ID: 968466181

View in Genome Browser
Species Human (GRCh38)
Location 4:752568-752590
Sequence TTGTGGATAAGGAGTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 770
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 729}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968466166_968466181 15 Left 968466166 4:752530-752552 CCTGAGGCCTCCGGGGACCGGGC 0: 1
1: 0
2: 1
3: 18
4: 229
Right 968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG 0: 1
1: 0
2: 2
3: 38
4: 729
968466169_968466181 8 Left 968466169 4:752537-752559 CCTCCGGGGACCGGGCGGGCAAG 0: 1
1: 0
2: 0
3: 8
4: 107
Right 968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG 0: 1
1: 0
2: 2
3: 38
4: 729
968466172_968466181 5 Left 968466172 4:752540-752562 CCGGGGACCGGGCGGGCAAGGGT 0: 1
1: 0
2: 1
3: 24
4: 188
Right 968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG 0: 1
1: 0
2: 2
3: 38
4: 729
968466176_968466181 -2 Left 968466176 4:752547-752569 CCGGGCGGGCAAGGGTGGGGTTT 0: 1
1: 0
2: 1
3: 15
4: 158
Right 968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG 0: 1
1: 0
2: 2
3: 38
4: 729

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968466181 Original CRISPR TTGTGGATAAGGAGTGAGGT GGG Intronic
901211527 1:7529115-7529137 TTGTGGATATGGAATGAAGGGGG + Intronic
901409850 1:9075077-9075099 TTAGGGAAAAGGAGTCAGGTTGG + Intronic
901767974 1:11515794-11515816 TTGGGGCCAAGGAGTGTGGTGGG + Intronic
902875336 1:19337589-19337611 TTGTGGATGGGGAGAGAGATTGG - Intergenic
903398815 1:23023383-23023405 TTTTGTATATGGTGTGAGGTAGG + Intronic
904436193 1:30498365-30498387 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
904580529 1:31540392-31540414 TTTTGCATACGGTGTGAGGTAGG + Intergenic
904713842 1:32451818-32451840 TTTTGCATATGGAATGAGGTAGG + Intergenic
904941256 1:34166016-34166038 TTGGGGGTGGGGAGTGAGGTTGG + Intergenic
904961439 1:34336383-34336405 TTGTGAATGAGGAGACAGGTTGG + Intergenic
906173602 1:43749174-43749196 TTTTGTATATGGTGTGAGGTAGG - Intronic
906369189 1:45237764-45237786 TTTTGTATATGGTGTGAGGTAGG - Intronic
906488505 1:46249262-46249284 GTGTGAATAAGGTGTGGGGTAGG + Intronic
906904037 1:49868578-49868600 TTTTGTATAAGGTGTAAGGTAGG - Intronic
907141513 1:52189810-52189832 TTTTGTATATGGTGTGAGGTAGG + Intronic
908310017 1:62871554-62871576 TTTTGTATATGGTGTGAGGTAGG + Intergenic
908344140 1:63214163-63214185 TTTTGTATATGGTGTGAGGTAGG - Intergenic
908603660 1:65769170-65769192 TTTTGTATATGGTGTGAGGTAGG - Intergenic
909303765 1:74046425-74046447 TTTTGTATAAGGTGTAAGGTAGG - Intronic
909619411 1:77651024-77651046 TTTTGTATATGGTGTGAGGTAGG - Intronic
909998858 1:82317006-82317028 TTGTGGAGAAGAGGTGTGGTAGG - Intergenic
910003217 1:82361893-82361915 TTGTGGCTAGGGAGAAAGGTGGG - Intergenic
910208463 1:84771216-84771238 TTTTGGATAAGGACTGAGACAGG - Intergenic
910517967 1:88084912-88084934 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
910937365 1:92495303-92495325 TTGTGATTAAGGAGAGAAGTGGG - Intergenic
910954517 1:92687360-92687382 TTTTGTATAAGGTGTGAGGAAGG - Intronic
911023922 1:93416929-93416951 TTTTGTATAAGGTGTGAGATGGG - Intergenic
912299183 1:108496164-108496186 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
912859908 1:113204665-113204687 TTGTGGATATGGTGAGAGATAGG + Intergenic
912889479 1:113513597-113513619 TTTTGTATAAGGTGTGAGGAAGG - Intronic
913094704 1:115505124-115505146 TTGTGGATATGGGATGGGGTGGG - Intergenic
915256046 1:154629863-154629885 TTTTGTATATGGTGTGAGGTAGG + Intergenic
915582138 1:156820144-156820166 TTTTGTATAAGGAGAGAGATGGG + Intronic
915991038 1:160516830-160516852 TTTTGTATAAGGTGTGAGGGAGG - Intronic
917030842 1:170689713-170689735 GTGGCGATATGGAGTGAGGTGGG + Intronic
917042039 1:170815731-170815753 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
917358181 1:174148217-174148239 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
917705281 1:177626675-177626697 TTTTGTATATGGTGTGAGGTGGG - Intergenic
917873829 1:179267049-179267071 TTTTGTATATGGTGTGAGGTAGG + Intergenic
918531614 1:185528402-185528424 TTGAGGATAAGGCGTGTGGCAGG + Intergenic
919293906 1:195669595-195669617 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
919948155 1:202337488-202337510 TTATGTATAGTGAGTGAGGTGGG + Intronic
920590332 1:207211714-207211736 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
920637903 1:207722363-207722385 TTTTGTATAAGGTGTGAGGAAGG + Intronic
920639220 1:207735301-207735323 TTTTGTATAAGGTGTGAGGAAGG - Intronic
920642932 1:207771567-207771589 TTTTGTATAAGGTGTGAGGAAGG + Intronic
921288011 1:213626597-213626619 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
921943218 1:220864616-220864638 TTGTATATATGGTGTGAGGTAGG + Intergenic
922147524 1:222962750-222962772 TTTTGTATAAGGAGTAAGGAAGG - Intronic
922152845 1:223020213-223020235 CTGATGATGAGGAGTGAGGTGGG + Intergenic
922436048 1:225607726-225607748 TTGGGGAAAAGGAGGGTGGTGGG - Intronic
922951441 1:229561100-229561122 TGGTAGGTAAGGAGTGAGGTGGG + Intergenic
923388722 1:233492221-233492243 TTGTGGGAAAGGAGTGAGGCAGG + Intergenic
923444014 1:234050808-234050830 TTTTGGATAAGGTGTAAGGAAGG + Intronic
923576279 1:235161534-235161556 TTGTTGAAAAGGAGGGAGGGAGG + Intronic
924893618 1:248312072-248312094 TTTTGTATAAGGTGTAAGGTGGG + Intergenic
1063495967 10:6508645-6508667 TTGTGAATAAGGAGTAAAGATGG + Intronic
1064150566 10:12860565-12860587 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1064344079 10:14514924-14514946 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1064740254 10:18425804-18425826 TTTTGTATAAGGAGTGAGATAGG + Intronic
1064916145 10:20460848-20460870 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1065103792 10:22358752-22358774 TTTTGTATAAGGAGTAAGGAAGG + Intronic
1065484631 10:26225953-26225975 TTGTTCATGAGGAATGAGGTGGG + Intronic
1066492856 10:35910825-35910847 TTTTGCTTATGGAGTGAGGTAGG + Intergenic
1067823949 10:49556074-49556096 TTTTGTATATGGTGTGAGGTAGG - Intergenic
1067844134 10:49705597-49705619 TTTTGTATATGGTGTGAGGTAGG - Intronic
1067996280 10:51277132-51277154 TTTTGTATAAGGTGTAAGGTAGG + Intronic
1068057032 10:52024083-52024105 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1068692180 10:59928366-59928388 TTTTGTATATGGGGTGAGGTAGG - Intergenic
1068889041 10:62129303-62129325 TTTTGTATATGGTGTGAGGTAGG - Intergenic
1069255862 10:66331237-66331259 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1070412313 10:76153483-76153505 TTTTGTATATGGTGTGAGGTAGG + Intronic
1071006154 10:80886417-80886439 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1071381545 10:85068157-85068179 TTGAGGAGAGGGAGAGAGGTGGG - Intergenic
1071663170 10:87526716-87526738 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1071913668 10:90265708-90265730 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1072026077 10:91458710-91458732 TTTTGTATAAGGTGTGAGTTTGG - Intronic
1072200946 10:93158317-93158339 TTGTTGAAAAGAAATGAGGTTGG - Intergenic
1072368707 10:94742232-94742254 CTGTGGTTCAGGAGTGTGGTTGG + Intronic
1072545680 10:96435630-96435652 TTTTGTATATGGTGTGAGGTAGG + Intronic
1073362948 10:102915008-102915030 GTGTGGAATAGGAGTGAAGTCGG - Intergenic
1074198593 10:111210701-111210723 TTGTGCATAAGGCATGTGGTAGG + Intergenic
1074579161 10:114700761-114700783 TTTTGTATATGGTGTGAGGTAGG - Intergenic
1075481604 10:122787128-122787150 CTGGGAATAAGGAGTCAGGTGGG + Intergenic
1075539821 10:123302754-123302776 TTTTGGGTATGGTGTGAGGTAGG - Intergenic
1075656351 10:124163689-124163711 TGGGGAATAAGGAGTCAGGTTGG + Intergenic
1075720170 10:124580434-124580456 TTGTGTATATGGTGTGAGGTAGG + Intronic
1075781390 10:125019632-125019654 TTCTGCATATGGTGTGAGGTAGG - Intronic
1076409741 10:130237771-130237793 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1076578414 10:131489306-131489328 TTTTGCATATGGTGTGAGGTAGG - Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077751164 11:4971560-4971582 GTATGGAAAAGGAGTAAGGTTGG + Intronic
1077762026 11:5112055-5112077 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1078516763 11:12029114-12029136 TTGGGGAAAAGGAGTCAGGCTGG + Intergenic
1078617956 11:12882403-12882425 TTGTGGGGAAGGAGACAGGTAGG - Intronic
1078652698 11:13210427-13210449 CCATGGATAAGGAGTGAGCTGGG + Intergenic
1078713903 11:13821181-13821203 TTTTGCATAAGGTGTGAGGAAGG + Intergenic
1078842308 11:15090025-15090047 TTTTGTATATAGAGTGAGGTAGG + Intergenic
1079178142 11:18162751-18162773 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1079263031 11:18902088-18902110 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1079690331 11:23408998-23409020 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1079904857 11:26232602-26232624 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
1080561729 11:33470186-33470208 TTTTGTATATGGTGTGAGGTAGG + Intergenic
1080993198 11:37566974-37566996 TTTTGGATATGGTGTAAGGTAGG - Intergenic
1081230420 11:40579370-40579392 TTGTGGCTAAGCAGTAAAGTTGG + Intronic
1082151019 11:48738844-48738866 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1082240940 11:49869865-49869887 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1083495376 11:63047551-63047573 GTGAGGGTAAGGTGTGAGGTTGG - Intergenic
1083501223 11:63110018-63110040 TTTTGTATAAGGTGTAAGGTAGG + Intronic
1083525806 11:63363614-63363636 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1083527005 11:63377347-63377369 TTGTGGTCCAGGAGTGTGGTTGG - Intronic
1083916585 11:65748900-65748922 TTTTGTATATGGTGTGAGGTGGG + Intergenic
1084614212 11:70225017-70225039 TTTGGTAGAAGGAGTGAGGTAGG - Intergenic
1084947343 11:72645512-72645534 TTGTGCAGTTGGAGTGAGGTAGG - Intronic
1085185914 11:74576103-74576125 TTAGGGCTAAGGGGTGAGGTAGG + Intronic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085490674 11:76914019-76914041 TTTTGTATAAGGAGTAAGGAAGG - Intronic
1086496104 11:87405953-87405975 TTTTGGATATGGAGGAAGGTAGG + Intergenic
1086519521 11:87653730-87653752 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1086883299 11:92174384-92174406 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1087051245 11:93888438-93888460 TTGTGGGAAAGGATTGATGTTGG + Intergenic
1087366639 11:97228107-97228129 TTTTGTATAAGGTGAGAGGTAGG + Intergenic
1087880888 11:103415136-103415158 TTTTGTATAAGGTGTAAGGTAGG - Intronic
1087981188 11:104616606-104616628 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1088038877 11:105351884-105351906 TTGTGTATATGAAGGGAGGTAGG - Intergenic
1088256669 11:107909722-107909744 AGGTGGATAAGGAAGGAGGTGGG - Intronic
1088490621 11:110383955-110383977 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1088508562 11:110551011-110551033 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1088512840 11:110596114-110596136 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1088741815 11:112773790-112773812 TTGGAGATAAGGAGTGATGATGG + Intergenic
1090724797 11:129515254-129515276 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1090760185 11:129830005-129830027 TTTTGTATATGGTGTGAGGTAGG - Intronic
1091798267 12:3309477-3309499 GGGTAGAAAAGGAGTGAGGTAGG - Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092803453 12:12195860-12195882 TTTTGTATAAGGTGAGAGGTGGG + Intronic
1093340034 12:17962753-17962775 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1093940493 12:25048932-25048954 TTTTGTATAAGGATTGAGGAAGG + Intronic
1094792939 12:33935385-33935407 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1095032994 12:37319047-37319069 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1095140108 12:38651429-38651451 TTGCGGAAAAGGAATGAGGCAGG + Intronic
1095187049 12:39212701-39212723 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1095271206 12:40221467-40221489 TTTTGAATATGGTGTGAGGTAGG + Intronic
1095404607 12:41854228-41854250 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1095425237 12:42067929-42067951 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1096509546 12:52120069-52120091 TTGGGGCTAAGGAGTGAAGGGGG + Intergenic
1096953901 12:55505865-55505887 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1097172193 12:57122286-57122308 TTTTGCATATGGTGTGAGGTAGG + Intronic
1097191386 12:57221181-57221203 ATGTGGGTGAGGAGAGAGGTGGG - Intronic
1097524085 12:60708401-60708423 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1098004553 12:65982181-65982203 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1098039778 12:66342175-66342197 TTTTGTATATGGTGTGAGGTAGG + Exonic
1098091664 12:66908608-66908630 TTGTTTATGAGGAGTGAGATTGG + Intergenic
1098200374 12:68048261-68048283 TGGAGAATAAGGAGTGAGCTTGG - Intergenic
1098505963 12:71251042-71251064 TTGTGGAGAAAGAGTGAGCTAGG - Intronic
1098575796 12:72040762-72040784 TTGAGGATAGGGAGAGAGATGGG + Intronic
1098829238 12:75339758-75339780 TTTTGGATAAGGTGTAAGGAAGG + Intronic
1098858477 12:75681178-75681200 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1099257651 12:80334083-80334105 TTGTGGGTAAGGTGTAAGGAGGG + Intronic
1099406454 12:82269467-82269489 TTGTGGTGAAGGTGAGAGGTAGG + Intronic
1099584221 12:84495504-84495526 TTGAAGAGAAGGAGGGAGGTAGG - Intergenic
1099626998 12:85088116-85088138 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1099723594 12:86396618-86396640 TGGGGGAGAAGGAGTGAGATAGG + Intronic
1099731468 12:86509231-86509253 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1099792842 12:87358883-87358905 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1101766176 12:107701606-107701628 TTGTGTGTATGGTGTGAGGTAGG + Intronic
1102033370 12:109757497-109757519 TTTTGGGTATGGTGTGAGGTAGG - Intronic
1102547115 12:113665202-113665224 GTGTGTATAGGGGGTGAGGTAGG - Intergenic
1102781265 12:115567086-115567108 TTGGGGAGAAAGAGTGAGGTGGG - Intergenic
1103605050 12:122079762-122079784 TTGTGGGGATGGAGTGAGATAGG + Intronic
1103689793 12:122762710-122762732 CTGTGGATAAGAAGTCAGATGGG + Intronic
1104074528 12:125377416-125377438 TTGAGAACAAAGAGTGAGGTTGG + Intronic
1104618973 12:130295416-130295438 TTCTGTATAAGAAGTGGGGTTGG + Intergenic
1105685209 13:22774222-22774244 GTGTGGGTAAGGAGAGAGCTGGG + Intergenic
1106026118 13:25957091-25957113 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1106202797 13:27555645-27555667 TTGTGTTTATGGTGTGAGGTAGG + Intronic
1106651261 13:31692651-31692673 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1108176607 13:47798830-47798852 TTGTGGATGAGGAGCTAGTTAGG - Intergenic
1108586532 13:51874844-51874866 TTGTGGAGGAGGAGGGAGGCAGG - Intergenic
1109085112 13:57961413-57961435 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1109182143 13:59226314-59226336 TGGTGAATGAGGAGTGAGGGTGG - Intergenic
1109216494 13:59595594-59595616 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1109326473 13:60873309-60873331 GTGTGGATAGGGAAAGAGGTTGG + Intergenic
1110128921 13:71982125-71982147 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1110491211 13:76110310-76110332 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1110545608 13:76751951-76751973 TTTTGGATACAGAGGGAGGTAGG - Intergenic
1110635139 13:77758596-77758618 TTTTGTATAAGGTGAGAGGTAGG + Intronic
1111013102 13:82338206-82338228 GTGAGGAGAAAGAGTGAGGTAGG - Intergenic
1111723423 13:91975090-91975112 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1111756449 13:92402100-92402122 TTGTTGAGTAGGAGTGAAGTTGG + Intronic
1111765450 13:92521597-92521619 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1111943482 13:94638730-94638752 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1113173683 13:107536047-107536069 TTTTGTATAAGGTGTAAGGTAGG - Intronic
1113528915 13:111005543-111005565 TTGTAGCTAAGGAGTAGGGTGGG - Intergenic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1115177854 14:30585327-30585349 TTGTATATATGGTGTGAGGTAGG + Intronic
1115294921 14:31814707-31814729 TTTTGAATAAGGTGTAAGGTAGG + Intronic
1115704219 14:35981870-35981892 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1115723627 14:36189504-36189526 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1115947658 14:38680706-38680728 TTTTGTATAAGGAGAGAGATAGG + Intergenic
1116126507 14:40795407-40795429 TAGTGATTAAGGGGTGAGGTTGG + Intergenic
1116190039 14:41653333-41653355 TTTTGTATAAGGTGTAAGGTAGG + Intronic
1116196863 14:41738316-41738338 TTTTGCATAAGGTGTGAGGAAGG - Intronic
1116736849 14:48702107-48702129 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1117617918 14:57552916-57552938 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1118814191 14:69298342-69298364 TTGTAGATAGGGAGTGGAGTGGG + Intronic
1119146930 14:72325524-72325546 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1119176488 14:72571646-72571668 TTTTGTATAAGGTGTGAGGTAGG - Intergenic
1119822419 14:77629121-77629143 TTTTGTATATGGTGTGAGGTAGG - Intergenic
1121032314 14:90669184-90669206 TTTTGTATATGGTGTGAGGTAGG - Intronic
1121205852 14:92166657-92166679 TTTTGTATATGGTGTGAGGTAGG + Exonic
1121581160 14:95032327-95032349 TTTTTGATATGGTGTGAGGTAGG + Intergenic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1122185165 14:99986874-99986896 TTTTGTATATGGTGTGAGGTAGG - Intronic
1122358749 14:101143639-101143661 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1122462136 14:101904579-101904601 TTGCAGAAAAGGAGTGAGTTAGG - Intronic
1122617057 14:103026028-103026050 TTTTGTATATGGTGTGAGGTAGG - Intronic
1124365412 15:29067671-29067693 TTGTGGAAAAGGCGAGAGGATGG - Intronic
1124458690 15:29869113-29869135 TTTGGTATAAGGAGTGAGATCGG - Intronic
1125454038 15:39839448-39839470 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1126106515 15:45150468-45150490 TTGGGGACAAGGGCTGAGGTTGG + Intronic
1126126963 15:45303398-45303420 TTTTGTATATGGTGTGAGGTAGG + Intergenic
1127171981 15:56312315-56312337 TTTTGGATAAGGTGTAAGGAAGG + Intronic
1127326481 15:57900420-57900442 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1127831334 15:62754046-62754068 TTGTAGATAATGACTCAGGTGGG + Intronic
1128233639 15:66052472-66052494 ATGTGGATCAGGATTGAGGCTGG - Intronic
1128381026 15:67112811-67112833 TTTTGTATAAGATGTGAGGTAGG + Intronic
1128726514 15:69992009-69992031 TTCTGGAAAAGGAGGGAGTTGGG + Intergenic
1128984291 15:72207908-72207930 TTGTGGATTAGAAGTGTGTTTGG - Intronic
1129223267 15:74147763-74147785 TTTTGTATAAGGAGTGAGGTGGG + Intergenic
1129526489 15:76219296-76219318 TTTTGTATATGGTGTGAGGTAGG - Intronic
1130030052 15:80305336-80305358 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1130118859 15:81029353-81029375 ATGAGGATAAGGAGTGAAGGAGG + Intronic
1130860670 15:87885689-87885711 TTTTGTATATGGTGTGAGGTAGG - Exonic
1131444692 15:92487969-92487991 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1131636342 15:94236833-94236855 TTGTAGATCAGGAGGGAGGTAGG + Intronic
1132291856 15:100709412-100709434 TATTGGAGAAGGAGTGAGGAAGG + Intergenic
1132302766 15:100786805-100786827 ATGTGGATATGGAGAGAGGGCGG + Intergenic
1132380802 15:101365117-101365139 TTTTGTATATGGTGTGAGGTAGG - Intronic
1132501675 16:287186-287208 TTGTGAATAAAGAGTGAGCTTGG + Exonic
1133086269 16:3366035-3366057 TTGGGGATGGGGAGTGGGGTGGG - Intronic
1133161493 16:3915046-3915068 TTGTGGATCAGGAGAGAGTGGGG - Intergenic
1133930004 16:10224344-10224366 TTGTGGATAAGAAGTGGTGGAGG - Intergenic
1134357042 16:13492064-13492086 TGGTGCAGGAGGAGTGAGGTGGG - Intergenic
1134783426 16:16919427-16919449 TTTTGGATAAGGAGTTGTGTGGG - Intergenic
1135271662 16:21074812-21074834 TTTGGGATAGGGTGTGAGGTAGG - Intronic
1135977703 16:27121232-27121254 TTTTGTATATGGTGTGAGGTAGG - Intergenic
1136502373 16:30678717-30678739 TTCTGAAGTAGGAGTGAGGTGGG - Intergenic
1137025846 16:35473499-35473521 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1137343045 16:47628993-47629015 TTTTGTATAAGGTGTAAGGTAGG - Intronic
1138243782 16:55450831-55450853 TTTTGTATAAGTTGTGAGGTAGG + Intronic
1138264253 16:55648544-55648566 TTTTGTATAAGGTATGAGGTAGG - Intergenic
1139592379 16:67940479-67940501 CTGTGGATATGGAGCAAGGTGGG + Intronic
1140162143 16:72507792-72507814 TTTTGTATAGGGTGTGAGGTAGG - Intergenic
1140592038 16:76365045-76365067 TTTTGCATAAGGTGTGAGGAAGG + Intronic
1141269452 16:82525637-82525659 TTGTGAATAAGGTATGGGGTTGG - Intergenic
1141497419 16:84419658-84419680 ATGTGGATGGGGAGTGGGGTCGG - Intronic
1142274517 16:89110319-89110341 TTTTGCATATGGTGTGAGGTAGG + Intronic
1143328034 17:6113318-6113340 TTTTGCATAAGGAGAGAGATAGG - Intronic
1143360887 17:6369977-6369999 TTTTGCATATGGAGTGAGGTAGG - Intergenic
1143867733 17:9936115-9936137 TTGTGTGTATGGTGTGAGGTAGG - Intronic
1144254662 17:13455219-13455241 TTTTGTATATGGTGTGAGGTAGG + Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144311401 17:14017411-14017433 GTGTCGACAAGGAGTGAGGGTGG - Intergenic
1144697019 17:17311404-17311426 TTTTGTATATGGTGTGAGGTAGG + Intronic
1145715218 17:27013116-27013138 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1145843768 17:28019395-28019417 TTCTGGCTAAGGAAAGAGGTGGG + Intergenic
1145959285 17:28877519-28877541 TTGGGTATATGGTGTGAGGTAGG + Intergenic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1147907896 17:43834575-43834597 TTTTGAATATGGTGTGAGGTAGG - Intergenic
1148201723 17:45753826-45753848 CTGTGGGTAGGGACTGAGGTGGG + Intergenic
1149147250 17:53509614-53509636 TTTTGTATATGGAGAGAGGTAGG - Intergenic
1149166742 17:53761103-53761125 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1150027720 17:61695164-61695186 TTTTGTATATGGTGTGAGGTAGG + Intronic
1150151630 17:62813962-62813984 TTTTGTATATGGTGTGAGGTAGG + Intergenic
1150718437 17:67593066-67593088 TTTTGAATATGGAGTGAGGTAGG - Intronic
1150859067 17:68782637-68782659 TTTTGTATATGGTGTGAGGTAGG + Intergenic
1151027908 17:70700894-70700916 TTTGGCATATGGAGTGAGGTAGG + Intergenic
1153434593 18:5055954-5055976 GTGTTGATAAGGGGTGAGTTAGG - Intergenic
1153974587 18:10257125-10257147 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1155436921 18:25822603-25822625 TTTTGTATATGGAGTGATGTAGG - Intergenic
1155856875 18:30845436-30845458 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156433115 18:37097244-37097266 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1157305827 18:46516936-46516958 TTGTGGATGATAAGTGAGGATGG - Intronic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1157769271 18:50331104-50331126 TTTTGTATATGGTGTGAGGTAGG + Intergenic
1157871869 18:51237381-51237403 TTTAGTATAAGGAGGGAGGTCGG - Intergenic
1158561355 18:58516472-58516494 TTGTGGAGAGGGAGAGGGGTGGG - Intronic
1159493697 18:69172577-69172599 TTTTGTATATGGTGTGAGGTAGG - Intergenic
1159681787 18:71363019-71363041 GTGTGGAAAAGGTCTGAGGTCGG - Intergenic
1160315782 18:77845123-77845145 TTTTGTATAGGGTGTGAGGTAGG + Intergenic
1160571658 18:79821601-79821623 TTGTGTATATGGGGTGGGGTAGG + Intergenic
1161629782 19:5347778-5347800 TTTTGTATATGGTGTGAGGTGGG - Intergenic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163384977 19:16994137-16994159 TTTTGTATATGGTGTGAGGTAGG - Intronic
1163734146 19:18968496-18968518 TTGTGTGTAGGGTGTGAGGTAGG - Intergenic
1164360636 19:27504386-27504408 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1165083039 19:33321795-33321817 TTTTGTATATGGTGTGAGGTAGG - Intergenic
1165706004 19:37976632-37976654 TTATGAATAAGGAGTGAGGTTGG - Intronic
1166161218 19:40954874-40954896 CTGTGGATAAGTAGTGTGCTTGG + Intergenic
1166182225 19:41117004-41117026 TTGTGGATAGGGATGAAGGTGGG - Intronic
1166204465 19:41259983-41260005 GTGGGGATAAGGCGTGGGGTGGG - Exonic
1166530342 19:43539108-43539130 TTTTGCATATGGTGTGAGGTAGG - Intergenic
1166969353 19:46553705-46553727 TTTTGTATATGGTGTGAGGTAGG + Intronic
1167107725 19:47440338-47440360 GGGTTGATTAGGAGTGAGGTGGG - Intronic
925431219 2:3795538-3795560 TTTTGTATAAGGTGTGAGGAAGG + Intronic
925471179 2:4162649-4162671 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
926044727 2:9702053-9702075 TTTTGGATATGGTGTGAGGGAGG + Intergenic
926129631 2:10294224-10294246 TTTTGTATATGGTGTGAGGTAGG + Intergenic
927264580 2:21130558-21130580 TTGTGTATATTGTGTGAGGTCGG + Intronic
927266171 2:21153644-21153666 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
927388638 2:22566738-22566760 GTGTGAATAAAGTGTGAGGTAGG - Intergenic
927695286 2:25235606-25235628 TTGTGGAAAACAAGTCAGGTGGG + Intronic
927836049 2:26400162-26400184 TTGTGGTTAAGGGGTGAGGCTGG + Intergenic
928119343 2:28571762-28571784 TTTTGTATAAAGTGTGAGGTAGG - Intronic
928262259 2:29778575-29778597 GTGTGCAGCAGGAGTGAGGTGGG + Intronic
928342645 2:30458501-30458523 TTTTGGATGAGTAGGGAGGTAGG + Intronic
928381012 2:30818638-30818660 TTTTGTATAAGGAGTAAGGAAGG - Intronic
928452581 2:31389527-31389549 TCTTGGAGAAGGAGTGATGTAGG + Intronic
929332000 2:40693369-40693391 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
929415175 2:41739901-41739923 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
929446201 2:42003274-42003296 TGGTGGAAAAGGAGCCAGGTGGG - Intergenic
930413747 2:51062546-51062568 TTTTGTATATGGTGTGAGGTAGG - Intergenic
930433673 2:51313876-51313898 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
930499943 2:52201909-52201931 TTTTGTATAAGGTGAGAGGTGGG - Intergenic
930861693 2:56080921-56080943 TTTTGAATAAGGTGTGAGGAAGG - Intergenic
931016481 2:57987026-57987048 TTTTGTATATGGTGTGAGGTAGG - Intronic
931137244 2:59416746-59416768 TTATGGATGAGGAGAGATGTGGG + Intergenic
931815343 2:65895219-65895241 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
931910752 2:66897218-66897240 TGGTGGATAAGGAGTGAGCCAGG + Intergenic
932138238 2:69250409-69250431 TTTGGTGTAAGGAGTGAGGTAGG - Intergenic
932320110 2:70815829-70815851 TTGTAGAGATGGTGTGAGGTGGG - Intronic
932947410 2:76252175-76252197 TTGTGGAAAAGAAGTTGGGTAGG - Intergenic
933093653 2:78151270-78151292 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
933118265 2:78501154-78501176 TTTTGGATAAGGTGTAAGGAAGG + Intergenic
934045138 2:88167467-88167489 TTCTGCATATGGTGTGAGGTAGG + Intergenic
934905768 2:98200842-98200864 TTTTGTATAAGGTGTGAGGCAGG + Intronic
935073024 2:99712483-99712505 TTGTGCCAAAGGAGTGAGGAAGG - Intronic
935937077 2:108197759-108197781 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
936158457 2:110065630-110065652 TTTTGTATATGGAGTGAAGTAGG + Intergenic
936186204 2:110305692-110305714 TTTTGTATATGGAGTGAAGTAGG - Intergenic
936341489 2:111637435-111637457 TTGTGTGTATGGTGTGAGGTAGG - Intergenic
936995957 2:118414530-118414552 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
937233046 2:120411880-120411902 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
937586729 2:123560731-123560753 TTTTGCATAAGGTGTGAGGAAGG + Intergenic
938827057 2:135016228-135016250 TTTTGTATATGGTGTGAGGTAGG + Intronic
938873994 2:135513795-135513817 TTTTGGATAAGGTGTAAGGAAGG + Intronic
939074447 2:137583509-137583531 TTTTGTATAAGGTGTGAGGAAGG + Intronic
939111030 2:138007743-138007765 TTTTGGAGAAGGAAGGAGGTAGG - Intronic
939647647 2:144720659-144720681 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
940603051 2:155885172-155885194 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
940703223 2:157072572-157072594 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
940814495 2:158283099-158283121 TTTTGTATAAGGTGTGAGGAAGG - Intronic
940942719 2:159580887-159580909 TTTTGTATAAGGTGTGAGGAAGG - Intronic
940964977 2:159826929-159826951 TTTTGTATAAGGTGTGAGGAAGG - Intronic
941091157 2:161177509-161177531 TGTTGTATAAGGTGTGAGGTAGG - Intronic
941124241 2:161566858-161566880 TTTTGTATAAGGAGTAAGGAAGG + Intronic
941144955 2:161833159-161833181 TCTTGGAAAATGAGTGAGGTGGG + Intronic
943324019 2:186476582-186476604 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
943453160 2:188071422-188071444 TTGTGGATAAATTGTGAGGGAGG + Intergenic
945309978 2:208300252-208300274 TTTTGGATAGGCAGTGAGGAAGG + Intronic
945388168 2:209229091-209229113 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
945397187 2:209333388-209333410 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
945479991 2:210334296-210334318 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
945714854 2:213345551-213345573 TTTTGTATAAGGTGTGAGGAAGG + Intronic
945716870 2:213367958-213367980 TTTTGTATAAGGTGTGAGGAAGG + Intronic
945781088 2:214173268-214173290 TTTTGTATAAGGTGTGAGGAAGG + Intronic
946298268 2:218804214-218804236 TTTTGTATATGGAGTGAGGTAGG + Intronic
947072344 2:226304195-226304217 TTTGTGATAAGGAGTGAGGCAGG - Intergenic
947283458 2:228482361-228482383 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
947494492 2:230624566-230624588 TTTTGGATAAGGTGTAAGGAAGG - Intergenic
947944139 2:234085359-234085381 TTGGGGATGGGGAGTGGGGTTGG - Intergenic
948645787 2:239403041-239403063 CTGTGTATAAGGAGAAAGGTGGG + Intergenic
948651417 2:239447253-239447275 TTTTGGATATGGTGTGAGGTAGG + Intergenic
948914140 2:241022396-241022418 TTTTGTATATGGTGTGAGGTAGG + Intronic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1170810120 20:19667738-19667760 TTGAGGATACGGAGTGAAATGGG - Intronic
1170909824 20:20555092-20555114 TTGTGTATATGGTGTGAGGTAGG + Intronic
1171155650 20:22870760-22870782 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1172448605 20:35006210-35006232 TTGTGGGTAGGGAGTGAGGGTGG - Intronic
1172988891 20:39017194-39017216 TTTTTGGTATGGAGTGAGGTAGG + Intronic
1173043726 20:39490011-39490033 TTTTGGCTCAAGAGTGAGGTGGG + Intergenic
1173090904 20:39970325-39970347 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1174117367 20:48236091-48236113 TTTTGAAGAAGGAGTGAGGCTGG - Intergenic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1175041398 20:56054855-56054877 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1175371443 20:58495683-58495705 TTGGGGGAAAGGGGTGAGGTGGG + Intronic
1175449843 20:59054397-59054419 TGGTGAATATGAAGTGAGGTAGG + Intergenic
1175759553 20:61551951-61551973 TTTTGTATATGGTGTGAGGTAGG - Intronic
1176881717 21:14202653-14202675 TTTTGTATAAGGGGTGAGGAAGG - Intronic
1176917911 21:14648239-14648261 TTTTGGATAAGGTGTAAGGAAGG - Intronic
1177116763 21:17095339-17095361 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1177378312 21:20303226-20303248 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1177553864 21:22664130-22664152 TTTTGTGTATGGAGTGAGGTAGG - Intergenic
1178388109 21:32172926-32172948 TTTTGGCTATGGTGTGAGGTTGG - Intergenic
1178812556 21:35897536-35897558 TTGTGTATAAGGTGTAAGGAAGG - Intronic
1178970382 21:37169963-37169985 TTTGGTATAAGGAATGAGGTAGG - Intronic
1179236713 21:39553982-39554004 CTGTGGATATGGAGTGACCTGGG - Intergenic
1179556675 21:42182987-42183009 TGGAGGGTCAGGAGTGAGGTGGG - Intergenic
1179925697 21:44533061-44533083 TTCTGGAAAAGGAGTGCGCTTGG + Intronic
1180680223 22:17620715-17620737 TTGGATATAAGGACTGAGGTAGG - Intronic
1181438951 22:22925879-22925901 ATGTGGCTAAGGAGTGAGGGAGG + Intergenic
1181994579 22:26866038-26866060 TTTTGTATATGGTGTGAGGTAGG + Intergenic
1182140956 22:27957807-27957829 TTTTGAATATGGTGTGAGGTAGG - Intergenic
1182560087 22:31152862-31152884 GTGTGGAGAGGGAGGGAGGTGGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183887835 22:40899854-40899876 TTTTAGATAAGGTGTGAAGTAGG - Intronic
1184459964 22:44631653-44631675 TTTTGTATATGGAGTGAGGTAGG - Intergenic
1185193037 22:49450871-49450893 TTTTTGATAAGGAGAGAGATAGG + Intronic
1185282335 22:49978752-49978774 TTTTGTGTAAGGAGTGAGGTAGG + Intergenic
949427490 3:3935012-3935034 TTTTGTATAAGGAGTAAGGAAGG - Intronic
949446196 3:4136441-4136463 TTTTGTATAAGGTGTGAGGAAGG - Intronic
949450457 3:4179506-4179528 TTTTGTATAAGGTGTGAGGAAGG - Intronic
949587001 3:5451113-5451135 ATGTGGATAAGGAGTGAGAGAGG + Intergenic
949593366 3:5516919-5516941 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
949846550 3:8376849-8376871 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
949980077 3:9497002-9497024 TTGAGGAAAAAGACTGAGGTAGG - Intergenic
950157287 3:10731190-10731212 TTTTGCATGTGGAGTGAGGTAGG - Intergenic
950564161 3:13755793-13755815 TTTTGTATATGGTGTGAGGTAGG + Intergenic
950955588 3:17050152-17050174 TTCTGTATAAGGAGAGAGATAGG - Intronic
951175243 3:19591434-19591456 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
951529195 3:23682861-23682883 TTTAGGACAAGGAGTGAGGTTGG + Intergenic
951628619 3:24694289-24694311 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
951672201 3:25197236-25197258 TTGTGTATAAGGTGTAAGGAAGG + Intronic
952459107 3:33505450-33505472 TTTTGTATATGGTGTGAGGTAGG - Intronic
952459223 3:33506657-33506679 TTCTGTATATGGTGTGAGGTAGG + Intronic
952582509 3:34851456-34851478 TTGTAGATAAGGGTTGAGGATGG + Intergenic
953047904 3:39312109-39312131 TTTTGCATAAGGTGTGAGGAAGG - Intergenic
953636459 3:44669520-44669542 TTGTGGATAAGGACTGAGTCAGG + Intergenic
955119113 3:56037918-56037940 TTTTGTATAAGGTGTGAGGAAGG - Intronic
955208275 3:56917193-56917215 TTGTGGGGAAGGAGTGAGCCAGG - Intronic
955561084 3:60191696-60191718 TTTGGGATAAGGTGTGAGGTAGG - Intronic
955635460 3:61023819-61023841 TTTTGTATAAGGAGTAAGGAAGG - Intronic
956215828 3:66847751-66847773 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
956920282 3:73920992-73921014 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
956985118 3:74689757-74689779 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
957020498 3:75121022-75121044 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
957141735 3:76368365-76368387 TTGTGGGTAAGGATTCAGCTGGG + Intronic
957658292 3:83111429-83111451 TTTTGGATAAGGGGTCAGGAAGG - Intergenic
958049175 3:88322346-88322368 GGGTGGATAGGGAGTGAGGTGGG - Intergenic
958094672 3:88928675-88928697 TTGTGGAAGAGGAGCAAGGTAGG - Intergenic
958112150 3:89162524-89162546 TTGAGGAGAAGGAGAGAGGTTGG - Intronic
958972247 3:100624706-100624728 TTTTGTATAAGGAGTCAGGAAGG + Intronic
959022154 3:101199338-101199360 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
959027305 3:101254962-101254984 TGGTGGAGCAGGAGGGAGGTAGG - Intronic
959147518 3:102566885-102566907 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
959246428 3:103875418-103875440 GTGTGGGTAAAGACTGAGGTGGG + Intergenic
959310881 3:104735358-104735380 TTGTAGACAAGAAGTGAAGTGGG + Intergenic
959551900 3:107669445-107669467 ATGTGGGTGGGGAGTGAGGTGGG + Intronic
959607947 3:108262511-108262533 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
959609121 3:108274634-108274656 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
959834184 3:110898972-110898994 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
960077827 3:113508103-113508125 TTTTGAATATGGTGTGAGGTAGG - Intronic
960646896 3:119895580-119895602 TTTTGTATATGGTGTGAGGTGGG + Intronic
960860880 3:122152406-122152428 TTTTGTATATGGAATGAGGTGGG + Intergenic
960878417 3:122319788-122319810 TGGTGTATATGGTGTGAGGTAGG - Intergenic
961423064 3:126822232-126822254 TTTTGTATATGGTGTGAGGTTGG + Intronic
961464010 3:127070599-127070621 TTGTGGATAAGAAGGGCTGTGGG - Intergenic
961505035 3:127364741-127364763 TTTTGTATATGGTGTGAGGTAGG + Intergenic
962660026 3:137592465-137592487 TTGTGGTCAAGGAATGAGGGAGG + Intergenic
962932886 3:140053817-140053839 TTGTGGAGATGGAGTGAGATGGG + Intronic
963032484 3:140992485-140992507 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
963189699 3:142455707-142455729 TTGTAGATATGGTGTAAGGTAGG - Intronic
963505862 3:146183712-146183734 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
964017735 3:151967738-151967760 TTTTGTATAAGGTGTGAGATGGG - Intergenic
964230230 3:154457572-154457594 TTCTGGGTGAGGAGTGAGGTGGG - Intergenic
965004668 3:163004912-163004934 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
965182940 3:165427726-165427748 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
965227392 3:166007203-166007225 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
965497825 3:169419578-169419600 TTGTGTATAAGGTGTAAGGAAGG - Intronic
966352249 3:179043543-179043565 TTTTGTATAAGGAGTAAGGAAGG - Intronic
968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG + Intronic
968544420 4:1191431-1191453 TTTTGTATATGGTGTGAGGTAGG - Intronic
968718770 4:2182638-2182660 TTTTGCATATGGTGTGAGGTAGG - Intronic
968876398 4:3269935-3269957 TTTTGGAAAATGAGGGAGGTGGG - Intronic
970175459 4:13334997-13335019 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
970394136 4:15648475-15648497 TTGTGGACAAGCACTCAGGTTGG - Intronic
970642873 4:18087088-18087110 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
971429096 4:26544996-26545018 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
971470312 4:27018026-27018048 TTGGGGGTAAGGTGTGAGGAGGG + Intronic
972372005 4:38433365-38433387 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
973273461 4:48284869-48284891 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
973935112 4:55838087-55838109 TTTTGTATATGGTGTGAGGTAGG - Intergenic
974263292 4:59552951-59552973 ATAAGGATAAGGAGTTAGGTAGG + Intergenic
974646991 4:64707354-64707376 TTTTGCATAATGTGTGAGGTAGG - Intergenic
974968404 4:68794374-68794396 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
975001969 4:69235693-69235715 TTCTGTATAAGGTGTGAGGAAGG - Intergenic
975003465 4:69256399-69256421 TTCTGTATAAGGTGTGAGGAAGG + Intergenic
975581915 4:75914829-75914851 TTGTGGAGAGGGGGTGAGGTGGG - Intronic
975637779 4:76467466-76467488 TTGTGGATAAAGAATGATTTTGG + Intronic
975898190 4:79120016-79120038 TTTTGGATAAGGTGTAAGGAAGG - Intergenic
976754764 4:88486211-88486233 TTGTGGAAAATGACTGTGGTAGG + Exonic
977180084 4:93863431-93863453 TTTTGTATAAGGTGAGAGGTGGG - Intergenic
977715117 4:100173529-100173551 TTGAGGAGAGGGAGAGAGGTGGG + Intergenic
977934853 4:102790127-102790149 TTTTGCATAAGATGTGAGGTAGG + Intergenic
977969887 4:103200950-103200972 TTGTGGCAATGGAGAGAGGTAGG + Intergenic
978257630 4:106711554-106711576 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
979081946 4:116356232-116356254 ATGTTGATAAGGAGTGACCTTGG + Intergenic
979609712 4:122676348-122676370 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
981319188 4:143371720-143371742 TTTTGTATAAGGTGTGAGGAAGG + Intronic
981618732 4:146670014-146670036 GTGTGGATTGGGAGTGGGGTGGG + Intergenic
982298298 4:153852774-153852796 TGGAAAATAAGGAGTGAGGTTGG - Intergenic
982802266 4:159720010-159720032 GTGTGGCTACGGAGTGAGGATGG + Intergenic
983089107 4:163483451-163483473 TTGAGAAGAAGGAGTGAGGAAGG + Intergenic
983105237 4:163678796-163678818 ATGTGGATAAACAGTGAGGCAGG - Intronic
984212104 4:176862419-176862441 TTTTGTATACGGAGTAAGGTAGG - Intergenic
984306584 4:177999853-177999875 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
984308058 4:178019868-178019890 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
984709996 4:182876798-182876820 TTGTAGATTCAGAGTGAGGTGGG + Intergenic
985814273 5:2115034-2115056 TCTTGGATAAGGGGAGAGGTTGG - Intergenic
986198951 5:5563501-5563523 TTTTGTATACGGAGTGAAGTAGG - Intergenic
986375454 5:7126448-7126470 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
986380097 5:7175520-7175542 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
986765730 5:10924317-10924339 ATGTGGAGCAGGAGTGAGGAGGG - Intergenic
987140023 5:14936090-14936112 TTTTGATTATGGAGTGAGGTGGG + Intergenic
987610149 5:20192521-20192543 TTTTGAATAAGGAGTAAGGAAGG + Intronic
988293102 5:29316417-29316439 TTTTGTATAAGGTGTGAGGACGG + Intergenic
988721896 5:33887443-33887465 TTGTCAATAAGGTGTGGGGTTGG + Intronic
988975618 5:36512999-36513021 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
989305853 5:39954972-39954994 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
989431633 5:41361633-41361655 ATTTGGAGAATGAGTGAGGTAGG - Intronic
989830148 5:45906586-45906608 TTGTGTATATGGTGTGAGGCTGG - Intergenic
992028959 5:72701547-72701569 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
992032165 5:72732558-72732580 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
993097856 5:83501471-83501493 TTTTGTATATGGTGTGAGGTTGG + Intronic
993892785 5:93493813-93493835 CTTTTAATAAGGAGTGAGGTAGG - Intergenic
994113841 5:96039543-96039565 TTTTGCATAAGGTGTGAGGAAGG + Intergenic
994508400 5:100671836-100671858 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
994917597 5:106000229-106000251 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
995112525 5:108443465-108443487 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
996673712 5:126150972-126150994 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
997895601 5:137713501-137713523 TTTTGTATATGGTGTGAGGTAGG - Intronic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998580393 5:143368209-143368231 TTGTGTATATGGTGTGAAGTAGG - Intronic
998700610 5:144694730-144694752 TTTTGTATATGGTGTGAGGTAGG - Intergenic
998780925 5:145655720-145655742 TTTTGTATAAGGTGTGAGGAAGG - Intronic
999726392 5:154441869-154441891 ATGTGGGGAAGGGGTGAGGTGGG - Intergenic
999985518 5:157001129-157001151 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1000045076 5:157515819-157515841 GTGGGGATAAAGAGTAAGGTGGG - Intronic
1000057706 5:157622423-157622445 TTTTGGATAAGGTGTAAGGAGGG - Intergenic
1000424625 5:161076182-161076204 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1000449059 5:161361946-161361968 TTTTGCATAAGGTGTAAGGTAGG + Intronic
1001259018 5:170210474-170210496 TTTTGTATATGGTGTGAGGTTGG + Intergenic
1001345932 5:170898690-170898712 TTTTGTATAAGGTGTCAGGTAGG + Intronic
1001567811 5:172711881-172711903 TTGTGGACAAGGATTCTGGTGGG - Intergenic
1001839260 5:174860013-174860035 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1001854247 5:174996947-174996969 TTGAGGATCAGCAGTGAGGAGGG + Intergenic
1002647827 5:180669909-180669931 TTGTGGGGATGGAATGAGGTTGG - Intergenic
1002686308 5:181013472-181013494 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1002792607 6:447065-447087 TTGTGTTTATGAAGTGAGGTGGG + Intergenic
1002851853 6:1003643-1003665 GTGTGGATGTGGAGAGAGGTGGG - Intergenic
1003161546 6:3638881-3638903 TTGTGTGTATGGTGTGAGGTAGG - Intergenic
1004353739 6:14913326-14913348 TTTGGAAAAAGGAGTGAGGTAGG + Intergenic
1004730628 6:18354954-18354976 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1005249284 6:23926417-23926439 TTTTGGAGAAGGGGTGAGGGAGG + Intergenic
1005564950 6:27081953-27081975 TTCTGGAAAAGAAGTGAGATTGG + Intergenic
1006078992 6:31553399-31553421 TTTTTGATTAGGTGTGAGGTGGG - Intronic
1006160318 6:32037176-32037198 TTGTGGGTAAGGAGGCAGTTTGG - Intergenic
1006299469 6:33185934-33185956 TTGAGGGTCAGGAGGGAGGTGGG + Intronic
1006684023 6:35816969-35816991 TTTTGTATATGGTGTGAGGTAGG - Intronic
1006795995 6:36732772-36732794 GTGGGGAAAGGGAGTGAGGTTGG - Exonic
1007869501 6:45017516-45017538 TTTTGTATAAGGAGTAAGGAAGG + Intronic
1007948526 6:45848291-45848313 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1008248004 6:49203028-49203050 TTGAGGAGAAAGAGTGAGGTAGG - Intergenic
1008386250 6:50894386-50894408 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1008393735 6:50982762-50982784 TTTGGAATAAGAAGTGAGGTAGG + Intergenic
1008707192 6:54177022-54177044 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1009037133 6:58131147-58131169 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1009212933 6:60884755-60884777 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1009362372 6:62830199-62830221 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1009577761 6:65488947-65488969 TTTTGTATAAGGAGTAAGGAAGG - Intronic
1010667233 6:78644866-78644888 TTTTGCATAAGGAGTAAGGAAGG + Intergenic
1011393647 6:86882103-86882125 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1011483303 6:87816569-87816591 TTGTGGATAGGAGGTGAAGTGGG + Intergenic
1011523887 6:88241645-88241667 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1012106995 6:95174887-95174909 TTATGGATAAGGATTAGGGTTGG + Intergenic
1012513500 6:100031567-100031589 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1012750002 6:103147852-103147874 TTGGGGATAAGGATGGGGGTTGG + Intergenic
1013701538 6:112776289-112776311 TTTTGGATAAGGTGTAAGGAAGG - Intergenic
1013738505 6:113255938-113255960 TTTTGTATAAGGTCTGAGGTAGG - Intergenic
1013905442 6:115211569-115211591 TTTTGTATATGGTGTGAGGTAGG - Intergenic
1014423389 6:121272077-121272099 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1014890465 6:126837974-126837996 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1014952772 6:127577634-127577656 TTGTGGATAAGGAGAAGGATAGG - Intronic
1015109359 6:129573933-129573955 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
1015247516 6:131091288-131091310 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1015358626 6:132309823-132309845 TTGTGTATAAGGTGTAAGGAAGG - Intronic
1016061024 6:139630377-139630399 TTTTGTATATGGAGAGAGGTAGG + Intergenic
1016395164 6:143616736-143616758 ATTTGGATAAGGAATGAGGTTGG + Intronic
1016397108 6:143636319-143636341 TTTTACATAAGGGGTGAGGTTGG + Intronic
1018113629 6:160561237-160561259 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1018942927 6:168321491-168321513 TTCTGTATATGGTGTGAGGTAGG + Intergenic
1019057838 6:169235937-169235959 GTGTGGATGGGGAGTGAGTTTGG - Intronic
1019703202 7:2484447-2484469 TTATGGATGAGGAGTAAGGGCGG - Intergenic
1020024654 7:4890561-4890583 TTGTGGATAAATTGTGAGGGAGG - Intergenic
1020065788 7:5187596-5187618 TTTTGAATATGGTGTGAGGTAGG + Intergenic
1020441910 7:8226245-8226267 TGGTGGATGAGGAGTGGGGAAGG - Intronic
1020507389 7:9009338-9009360 TTTTGTATATGGTGTGAGGTAGG + Intergenic
1020751156 7:12143912-12143934 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1020843707 7:13255845-13255867 CTGGGGTTAAGGAGTAAGGTGGG + Intergenic
1022737257 7:33087973-33087995 TTATGGAAAAGGAGTCAGGCTGG - Intergenic
1022822390 7:33974223-33974245 TTGGGGATGTGGAGTGAGATTGG + Intronic
1022997004 7:35767063-35767085 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1023243274 7:38172748-38172770 TTTTGTAAATGGAGTGAGGTAGG + Intergenic
1023413149 7:39908092-39908114 TTGTGTATAGGGTGGGAGGTGGG - Intergenic
1023924943 7:44661356-44661378 TTGTGGATAAGCATATAGGTGGG + Intronic
1024199590 7:47092017-47092039 TTTTGTATATGGAGAGAGGTGGG - Intergenic
1024337719 7:48226075-48226097 CTGTAGAAAAGGAGTGGGGTTGG + Intronic
1025183693 7:56839580-56839602 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1025688232 7:63737407-63737429 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1026252049 7:68679621-68679643 TTTTGGCTAAGGAGTGAGCAGGG - Intergenic
1026488601 7:70843128-70843150 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1026733728 7:72934651-72934673 TTTTGTATATGGTGTGAGGTTGG + Intronic
1026784009 7:73289204-73289226 TTTTGTATATGGTGTGAGGTTGG + Intergenic
1026887173 7:73957705-73957727 TTTTGTATATGGAATGAGGTAGG + Intergenic
1027910289 7:84241798-84241820 TTTTGTATAAGGTGTAAGGTAGG + Intronic
1028139612 7:87258997-87259019 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1028181132 7:87726262-87726284 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1028557526 7:92139662-92139684 TTTTGTATATGGTGTGAGGTAGG + Intronic
1028785292 7:94785759-94785781 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1028815774 7:95142522-95142544 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1028836864 7:95384174-95384196 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1028837194 7:95387953-95387975 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1028967046 7:96813846-96813868 TTTTAGATAAGGTGTGAGGAAGG - Intergenic
1029009203 7:97240977-97240999 TTTTGAATAAGGTGTGAGGAAGG - Intergenic
1029106447 7:98180606-98180628 TTGTGGAGAAGTAGAGAGTTTGG + Intronic
1029304861 7:99611639-99611661 TTATGGAAAAGGAGTCAGGTTGG - Intergenic
1029674061 7:102054328-102054350 TTTTGCATATGGTGTGAGGTAGG + Intronic
1030443179 7:109614700-109614722 CTGTGGTTAAGGAATGAGTTGGG + Intergenic
1030922481 7:115408974-115408996 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1031246398 7:119318103-119318125 TTGTGTATAAGGTGTAAGGCAGG - Intergenic
1031438352 7:121761130-121761152 TTTTATATAAGGCGTGAGGTGGG - Intergenic
1031664113 7:124463896-124463918 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1031666887 7:124495675-124495697 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1031818603 7:126471361-126471383 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1031899978 7:127397992-127398014 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1031905479 7:127455910-127455932 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1031908698 7:127490210-127490232 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1032326806 7:130936517-130936539 TTGTGGTCCAGGAGGGAGGTGGG - Intergenic
1032429409 7:131848769-131848791 TTCTGGATAGGGAGGGACGTTGG - Intergenic
1032704205 7:134408090-134408112 AAGTGGATAAGGAGGTAGGTAGG + Intergenic
1033964040 7:146951465-146951487 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1034109043 7:148518542-148518564 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1034743498 7:153500548-153500570 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1035017243 7:155777389-155777411 TTGTGGGTATTGAGTGAGGTCGG - Exonic
1036037870 8:5040218-5040240 TTATGGATGCAGAGTGAGGTAGG + Intergenic
1036589277 8:10153263-10153285 ATGTGGATGAGGCATGAGGTGGG + Intronic
1037207137 8:16336799-16336821 TTTTGTATAAGGTGTGAGGACGG + Intronic
1037257826 8:16975027-16975049 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1037626601 8:20612987-20613009 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1038232931 8:25721689-25721711 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1038829253 8:31038745-31038767 TTTTGTATATGGTGTGAGGTAGG + Intronic
1039084413 8:33765718-33765740 TTTTGTATATGGTGTGAGGTAGG - Intergenic
1039138789 8:34358994-34359016 TTGTGGATGAACAGTGTGGTTGG + Intergenic
1039149139 8:34483780-34483802 TTGTGGGTCAGGTGTGAAGTGGG - Intergenic
1040364416 8:46700436-46700458 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1040428419 8:47312892-47312914 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1040458734 8:47626208-47626230 TTGTGTATAAGGTGTAAGGAAGG - Intronic
1040587536 8:48757548-48757570 CTGTAGGTAAGGAGTGGGGTAGG + Intergenic
1040752593 8:50728644-50728666 GTGTGCATGAGGAGTCAGGTTGG + Intronic
1040993164 8:53373959-53373981 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
1041041398 8:53849881-53849903 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1041129534 8:54682969-54682991 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1041665013 8:60435047-60435069 TTTTGTATAAGGTGAGAGGTAGG + Intergenic
1041844939 8:62317446-62317468 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1044179145 8:89167037-89167059 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1044255022 8:90049997-90050019 TTTTGTATAAGGAGTAAGGAAGG - Intronic
1044283222 8:90380388-90380410 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1045308017 8:100975496-100975518 TTGCAGGTAAGGAGTGTGGTTGG - Intergenic
1045609855 8:103826395-103826417 TTGTGTATATAGTGTGAGGTAGG + Intronic
1045802565 8:106118251-106118273 TTTTGTATAAGGAGTAAGGATGG - Intergenic
1045900657 8:107275594-107275616 TGATGGATATGGAGTGGGGTCGG - Intronic
1046434329 8:114167572-114167594 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1046813066 8:118553502-118553524 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1046975759 8:120275311-120275333 TTTTGTATAAGGTGAGAGGTAGG - Intronic
1048297649 8:133226377-133226399 TAGGGGATGAGGAGTGATGTTGG - Intronic
1048625039 8:136175889-136175911 CTGGGGATCAGAAGTGAGGTTGG + Intergenic
1048748504 8:137643585-137643607 ATGTTGAAAAGGAGTGAGGAAGG + Intergenic
1049966137 9:781848-781870 TTTTGTATAAGGTGAGAGGTAGG - Intergenic
1050037431 9:1451950-1451972 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1050430015 9:5552822-5552844 TTGTGGATAGGTAGGGAAGTGGG - Intronic
1051492804 9:17685618-17685640 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1051578500 9:18645559-18645581 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1052443132 9:28524242-28524264 TTGTGTGTATGGTGTGAGGTAGG - Intronic
1052604335 9:30679979-30680001 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1052735556 9:32338861-32338883 TTTTGTAGATGGAGTGAGGTAGG - Intergenic
1052897803 9:33764211-33764233 TTTTGTATATGGTGTGAGGTAGG - Intronic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1053322221 9:37109255-37109277 CTTTGTATATGGAGTGAGGTAGG - Intergenic
1053591674 9:39520922-39520944 TTGTGGAGAAGCGATGAGGTGGG - Intergenic
1053715049 9:40878739-40878761 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1053751330 9:41259280-41259302 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1054256852 9:62823609-62823631 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1054284590 9:63156256-63156278 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1054318786 9:63631138-63631160 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1054334454 9:63792004-63792026 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1054334773 9:63796340-63796362 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1054390226 9:64608698-64608720 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1054736205 9:68753048-68753070 TTTTGTATAAGGTGAGAGGTAGG + Intronic
1054981065 9:71206756-71206778 TTTTGCATAAGGAGTAAGGAAGG + Intronic
1055072197 9:72178146-72178168 TTTGGAATAAGGAGTGTGGTTGG + Intronic
1055150679 9:72995260-72995282 TTGAGGAGAAGGAGAGAGATGGG - Intronic
1055774617 9:79753909-79753931 GTGTGGGTATGGGGTGAGGTCGG + Intergenic
1056229771 9:84531309-84531331 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1056401774 9:86234533-86234555 TTTTGTGTAAGGATTGAGGTAGG - Intronic
1056639603 9:88359247-88359269 TTGGGGACAACGAGAGAGGTAGG - Intergenic
1057218082 9:93240498-93240520 CTGTGGATGAGGAGTGGGTTGGG + Intronic
1057965965 9:99503572-99503594 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1057986528 9:99721211-99721233 TTTTGGATGTGGTGTGAGGTAGG - Intergenic
1058213758 9:102205975-102205997 ATGTGGAAAAGGAATGAGATTGG - Intergenic
1058823008 9:108749682-108749704 TAGTGGAAAGGGAGTGAGCTGGG + Intergenic
1058973020 9:110100498-110100520 TTGTGTACATGGGGTGAGGTAGG + Intronic
1059161241 9:112036896-112036918 TTTAGGATAGGGAGTGAGGCAGG - Intergenic
1059493302 9:114687987-114688009 TTTTGTATATGGTGTGAGGTGGG + Intergenic
1060020123 9:120122678-120122700 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1060165289 9:121408683-121408705 TTGTGGATAAATTGTGAGGGAGG - Intergenic
1061624731 9:131835036-131835058 TTGTGCAGGAGGAGCGAGGTGGG - Intergenic
1062705373 9:137936650-137936672 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1185742836 X:2547587-2547609 TTGTGGGTAAGGAGCAGGGTAGG - Intergenic
1186061633 X:5714461-5714483 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187068121 X:15860970-15860992 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1187122812 X:16425600-16425622 TTGTGGTTCAGGAATGGGGTTGG - Intergenic
1187302919 X:18068700-18068722 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1187459091 X:19469370-19469392 TTGTGTATAAGGTGTAAGGAAGG - Intronic
1187647108 X:21359222-21359244 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1187848054 X:23561822-23561844 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1188310485 X:28611113-28611135 TTGTGGAGAAGGGAAGAGGTTGG + Intronic
1188659065 X:32735736-32735758 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1188704078 X:33304386-33304408 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1188848729 X:35105802-35105824 TTTTGTATAAGGTGTAAGGTAGG - Intergenic
1189862256 X:45285539-45285561 TTTTGTATATGGTGTGAGGTAGG + Intergenic
1190415356 X:50175391-50175413 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1190715666 X:53101098-53101120 TTGTGGATATGGAGAAAGTTTGG - Intergenic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1191800836 X:65077479-65077501 TTGTGGATCAGGAGTTAAGATGG + Intergenic
1191898662 X:66019397-66019419 ATGTGGAAAAGGGGAGAGGTAGG - Intergenic
1192025807 X:67450230-67450252 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1192666463 X:73092972-73092994 TTGTGTATAAGGTGAGAGATAGG + Intergenic
1192678190 X:73222381-73222403 TTTTGTATAAGGAGTAAGGAAGG + Intergenic
1193044670 X:77039561-77039583 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1193438375 X:81508762-81508784 TTTTGTATAAGGAGTAAGGAAGG - Intergenic
1193859787 X:86651213-86651235 TTGTGGGGCAGGAGAGAGGTGGG + Intronic
1193875319 X:86855510-86855532 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1194228739 X:91295663-91295685 TTTTGTATAAGGTGTAAGGTAGG + Intergenic
1194418677 X:93645593-93645615 TTTTGCATAAGGTGTGAGGAAGG + Intergenic
1194539927 X:95157260-95157282 TTGGTGATAAGGAGGGCGGTTGG - Intergenic
1194607676 X:96001712-96001734 TTTTGGAGAAGCAGTGAGATAGG - Intergenic
1195549638 X:106152985-106153007 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1195794584 X:108630825-108630847 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1195895993 X:109746804-109746826 TTTTGCAAAAGGAGTGGGGTGGG - Intergenic
1196031303 X:111097277-111097299 TGGTGGTTAAGGGGTGGGGTGGG + Intronic
1196293286 X:113968735-113968757 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1196410279 X:115411285-115411307 TTGTGGTTAGGGAGGGAGGGAGG + Intergenic
1196597908 X:117566291-117566313 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1196624820 X:117866360-117866382 TTGGGGATAAGGGATGATGTTGG - Intergenic
1197131530 X:123010814-123010836 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1197284501 X:124580551-124580573 TAGTGGTTATGGAGTGGGGTTGG + Intronic
1198171550 X:134110800-134110822 TTGTGGAGATGAAGAGAGGTTGG - Intergenic
1198337726 X:135683605-135683627 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1198784781 X:140274858-140274880 TTGGTGTTAAGTAGTGAGGTGGG - Intergenic
1199302461 X:146229101-146229123 TTTTGTATAAGGTGTGAGGGAGG + Intergenic
1199800389 X:151245491-151245513 TTTTGCATAATGAGTGAAGTAGG + Intergenic
1199825837 X:151498419-151498441 GTGTGGACAGGGAGGGAGGTGGG + Intergenic
1200054658 X:153453742-153453764 TTTTGCATATGGAGTGAGGTGGG - Intronic
1201502443 Y:14659811-14659833 TTGTGCATAGGGAGTGAGGGCGG + Intronic
1201959398 Y:19662039-19662061 TTTTGCATAAGGTGTGAGGAAGG - Intergenic