ID: 968461899

View in Genome Browser
Species Human (GRCh38)
Location 4:730373-730395
Sequence CACGTGGCCCACGGGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968461899_968461910 5 Left 968461899 4:730373-730395 CCCCCACCCCCGTGGGCCACGTG 0: 1
1: 0
2: 0
3: 13
4: 226
Right 968461910 4:730401-730423 TCCTGCTGTCTCCGATGCCTTGG 0: 1
1: 0
2: 0
3: 15
4: 215
968461899_968461913 11 Left 968461899 4:730373-730395 CCCCCACCCCCGTGGGCCACGTG 0: 1
1: 0
2: 0
3: 13
4: 226
Right 968461913 4:730407-730429 TGTCTCCGATGCCTTGGGCCTGG 0: 1
1: 0
2: 1
3: 10
4: 112
968461899_968461912 6 Left 968461899 4:730373-730395 CCCCCACCCCCGTGGGCCACGTG 0: 1
1: 0
2: 0
3: 13
4: 226
Right 968461912 4:730402-730424 CCTGCTGTCTCCGATGCCTTGGG 0: 1
1: 0
2: 0
3: 15
4: 174
968461899_968461914 12 Left 968461899 4:730373-730395 CCCCCACCCCCGTGGGCCACGTG 0: 1
1: 0
2: 0
3: 13
4: 226
Right 968461914 4:730408-730430 GTCTCCGATGCCTTGGGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968461899 Original CRISPR CACGTGGCCCACGGGGGTGG GGG (reversed) Intronic
900103863 1:974063-974085 CCCGGGGCACACGGGCGTGGGGG - Intronic
900313222 1:2044758-2044780 CACGCGGCCCCCGGGGCTGAGGG + Intergenic
900511572 1:3063289-3063311 AACGAGGCCCACGGGGTGGGCGG + Intergenic
900642838 1:3695567-3695589 CATGGGGCGCACGGGAGTGGGGG - Intronic
901006019 1:6171870-6171892 CAGGTGGGCCAGGAGGGTGGTGG - Intronic
901230904 1:7641295-7641317 CACGTAGCCCACGGGGTTCAGGG + Intronic
901506119 1:9687243-9687265 CACGTGGGGAATGGGGGTGGAGG + Intronic
901629884 1:10642872-10642894 CTCGTTACCCACGGGGGTGCTGG + Exonic
902761017 1:18580792-18580814 CACGTGGCCTCAGAGGGTGGGGG - Intergenic
904302179 1:29561455-29561477 CACACAGCCCACAGGGGTGGAGG - Intergenic
904455086 1:30642682-30642704 CACACAGCCCACAGGGGTGGAGG + Intergenic
904614991 1:31744729-31744751 CACCTGGAACACGGAGGTGGTGG + Exonic
905614902 1:39389441-39389463 CACTTGGACCCCGGAGGTGGAGG - Intronic
906182492 1:43834075-43834097 CACTTGGACCTCGGAGGTGGAGG + Intronic
907798567 1:57741991-57742013 TAAGAGGCCCATGGGGGTGGAGG + Intronic
912920974 1:113866829-113866851 CACTTGACCCCAGGGGGTGGAGG - Intronic
913680795 1:121186047-121186069 GACGAGGCCCAGGGGGCTGGAGG - Intronic
914032628 1:143973689-143973711 GACGAGGCCCAGGGGGCTGGAGG - Intergenic
914156818 1:145094278-145094300 GACGAGGCCCAGGGGGCTGGAGG + Intronic
916734164 1:167592299-167592321 CACTTGGACCCCGGAGGTGGAGG + Intergenic
919823118 1:201485232-201485254 CAGGAGGCCCAAGGGGGTAGGGG - Intronic
919898341 1:202024022-202024044 CACTTGGGCCCTGGGGGTGGGGG - Intergenic
920468108 1:206204573-206204595 GACGAGGCCCAGGGGGCTGGAGG - Intronic
922741295 1:228015709-228015731 CACTTGGGCGGCGGGGGTGGGGG - Intronic
1063208323 10:3855671-3855693 CCTTTGGCCCACGGGGGTTGGGG + Intergenic
1065099658 10:22321029-22321051 CACGTGACCCGCTGGGGGGGCGG + Intronic
1065346568 10:24753713-24753735 CACTTGAGCCTCGGGGGTGGAGG + Intergenic
1066359486 10:34716544-34716566 CACGTAGCCCATGGGGCTGCAGG - Intronic
1070891991 10:79947975-79947997 CACCAGGCCAACTGGGGTGGTGG + Intronic
1071096485 10:81981443-81981465 CTCCAGGCCCACTGGGGTGGTGG + Intronic
1073300363 10:102467608-102467630 ACTGTGGCCCACGGGGGTGGTGG + Intronic
1073478513 10:103770693-103770715 CCAGTGGTCCATGGGGGTGGGGG + Intronic
1073478684 10:103771977-103771999 CCAGTGGTCCATGGGGGTGGGGG - Intronic
1074358786 10:112808539-112808561 CACTTGGCCCCGGGAGGTGGAGG + Intronic
1074504835 10:114060295-114060317 CAAGTGGCCAATGGGTGTGGAGG + Intergenic
1075345554 10:121679521-121679543 GACGTGGGACACGGGGGTGGTGG + Intergenic
1075600220 10:123762008-123762030 CACGTGGTCGTCGGGGGTGGGGG + Exonic
1076562561 10:131376808-131376830 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562578 10:131376867-131376889 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562595 10:131376926-131376948 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562612 10:131376985-131377007 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562629 10:131377044-131377066 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562646 10:131377103-131377125 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562663 10:131377162-131377184 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562680 10:131377221-131377243 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076691142 10:132224421-132224443 CACGTGGTCCAAGGAGATGGTGG - Exonic
1076847490 10:133076410-133076432 CCCGTGTCCCTCGGAGGTGGTGG - Intronic
1076900430 10:133335166-133335188 AGCTTGGCCCGCGGGGGTGGGGG + Intronic
1079076328 11:17387402-17387424 CACCTCGCCCTCGGGGCTGGTGG + Exonic
1079610977 11:22432481-22432503 CACGTGCCGCATGGGGGTGGGGG + Intergenic
1079881459 11:25932519-25932541 CATGTGGCTCACAGTGGTGGTGG - Intergenic
1080418448 11:32090914-32090936 CACGTCGCCAGCTGGGGTGGTGG - Exonic
1082250448 11:49973517-49973539 CACTTGGCCCTGGGAGGTGGAGG + Intergenic
1083609944 11:63999896-63999918 GAGGGGGCCCACAGGGGTGGGGG - Intronic
1084169087 11:67391924-67391946 CACGTGGACCAATGGGGAGGCGG + Intronic
1084216654 11:67650584-67650606 CACGTGGCCCCAGAGGGTTGAGG + Exonic
1084399906 11:68937435-68937457 CATGTGGCCCTGGAGGGTGGAGG + Intronic
1084486357 11:69450474-69450496 CAGGAGGCCCACAGGGCTGGGGG - Intergenic
1089035131 11:115381208-115381230 CACTTGAACCTCGGGGGTGGAGG + Intronic
1089316230 11:117593145-117593167 CACGTGGGCCCAGGGGATGGAGG - Intronic
1090807092 11:130209576-130209598 CAGGTGGCCCCCGGGGCAGGAGG + Exonic
1090832189 11:130427661-130427683 CTCGTGGCCCCCAGGGGCGGTGG + Exonic
1098336097 12:69406409-69406431 CACTTGAACCAAGGGGGTGGAGG - Intergenic
1099198021 12:79641761-79641783 CACGTGGACCAGGGAGTTGGAGG + Intronic
1099550552 12:84038383-84038405 CAGGGGGCCAGCGGGGGTGGTGG + Intergenic
1102092916 12:110208420-110208442 CACTTGGGCCAGGGAGGTGGAGG + Intronic
1102519678 12:113470684-113470706 CACAGGGCCCACAGGGGTAGGGG + Intronic
1104940995 12:132395249-132395271 CAGGTGACCCACGGGGCCGGGGG - Intergenic
1105281296 13:18964142-18964164 CATGTGGAACACGGGGGTGGGGG + Intergenic
1106108965 13:26760538-26760560 CAGGCGGCCCGCGGGGGCGGGGG + Intronic
1106931309 13:34668638-34668660 CATGAGACCGACGGGGGTGGGGG - Intergenic
1108487609 13:50942735-50942757 CATGTGCCCCACGGTGGTTGGGG + Intronic
1108553053 13:51565605-51565627 CACTTGAACCCCGGGGGTGGAGG - Intergenic
1112512638 13:100023500-100023522 CACGTGGCCGCCGGGTGCGGTGG - Intergenic
1113893698 13:113749663-113749685 CACGGGGCCCCCAGGGGTGCAGG - Intergenic
1114266030 14:21073115-21073137 CACCTGGCCCAACAGGGTGGGGG - Exonic
1114748242 14:25173772-25173794 CACTTGGACCAGGGAGGTGGAGG - Intergenic
1121008733 14:90507412-90507434 AACGTGGGCCATGGTGGTGGGGG + Intergenic
1121450060 14:94001353-94001375 CCCGTGGCCCAGGGAGCTGGGGG + Intergenic
1122960909 14:105093327-105093349 CACGTCGCCCGCGAGGGGGGTGG + Intergenic
1122970026 14:105148688-105148710 TAAGGGGCCCACAGGGGTGGAGG + Intronic
1124411862 15:29443506-29443528 CATGGGGCCCACGGGTCTGGTGG + Intronic
1124952070 15:34332697-34332719 CACTTGGACCAGGGAGGTGGAGG + Intronic
1125444244 15:39736607-39736629 CCTGTGGCCCACGGGGGAGGAGG - Intronic
1128588932 15:68877156-68877178 CAAGTGGCCCACGAAGTTGGAGG + Intronic
1129102544 15:73279634-73279656 CACGCGGGCCCCGGGCGTGGTGG - Intronic
1129750305 15:78058308-78058330 CATGGGGTCCACGGGGGTGTGGG + Intronic
1129856765 15:78830505-78830527 CTCGGGGCCCACAGGGGAGGTGG + Intronic
1131116948 15:89801688-89801710 CAAGTGGCCCCCCGGGGTCGAGG - Intronic
1132549731 16:549402-549424 CACGTGGACCACGGTGCTGGTGG + Exonic
1132592961 16:734357-734379 CAGGGGGCACACGGGGCTGGCGG + Intronic
1132854889 16:2040320-2040342 CTGGAGGGCCACGGGGGTGGTGG - Intronic
1136414660 16:30095993-30096015 CACCTGGGGCGCGGGGGTGGGGG + Exonic
1138189706 16:55004391-55004413 CACATGTCCCCTGGGGGTGGTGG - Intergenic
1138425703 16:56931015-56931037 TCCGTGGCCCAGGGGGGTTGGGG + Intergenic
1139366883 16:66439006-66439028 TACGTGGATCATGGGGGTGGGGG + Intronic
1140046203 16:71441887-71441909 CACGTGGGCCGCGGGGCTGCGGG + Intergenic
1140167611 16:72569971-72569993 CACGTGGGCCACAGGCATGGTGG - Intergenic
1140662249 16:77198684-77198706 AGGGTGGCCCACGGGGGTGCTGG + Exonic
1141138914 16:81484535-81484557 CTCGTGGCCCAAGGGGGAAGAGG - Intronic
1141138923 16:81484543-81484565 CCCTTGGGCCACGAGGGTGGGGG + Intronic
1141866645 16:86754581-86754603 CAAGTGCCTCACGGGAGTGGTGG - Intergenic
1142413484 16:89928136-89928158 CACTTGAGCCAGGGGGGTGGAGG - Intronic
1142590503 17:1003365-1003387 CCTGTGGCCCACGGGGGCTGGGG - Exonic
1142638511 17:1271829-1271851 CACGGGGCCCACTGGAGTCGTGG - Intergenic
1143102523 17:4512298-4512320 CCTGAGGCCCACGGGGATGGGGG + Intronic
1143126012 17:4641360-4641382 CGCGGAGGCCACGGGGGTGGGGG - Intronic
1143719459 17:8799408-8799430 CAGGTGGCCCGCGGAGGCGGTGG - Intergenic
1143871459 17:9959768-9959790 CTCCTGGCTCACGGGGTTGGGGG - Intronic
1144682846 17:17206601-17206623 CGCGTGGCCCTCGGGGGCTGAGG - Intronic
1144682930 17:17206883-17206905 CCCGTGGCCCGCGGGTGTGCAGG - Intronic
1147614697 17:41821065-41821087 CACCTGGCCCACGGGGAGAGTGG + Exonic
1152588005 17:81197631-81197653 CACCTGGCCCTCGGGGGAGGAGG - Intronic
1152598297 17:81248982-81249004 CACGTGGCCCACGGCCGAGGTGG - Intronic
1155165477 18:23228705-23228727 AAACTGGCCCACGGGGGTGGGGG - Intronic
1155453430 18:25986606-25986628 TATGTGGGCCCCGGGGGTGGTGG - Intergenic
1157882439 18:51333296-51333318 CACTTGAACCACGGAGGTGGAGG + Intergenic
1160528971 18:79552686-79552708 CCCGGGACCCACGGGCGTGGGGG - Intergenic
1160871790 19:1281149-1281171 CGCGTGTCCCACGGGGCTGCGGG - Intergenic
1160967905 19:1754548-1754570 CACGGGCCGCACGGGGGAGGCGG + Exonic
1161506379 19:4646059-4646081 GATATGGGCCACGGGGGTGGGGG - Intronic
1161628819 19:5341047-5341069 CACGTGGGCGGCTGGGGTGGTGG + Intergenic
1161675282 19:5643777-5643799 CACTTGGACCAGGGAGGTGGAGG + Intronic
1161990241 19:7680696-7680718 GACGTGGCCCACGGCCGTGATGG - Intronic
1162403158 19:10458091-10458113 CTCCTGGCCCAAGTGGGTGGGGG + Exonic
1162822464 19:13231370-13231392 CAGGTGCCCCCAGGGGGTGGGGG - Intronic
1163386781 19:17004764-17004786 CACGTGGCTCTCTGGGGTGGAGG + Intronic
1165431385 19:35775484-35775506 CGCGCGCCCCACGGGGGCGGGGG - Intronic
1165900508 19:39167277-39167299 CATGGGGCCAAAGGGGGTGGAGG + Intronic
1165955713 19:39500714-39500736 CACGTGAGACACGGGGTTGGTGG + Intronic
1166822980 19:45591895-45591917 CCCCTGGCCCACGGGGGCTGTGG + Exonic
1168144920 19:54415535-54415557 CCCATGGCCCCCGGGGGAGGGGG - Exonic
1168326372 19:55540778-55540800 CAGGTGGCCCTGGGGGCTGGGGG + Exonic
925118918 2:1402443-1402465 CACGGAGCCAAGGGGGGTGGGGG + Intronic
940945704 2:159615629-159615651 CAGGAGGCGGACGGGGGTGGGGG + Intronic
943589899 2:189784422-189784444 CACGTTGCCCCCGGGCGAGGCGG + Exonic
946373502 2:219294761-219294783 GAGCTGGCCCACGCGGGTGGTGG + Intronic
946404921 2:219487122-219487144 CAGCTGGGCCATGGGGGTGGTGG - Intronic
947829102 2:233126129-233126151 AAAGTGCTCCACGGGGGTGGGGG + Intronic
948138870 2:235658570-235658592 CACGTGCCCAGCAGGGGTGGAGG + Intronic
948459862 2:238123868-238123890 CCCGTGGCCCAGTGGGGTGAGGG + Intronic
948503423 2:238411232-238411254 CACCTGCCCCACAGGGGTGAGGG - Intergenic
948916164 2:241035940-241035962 CAGGTGTGCCACGGGGTTGGAGG + Intronic
1174047039 20:47741042-47741064 CGCCTGACCCACGGGGGAGGTGG - Intronic
1175378121 20:58543158-58543180 CAGGTGCCCCCCGGGGCTGGGGG - Intergenic
1178498356 21:33105576-33105598 CACGTGGGCCACTTAGGTGGAGG - Intergenic
1178922989 21:36751556-36751578 CAAGTGGCCGACTGGGGTGCGGG - Exonic
1179146012 21:38768461-38768483 CAAATGTCCCCCGGGGGTGGGGG - Intergenic
1179842012 21:44082848-44082870 CACGTGGACCACGGCATTGGAGG - Exonic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181518738 22:23433378-23433400 CAGGTGGCCCACGGGCTGGGAGG - Intergenic
1182056530 22:27359907-27359929 CACGTGTACCACAGTGGTGGGGG - Intergenic
1182257761 22:29050537-29050559 CAGGTGGCCCGCGGGGGCGGAGG + Exonic
1182615397 22:31585511-31585533 CACATGTCTCCCGGGGGTGGAGG + Intronic
1183564193 22:38601428-38601450 GAGGTGGCTCACAGGGGTGGGGG + Intronic
1183912860 22:41092129-41092151 CACCTGGCCGCCGGCGGTGGGGG + Exonic
1184597889 22:45525468-45525490 CACGAGATCCTCGGGGGTGGGGG - Intronic
1184777279 22:46629491-46629513 CACGAGGCCCCCGGGGTGGGGGG + Intronic
1185323742 22:50215618-50215640 CACCTGTGCCAGGGGGGTGGGGG + Intronic
952239388 3:31514469-31514491 ACTGTGGCCCACAGGGGTGGGGG - Intergenic
954681917 3:52350457-52350479 CACGTGTGCCAGGGAGGTGGTGG - Intronic
956960286 3:74391648-74391670 CACTTGAACCCCGGGGGTGGAGG - Intronic
957387391 3:79514294-79514316 CACGTGGTGTGCGGGGGTGGAGG + Intronic
959011919 3:101087598-101087620 CACTTGGCCCTGGGAGGTGGAGG - Intergenic
962138061 3:132758408-132758430 CACATGGGCCAGGGAGGTGGAGG + Intergenic
963760616 3:149284258-149284280 CACGGGGCGCAGGGGGGTGGGGG - Intergenic
964840163 3:160984840-160984862 CAAATGTCCCATGGGGGTGGAGG - Intronic
964867628 3:161278567-161278589 CACGTGAGCCAGGGAGGTGGAGG - Intergenic
967330441 3:188284438-188284460 CAGGAGGCCCAAGGGGGAGGTGG + Intronic
967858256 3:194134273-194134295 CACGTGGCACCCGGCGGCGGCGG + Intergenic
967858920 3:194137410-194137432 CACATCGCGCGCGGGGGTGGGGG + Intronic
968084230 3:195867431-195867453 GCAGTGGCCCTCGGGGGTGGTGG + Exonic
968461899 4:730373-730395 CACGTGGCCCACGGGGGTGGGGG - Intronic
968476099 4:809514-809536 CACATGGCCTGAGGGGGTGGGGG + Intronic
968515009 4:1012108-1012130 CACGTGGGGCGCGGGGGCGGGGG - Intronic
968568196 4:1326040-1326062 CAGGTGGCCCCCGGGGGTCTGGG + Intronic
969183111 4:5456887-5456909 CACGTGGTGCAAGGGGATGGTGG + Exonic
969600608 4:8173945-8173967 CACCTGCCCCTCGGGGCTGGAGG + Intergenic
971264894 4:25088694-25088716 GACGTGGCCCACGAGAGCGGCGG - Intergenic
974948049 4:68552500-68552522 CATGTGTCCCAAGGTGGTGGGGG - Intronic
980021117 4:127711518-127711540 TATGTGGCCCAGGGGGGTTGGGG - Intronic
986262053 5:6156087-6156109 CACGTGGTCCAAGGGGCTGTGGG - Intergenic
986468117 5:8047396-8047418 CACATGGCCCACATGGGAGGTGG + Intergenic
987312866 5:16697612-16697634 CACTTGAACCCCGGGGGTGGAGG + Intronic
992905251 5:81339242-81339264 CACGGGGGCCAAGCGGGTGGGGG + Intronic
1001293690 5:170484297-170484319 CACGTGTTCCTCGGGGGCGGCGG + Intronic
1002044100 5:176532413-176532435 CCGCTGGCCCACGGGGGCGGAGG + Exonic
1002342220 5:178524609-178524631 CAGGTGGTCCATGGGGGAGGAGG - Intronic
1004072823 6:12317006-12317028 CACTTGAACCAGGGGGGTGGAGG + Intergenic
1004667673 6:17763384-17763406 CACGTGAGCCAGGGAGGTGGAGG + Intronic
1005759029 6:28950702-28950724 CACCTGGCACACGGGCGCGGTGG - Intergenic
1005883092 6:30075000-30075022 CACTTGGTCCACAGGGGAGGAGG - Intronic
1006319313 6:33310733-33310755 CACTTGAGCCACGGAGGTGGAGG + Intronic
1012112595 6:95256413-95256435 CACTTGAACCCCGGGGGTGGAGG - Intergenic
1012833999 6:104242048-104242070 CACTTGGCCCCGGGAGGTGGAGG + Intergenic
1016162440 6:140898082-140898104 CCCGGGAGCCACGGGGGTGGGGG + Intergenic
1019729713 7:2623272-2623294 CACATCGCTCCCGGGGGTGGGGG - Intergenic
1020127503 7:5541242-5541264 CACTTGGCCGACAGGGGTGTGGG - Intronic
1021838914 7:24706569-24706591 AACCTGGCCCACGAGGGTTGGGG + Intronic
1023427156 7:40050061-40050083 CACTTGGACCCCGGAGGTGGAGG - Intronic
1028207503 7:88033819-88033841 CACGTGGGCCTGTGGGGTGGTGG - Intronic
1030097082 7:105909974-105909996 CACGTGACCCACTGGCTTGGAGG + Intronic
1031379000 7:121061499-121061521 CACATGGCCCACTCTGGTGGGGG + Intronic
1032079710 7:128852768-128852790 CACGGGGACCTCAGGGGTGGGGG + Intronic
1033648713 7:143323782-143323804 CACGCGGGACAAGGGGGTGGAGG - Intronic
1034103577 7:148471826-148471848 CACGTGGGCCTGGGAGGTGGAGG + Intergenic
1035680210 8:1482591-1482613 CTCGTGGGCCACGGGGTGGGCGG + Intergenic
1035716497 8:1759245-1759267 CTCGTGGCTAACGGGGTTGGCGG + Intronic
1036487178 8:9189823-9189845 AAGGTGTCCCCCGGGGGTGGTGG - Intergenic
1036752482 8:11452077-11452099 CACGTGTCCCTTGGTGGTGGGGG + Intronic
1037820772 8:22133593-22133615 CCCGGGACCCGCGGGGGTGGGGG + Intergenic
1038799612 8:30737762-30737784 CACGTGGGCCTGGGAGGTGGAGG + Intronic
1046805516 8:118475153-118475175 CACGTGACCCTGGGAGGTGGAGG + Intronic
1049058242 8:140255800-140255822 CACTTGACCCAGGGAGGTGGAGG + Intronic
1049654508 8:143791791-143791813 GATGAGGGCCACGGGGGTGGGGG + Intronic
1049861265 8:144901089-144901111 GACGGGGCCCAAGGGGGTAGGGG + Intronic
1050532604 9:6603811-6603833 CACTTGAACCACGGAGGTGGAGG - Intronic
1050552224 9:6758279-6758301 CGCGTGGGGCACGGGGGTGCGGG + Intronic
1054172956 9:61857195-61857217 CACCTGGGACCCGGGGGTGGGGG - Intergenic
1054664586 9:67723586-67723608 CACCTGGGACCCGGGGGTGGGGG + Intergenic
1056211205 9:84367152-84367174 CCCGTGGCCTGCGGTGGTGGTGG - Intergenic
1057613037 9:96563564-96563586 CACTTGAACCAGGGGGGTGGAGG + Intronic
1060945199 9:127566416-127566438 CAGGAGCCCCACGGGGCTGGTGG - Intronic
1061650849 9:132048743-132048765 CACCTGCATCACGGGGGTGGCGG + Intronic
1061986441 9:134132844-134132866 CACTTGGCCCAGGAGGTTGGGGG - Intergenic
1062423295 9:136494293-136494315 GTCCTGGCCCACGGGGGTGTGGG - Intergenic
1062534824 9:137016786-137016808 CACGTGGCCCACGTGGTGGATGG - Intronic
1186556865 X:10568969-10568991 CAAATCACCCACGGGGGTGGTGG + Intronic
1194229297 X:91301884-91301906 CTCATGGCCCAAGGTGGTGGTGG + Intergenic
1198266865 X:135017570-135017592 CTCGTGGACCAAGTGGGTGGTGG - Intergenic
1198862437 X:141084939-141084961 CACTTGACCCAGGGAGGTGGAGG + Intergenic
1198900257 X:141502447-141502469 CACTTGACCCAGGGAGGTGGAGG - Intergenic
1199296015 X:146159699-146159721 CACGTGAACCAGGGAGGTGGAGG - Intergenic
1199700156 X:150369779-150369801 CACGTGCACCACTGGGGTGTGGG + Intronic
1200182963 X:154162366-154162388 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200188617 X:154199480-154199502 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200194266 X:154236621-154236643 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200200022 X:154274424-154274446 CAGGAGGCCCAGGAGGGTGGCGG + Intronic
1200210528 X:154344973-154344995 CAGGTGGCCCAGGAGTGTGGGGG - Intergenic
1200220324 X:154387119-154387141 CAGGTGGCCCAGGAGTGTGGGGG + Intergenic