Intergenic
938453199 2:131442375-131442397 GGGACCTGCAGGCCTCCCCCTGG + Intergenic
938466420 2:131528384-131528406 GGGCCACGCGGGTCTCCCTCTGG - Intronic
938732271 2:134155894-134155916 GGTCCAGGGAGGCCTCCCTGCGG - Intronic
941808604 2:169734111-169734133 GCTCCCAGCAGGCCGGCCTCGGG - Intronic
944645858 2:201780731-201780753 CGTCTCCGCAGGCCCCCCGCAGG + Intronic
946504196 2:220281479-220281501 AGTCCCAGGAGGCCTCCCTTGGG - Intergenic
947610925 2:231524738-231524760 GGGCTCAGCAGTCCTCCCTCTGG - Exonic
947740140 2:232481191-232481213 GGGCCCAGCTGGCCTCCCTCAGG + Intronic
948565693 2:238884748-238884770 GTACCTCGCAGGCCTCCCGCAGG + Intronic
948811551 2:240480949-240480971 GGTCCCCGCAGTCCTTCTTGTGG + Exonic
948860865 2:240752079-240752101 AGTCTCCTCAGGCCTCTCTCCGG + Intronic
1168809113 20:692321-692343 GGTCCAGGCAGGCCTCTCTAGGG + Intergenic
1169912159 20:10655793-10655815 GGTCAGGGCAGGCCTCCCTTTGG + Intronic
1171291280 20:23984382-23984404 AGCCCCTCCAGGCCTCCCTCAGG - Intergenic
1171413897 20:24964578-24964600 CGTCCCTGTAGGCGTCCCTCAGG - Intronic
1172271445 20:33657778-33657800 GGACCCTGCCTGCCTCCCTCTGG - Exonic
1172433054 20:34908501-34908523 GGTCCTGGAAGGCCTCTCTCTGG - Intronic
1172845734 20:37929110-37929132 GGTCAGGGCAGGCCTCCCTAAGG + Intronic
1173250137 20:41360047-41360069 GGTCCCCACAGCCCTGCCTTTGG - Exonic
1175388454 20:58611849-58611871 AGAACCTGCAGGCCTCCCTCAGG + Intergenic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1175814850 20:61878003-61878025 TGTCCACGAAGTCCTCCCTCTGG - Intronic
1175826165 20:61937720-61937742 AGTCAACCCAGGCCTCCCTCAGG + Exonic
1175921196 20:62451282-62451304 GGCCCCACCAGGCCTCCCCCAGG - Intergenic
1176139354 20:63538252-63538274 GGTCACGGCAGGGCTCACTCAGG - Intergenic
1176270664 20:64234361-64234383 GCTCTCAGCAGGGCTCCCTCTGG - Intronic
1176290684 21:5043022-5043044 GGGCATGGCAGGCCTCCCTCTGG - Intergenic
1177834198 21:26171125-26171147 CGACCCCGCAGGCCTCCCGGGGG + Intronic
1179417226 21:41208493-41208515 GGACCACACAGGCCTCCCCCTGG - Intronic
1179417408 21:41209343-41209365 GGACCACACAGGCCTCCCCCTGG - Intronic
1179866571 21:44220619-44220641 GGGCATGGCAGGCCTCCCTCTGG + Intergenic
1180087282 21:45513447-45513469 GGTGCCCACAGGCCGCCCTGCGG + Exonic
1180090532 21:45531593-45531615 AGTCCCCACAGGCCACCCGCAGG + Exonic
1180248935 21:46566715-46566737 GGTCCCTCCAGCCCTTCCTCTGG + Intronic
1180252381 21:46597878-46597900 GGTCCCCTCCGGCCTCTCCCAGG + Intergenic
1180766125 22:18346712-18346734 AGCCCCTCCAGGCCTCCCTCGGG + Intergenic
1180780188 22:18515666-18515688 AGCCCCTCCAGGCCTCCCTCGGG - Intergenic
1180812904 22:18772987-18773009 AGCCCCTCCAGGCCTCCCTCGGG - Intergenic
1180834783 22:18924539-18924561 GGCCCCAGCAGCCCTCCGTCAGG - Intronic
1181027166 22:20132839-20132861 GGTCACCCCAGGGCTCCTTCAGG + Intronic
1181065079 22:20301798-20301820 GGCCCCAGCAGCCCTCCGTCAGG + Intergenic
1181199082 22:21207303-21207325 AGCCCCTCCAGGCCTCCCTCGGG - Intergenic
1181294810 22:21828445-21828467 GGTCCTCTCTGGCCTCGCTCTGG - Intronic
1181400680 22:22648553-22648575 AGCCCCTCCAGGCCTCCCTCGGG + Intergenic
1181648710 22:24247335-24247357 AGCCCCTCCAGGCCTCCCTCGGG - Intergenic
1181702660 22:24629651-24629673 AGCCCCTCCAGGCCTCCCTCAGG + Intergenic
1184481245 22:44748743-44748765 AGTCACCCCAGGCCTTCCTCCGG - Intronic
1184568861 22:45309846-45309868 GGTCCCCGGAGGCCCCGCCCCGG - Intronic
1185244161 22:49764364-49764386 GCTCCTCCCAGGGCTCCCTCGGG - Intergenic
1185342556 22:50298186-50298208 TGTCCCCGCAGGTCACCCCCAGG + Intronic
1203227743 22_KI270731v1_random:87603-87625 AGCCCCTCCAGGCCTCCCTCGGG + Intergenic
1203284872 22_KI270734v1_random:149838-149860 GGCCCCAGCAGCCCTCCGTCAGG - Intergenic
954196321 3:48999202-48999224 GGGCCCTGGAGGGCTCCCTCAGG - Intronic
954631481 3:52049952-52049974 GGTCCCTGCAGACCTCCCTGAGG - Exonic
956307078 3:67837204-67837226 GGTCGCAGCATTCCTCCCTCTGG - Intergenic
964623034 3:158734169-158734191 GGTCAGGGCAGGCCTCTCTCGGG + Intronic
964767472 3:160192623-160192645 GGTCTGGGCAGCCCTCCCTCAGG - Intergenic
965872655 3:173279867-173279889 TGTCACCCCAGGGCTCCCTCTGG + Intergenic
966671172 3:182527818-182527840 GGGCCCTGCAGGCCTCCCATAGG - Intergenic
968461375 4:726885-726907 GGTCCCCGCAGGCCTCCCTCAGG + Intronic
968966716 4:3772588-3772610 GGTCCCCGTTGTCCTCCCACCGG + Intergenic
969239071 4:5887866-5887888 CCTCCCCGCAGGCCTCGCGCGGG - Intronic
969431954 4:7160539-7160561 GGTTCCAGCCAGCCTCCCTCTGG - Intergenic
969714765 4:8863183-8863205 GTAGCCCGCTGGCCTCCCTCAGG + Intronic
972630363 4:40836724-40836746 GGTCACTGCAGACCTCCCTGTGG - Intronic
973103131 4:46296317-46296339 GGTGCCAGCATTCCTCCCTCTGG - Intronic
977693809 4:99946339-99946361 GGGCCCCGCAGGCCTCCAGGAGG + Intronic
981750992 4:148092172-148092194 CTTCCCCGCAGGCCTTCCTGGGG + Intronic
984882897 4:184425954-184425976 GGTCTCTGCAGGGCTCACTCCGG + Intronic
985665467 5:1179670-1179692 GGGCCCCACAGGCCACGCTCAGG + Intergenic
986391294 5:7290000-7290022 GGTCCGCGCAGGCCCCCGTTAGG - Intergenic
992444343 5:76820213-76820235 GGGCCCAGCAGGCCTCGCTGTGG + Intronic
997668522 5:135651361-135651383 GTTTCCCCCAGGACTCCCTCAGG + Intergenic
997673252 5:135693815-135693837 GGACCCAGCAGGCCTCATTCAGG - Intergenic
997980153 5:138463966-138463988 GATTCCCGCAGGTCTCCCTGGGG - Intergenic
998882170 5:146655403-146655425 GGTCACGGAAGGCCTCCCTGAGG - Intronic
1001245374 5:170102155-170102177 TGTCCAAGAAGGCCTCCCTCTGG + Intergenic
1002069307 5:176669966-176669988 GGGACCCCCAGGCCTCCCCCAGG - Intergenic
1002306394 5:178286350-178286372 GAGCCCCGCGGGCGTCCCTCAGG - Intronic
1002344977 5:178542497-178542519 GGTCACTGCAGCCATCCCTCTGG + Intronic
1004333560 6:14743347-14743369 GGTCCCAGCAGGCCTCCAGATGG + Intergenic
1005876137 6:30011140-30011162 TGTCCCCACAGCCCACCCTCTGG - Intergenic
1007654926 6:43446140-43446162 TATACCCACAGGCCTCCCTCAGG - Intronic
1008521225 6:52363114-52363136 GGTCCCCACCCGCCTCCGTCTGG - Intronic
1010041961 6:71395273-71395295 GGTGCCCCCAGGCCCCACTCTGG - Intergenic
1017015855 6:150099011-150099033 TGTCACCCCAGGGCTCCCTCTGG + Intergenic
1017021676 6:150144228-150144250 GGATCCCGCAGGCCCCCCGCAGG - Intronic
1019032464 6:169024678-169024700 GGTCCCCGCAGGTGGCTCTCGGG + Intergenic
1019339538 7:502399-502421 GGTCCCCTCATGGCTCCCCCAGG + Intronic
1019350172 7:550920-550942 GGTGTGCCCAGGCCTCCCTCAGG + Intronic
1019350189 7:550972-550994 GGTGTGCCCAGGCCTCCCTCAGG + Intronic
1019435407 7:1019937-1019959 GGTGCCCCGTGGCCTCCCTCGGG - Intronic
1019444843 7:1066018-1066040 CGGCCGCGCAGGGCTCCCTCTGG - Intronic
1019508976 7:1407775-1407797 GGTCCGCGCTGGCCTGCCTGTGG + Intergenic
1019596101 7:1859081-1859103 CGTCTCTGCAGGCCTCTCTCAGG - Intronic
1022003714 7:26248487-26248509 CGTCACCCCAGGGCTCCCTCCGG + Intergenic
1022817392 7:33926955-33926977 GGATCCTGCAGTCCTCCCTCTGG - Intronic
1023965689 7:44962137-44962159 GGTCTCCCAAGGCCTCCCTGTGG + Intergenic
1024598969 7:50963060-50963082 GGTCGCTGCAGGCCTGCCCCTGG + Intergenic
1024985151 7:55187905-55187927 GGGCCCCGCAGGGCTTTCTCAGG - Intronic
1029535347 7:101154577-101154599 GGTCCTCGGGGGCCGCCCTCGGG + Intronic
1032279698 7:130491000-130491022 GGGCGCTGCAGGCCTCCCTTCGG - Intronic
1032284774 7:130531855-130531877 CGTGCCCCCAGCCCTCCCTCGGG - Intronic
1033220451 7:139523817-139523839 GGGCCCCCCAGGCCGGCCTCGGG - Intergenic
1034306791 7:150049610-150049632 GGCCCAGGCAGGCCTCTCTCTGG - Intergenic
1034492221 7:151399479-151399501 GGCGCCAGGAGGCCTCCCTCGGG + Intronic
1034493204 7:151405287-151405309 CGACCCTGCAGGGCTCCCTCAGG + Intronic
1034800053 7:154051032-154051054 GGCCCAGGCAGGCCTCTCTCTGG + Intronic
1035412044 7:158652288-158652310 AGTACCCGCAGGCCTTCTTCCGG + Exonic
1035437718 7:158871566-158871588 GGTCCCCGCTTGCCTTCCTGTGG + Intronic
1035768735 8:2129777-2129799 GGTCCCTGCTGCCCTGCCTCTGG + Intronic
1037735941 8:21566243-21566265 GGCTCCAGCAGGCCTCCCTGGGG + Intergenic
1038707702 8:29910275-29910297 GGGGCCCTCAGCCCTCCCTCAGG - Intergenic
1043419920 8:80087763-80087785 GGTCCCCACTGGTCTCCCTCTGG - Intronic
1046821665 8:118640474-118640496 AATCCCAGCAGGCCTCCCTCTGG + Intergenic
1049385216 8:142339725-142339747 CTTTCCCGCAGACCTCCCTCGGG - Intronic
1049790163 8:144468747-144468769 GGTCCCCGCAGCCCTGACGCAGG - Exonic
1049828399 8:144685089-144685111 GGTCCCCTCACACCCCCCTCGGG + Intergenic
1052634082 9:31078350-31078372 GGTCATCAAAGGCCTCCCTCTGG - Intergenic
1053382577 9:37660845-37660867 GTACCCCCCAGGCCTCCTTCTGG - Intronic
1056583833 9:87915127-87915149 GGCCCCCGAGGGCCTCCCACCGG + Intergenic
1056584325 9:87918596-87918618 GGCCCCCGAGGGCCTCCCACCGG + Intergenic
1056612544 9:88134326-88134348 GGCCCCCGAGGGCCTCCCACCGG - Intergenic
1056613036 9:88137794-88137816 GGCCCCCGAGGGCCTCCCACCGG - Intergenic
1057112774 9:92489851-92489873 GGTCCCCGCTGGACCCCCACTGG + Intronic
1057227412 9:93299652-93299674 CGTCCCCCCAGCCGTCCCTCTGG - Intronic
1061017363 9:127989614-127989636 GGTCAGGGCAGGCTTCCCTCAGG + Intergenic
1061060956 9:128250402-128250424 GGTCCCGGCATTCCTCCCGCGGG - Intronic
1061314156 9:129783882-129783904 GGATCCCACAGCCCTCCCTCGGG + Intergenic
1061362932 9:130155212-130155234 GGTCCCCTCAGGCCCTCCTAGGG + Intergenic
1062254637 9:135615158-135615180 AGCCCCAGCAGGCCACCCTCTGG - Intergenic
1062451662 9:136618284-136618306 TGGCCCCCCAGGCCTCCCCCAGG - Intergenic
1189002763 X:36963673-36963695 GGTCCCCGCGGGCCGCCGTGGGG + Intergenic
1189297407 X:39928854-39928876 GCTCACAGCAGGCCTTCCTCAGG + Intergenic
1189605957 X:42678280-42678302 GGTGTCAGCAGGACTCCCTCTGG + Intergenic
1192203404 X:69081321-69081343 GGTCCCAGGAGGCTTCCCTGGGG - Intergenic
1193573500 X:83173609-83173631 GGTGGCAGCAGTCCTCCCTCTGG + Intergenic
1195940832 X:110166574-110166596 GATCCCCACAGGCCTCCCAGGGG - Intronic
1199635259 X:149807184-149807206 GGTACCCTCAGTCCTCCCTCAGG - Intergenic
1199642904 X:149881293-149881315 GGCCTCCTCAGTCCTCCCTCAGG - Intronic
1199947431 X:152680261-152680283 GGTGCCCTCGGGCCTCTCTCAGG - Intergenic
1199962249 X:152788193-152788215 GGTGCCCTCGGGCCTCTCTCAGG + Intergenic
1200279306 X:154763055-154763077 GGCCCGCGCACGCCTCCCTCTGG + Intronic