ID: 968463547

View in Genome Browser
Species Human (GRCh38)
Location 4:737898-737920
Sequence ACGTTGGCATAGCGGGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968463535_968463547 20 Left 968463535 4:737855-737877 CCCTCATCCCACAGCGCCAGCTT 0: 1
1: 0
2: 1
3: 21
4: 215
Right 968463547 4:737898-737920 ACGTTGGCATAGCGGGTAGCTGG No data
968463537_968463547 13 Left 968463537 4:737862-737884 CCCACAGCGCCAGCTTCCCCACA 0: 1
1: 0
2: 2
3: 20
4: 253
Right 968463547 4:737898-737920 ACGTTGGCATAGCGGGTAGCTGG No data
968463540_968463547 4 Left 968463540 4:737871-737893 CCAGCTTCCCCACAACAGAGGAG 0: 1
1: 0
2: 4
3: 23
4: 239
Right 968463547 4:737898-737920 ACGTTGGCATAGCGGGTAGCTGG No data
968463538_968463547 12 Left 968463538 4:737863-737885 CCACAGCGCCAGCTTCCCCACAA 0: 1
1: 0
2: 1
3: 20
4: 258
Right 968463547 4:737898-737920 ACGTTGGCATAGCGGGTAGCTGG No data
968463542_968463547 -4 Left 968463542 4:737879-737901 CCCACAACAGAGGAGCAGCACGT 0: 1
1: 0
2: 0
3: 9
4: 87
Right 968463547 4:737898-737920 ACGTTGGCATAGCGGGTAGCTGG No data
968463541_968463547 -3 Left 968463541 4:737878-737900 CCCCACAACAGAGGAGCAGCACG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 968463547 4:737898-737920 ACGTTGGCATAGCGGGTAGCTGG No data
968463536_968463547 19 Left 968463536 4:737856-737878 CCTCATCCCACAGCGCCAGCTTC 0: 1
1: 0
2: 1
3: 27
4: 308
Right 968463547 4:737898-737920 ACGTTGGCATAGCGGGTAGCTGG No data
968463532_968463547 28 Left 968463532 4:737847-737869 CCTGCCTCCCCTCATCCCACAGC 0: 1
1: 0
2: 12
3: 533
4: 7941
Right 968463547 4:737898-737920 ACGTTGGCATAGCGGGTAGCTGG No data
968463534_968463547 21 Left 968463534 4:737854-737876 CCCCTCATCCCACAGCGCCAGCT 0: 1
1: 0
2: 3
3: 17
4: 256
Right 968463547 4:737898-737920 ACGTTGGCATAGCGGGTAGCTGG No data
968463533_968463547 24 Left 968463533 4:737851-737873 CCTCCCCTCATCCCACAGCGCCA 0: 1
1: 0
2: 3
3: 45
4: 499
Right 968463547 4:737898-737920 ACGTTGGCATAGCGGGTAGCTGG No data
968463543_968463547 -5 Left 968463543 4:737880-737902 CCACAACAGAGGAGCAGCACGTT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 968463547 4:737898-737920 ACGTTGGCATAGCGGGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968463547 Original CRISPR ACGTTGGCATAGCGGGTAGC TGG Intronic
No off target data available for this crispr