ID: 968466713

View in Genome Browser
Species Human (GRCh38)
Location 4:755312-755334
Sequence ACACCCCACACACAGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 2, 2: 5, 3: 33, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968466713_968466716 2 Left 968466713 4:755312-755334 CCAGTCTCCTGTGTGTGGGGTGT 0: 1
1: 2
2: 5
3: 33
4: 234
Right 968466716 4:755337-755359 AGCGACTCATCGCACGTCTCTGG No data
968466713_968466717 3 Left 968466713 4:755312-755334 CCAGTCTCCTGTGTGTGGGGTGT 0: 1
1: 2
2: 5
3: 33
4: 234
Right 968466717 4:755338-755360 GCGACTCATCGCACGTCTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968466713 Original CRISPR ACACCCCACACACAGGAGAC TGG (reversed) Intronic
900407328 1:2498414-2498436 CCAGCCCCCACATAGGAGACTGG - Intronic
900499480 1:2994236-2994258 ACACCCAACACACAGCAGTGGGG - Intergenic
900624535 1:3602220-3602242 ACACCCCTCACAAAGGACTCAGG + Intronic
901320138 1:8334971-8334993 ACCCCCACCACACAGAAGACAGG - Intronic
902509427 1:16958057-16958079 ACAGCCCACACACACCAGACTGG - Intronic
902808085 1:18873129-18873151 GCTCCCCACAGACTGGAGACTGG - Intronic
905734214 1:40315011-40315033 ACCCCCCAAACACAGGATGCTGG - Intronic
907472180 1:54681010-54681032 ACATCCGTCACACAGGATACAGG + Intronic
911288664 1:96028639-96028661 AAACCCCGAACACAGGAGACTGG - Intergenic
912871189 1:113308431-113308453 ACTCCCCATACACAGGCGTCTGG + Intergenic
916195085 1:162215169-162215191 CATCACCACACACAGGAGACAGG - Intronic
920035500 1:203062608-203062630 AAACCCCACCAGCAGGAGACTGG + Intronic
921594562 1:217040009-217040031 ACACACCACACACAAGAGCAGGG + Intronic
923727984 1:236523864-236523886 ACGCCCCAGACACAGAAGGCGGG + Intronic
924770895 1:247078600-247078622 GGACCCCAGACACCGGAGACTGG - Exonic
1063366399 10:5493497-5493519 ACGCCCACCGCACAGGAGACTGG + Intergenic
1067683293 10:48453473-48453495 CCAGGCCGCACACAGGAGACTGG - Intronic
1067765366 10:49081777-49081799 GCTCCCCACACACACAAGACCGG + Intronic
1068613542 10:59087190-59087212 ACACCTACCACAAAGGAGACTGG - Intergenic
1068633664 10:59324524-59324546 ACACCCCACACACATGAGATTGG + Intronic
1072032638 10:91536322-91536344 CCACCCCACACTGAGGAGCCAGG - Intergenic
1072611951 10:97023359-97023381 ACACCACACAAAAAGGAGCCAGG - Intronic
1073050262 10:100662491-100662513 ACATACCACACACAGGCGACAGG - Intergenic
1073465272 10:103691624-103691646 ACACCCCAGACCCAGGTGATAGG + Intronic
1074330761 10:112506415-112506437 ACATCCCCCACAGATGAGACGGG + Intronic
1076130766 10:128012196-128012218 AGAGCCCCAACACAGGAGACAGG - Intronic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1077106512 11:844660-844682 ACACTCCACACCCAGGAGAGAGG - Intronic
1077258917 11:1604983-1605005 ACACCCCAGGCACAGGGGACAGG - Intergenic
1077274098 11:1695368-1695390 CCACCCCACACACAGGACAATGG - Intergenic
1077670977 11:4157353-4157375 AGGCCCCACACACAGGACTCAGG - Intergenic
1078172010 11:8935333-8935355 ATAACCCAGACACAGGTGACGGG + Intergenic
1079386307 11:19983164-19983186 ACAGCCCCCATAAAGGAGACTGG - Intronic
1079747309 11:24149940-24149962 TCAGCCCACACACATGAGAAAGG - Intergenic
1080386178 11:31812385-31812407 ACGCACCACACACAGATGACCGG - Intronic
1085513943 11:77101701-77101723 ACACGCCACACACAGAAAAGAGG - Intronic
1085732488 11:79011539-79011561 ACATCCCACACTCAGGAACCTGG - Intronic
1086931183 11:92694820-92694842 GGAGCCCACACACAGGAGAGGGG + Intronic
1086992346 11:93317876-93317898 TCAGCCCACACTCAGGAGATGGG - Intergenic
1088886930 11:114015136-114015158 AAACGCCCCACAAAGGAGACTGG + Intergenic
1090067748 11:123518105-123518127 AAACCCCACAACCAGGAGAGGGG - Intergenic
1094360008 12:29620400-29620422 ACCCCCAACACAGAGGGGACTGG + Intronic
1096965373 12:55622935-55622957 ACACACTACACACAGGCTACAGG + Intergenic
1097185025 12:57192157-57192179 ACACCCCACACACACTTGCCTGG + Intronic
1097625614 12:61996544-61996566 ACACCTGAGACACAGAAGACTGG - Intronic
1098209482 12:68148686-68148708 ACAGCCCTCTCACAGGAGTCTGG + Intergenic
1098271796 12:68776739-68776761 ACACCCCACTCTCTGGAGTCTGG - Exonic
1098783347 12:74717072-74717094 ACAGCCCATACAGAGAAGACAGG + Intergenic
1100870814 12:98908148-98908170 ACTCCCAACCCACAGCAGACAGG - Intronic
1101614800 12:106325910-106325932 AAAACCCACACACACCAGACTGG + Intronic
1101792641 12:107941847-107941869 ACAGGCCACACAGAGAAGACTGG + Intergenic
1102025653 12:109713043-109713065 ACCCCACGCCCACAGGAGACAGG - Intergenic
1102172884 12:110855467-110855489 GCACCCCACACACAGGCTTCTGG + Intronic
1102217963 12:111175022-111175044 CCCCCCCACACACAGAAGAGGGG + Intronic
1104232644 12:126900115-126900137 AGACCCTCCTCACAGGAGACCGG - Intergenic
1105845046 13:24286740-24286762 GCAACCCACATACAGGGGACAGG - Intronic
1106702604 13:32246052-32246074 TCACTTCACTCACAGGAGACAGG + Intronic
1107477263 13:40750358-40750380 ACACCCCACACACAGTATGTAGG - Intronic
1107615131 13:42158960-42158982 ACAACACACACATAGGAGAGAGG - Intronic
1107817810 13:44259861-44259883 AGACACCACACACAGCAGCCAGG + Intergenic
1109866580 13:68272589-68272611 ATGCCCCACAGACAGAAGACAGG - Intergenic
1112432718 13:99366274-99366296 ACACAAAACACACAAGAGACTGG - Intronic
1113035205 13:106040475-106040497 AGATCCCACGCTCAGGAGACAGG + Intergenic
1113213978 13:108016869-108016891 ACAAGCCACACCCAGGAGGCAGG - Intergenic
1115951865 14:38730538-38730560 ACATCACACACACAGGTGATGGG + Intergenic
1117021566 14:51576091-51576113 GCACCCGACACCCAGGAGAGTGG + Intronic
1118168393 14:63360420-63360442 ACAGGCCACACTCAGGAGAGAGG - Intergenic
1119636051 14:76274317-76274339 ACAGCCCACACACAGGGAGCGGG - Intergenic
1120252444 14:82075323-82075345 ACACCTCACACACAGGACAGTGG - Intergenic
1120885343 14:89447629-89447651 ACACCCCATGCCTAGGAGACCGG + Intronic
1121257732 14:92543570-92543592 ACACCCCACACCCTGGAAACTGG + Intronic
1121266312 14:92604558-92604580 ACACCACCCCTACAGGAGACAGG - Intronic
1123477239 15:20598626-20598648 TCACCCCACACAGAGGAGCCTGG + Intergenic
1123640774 15:22401738-22401760 TCACCCCACACAGAGGAGCCTGG - Intergenic
1125920721 15:43524039-43524061 GCTCCCCAGACAGAGGAGACAGG + Exonic
1126829419 15:52584771-52584793 ACATCCGACACACAGAAGAACGG - Exonic
1127187596 15:56495276-56495298 ACACCCTACACTCAGCACACAGG + Intergenic
1128345028 15:66848174-66848196 ATACCCCAGACCCATGAGACGGG + Intergenic
1128542642 15:68546483-68546505 AAAACCCACACACAGTAGCCAGG - Intergenic
1131010375 15:89012465-89012487 GCACACCAAACAAAGGAGACAGG - Intergenic
1132408052 15:101556529-101556551 GTACCTCACGCACAGGAGACCGG - Intergenic
1132628254 16:902647-902669 TCACCCCACACAGCAGAGACAGG - Intronic
1135171536 16:20188411-20188433 CCTCCCCAGACACAGGAGCCTGG - Intergenic
1135735332 16:24926861-24926883 AGGACCCAAACACAGGAGACTGG - Intronic
1136070596 16:27784799-27784821 AATCCCCACACGGAGGAGACTGG + Intergenic
1136266338 16:29121651-29121673 ACATCCAAGACACAGGACACAGG + Intergenic
1139759900 16:69176465-69176487 ACACCACACACACAATAGAGTGG + Intronic
1140313881 16:73874167-73874189 ACTCCCCACACACTTGATACTGG - Intergenic
1140580368 16:76224151-76224173 CCACACCACCCACAGAAGACAGG + Intergenic
1141541322 16:84724719-84724741 ACACAACACACACAGGGGTCAGG - Intronic
1141900416 16:86987108-86987130 ACACGGCACACACAGGAGACAGG - Intergenic
1142672549 17:1493754-1493776 ACCCCTCCCACACAGGAGGCTGG + Intergenic
1143515651 17:7418041-7418063 ACATTCCACACACCGAAGACTGG - Exonic
1143708461 17:8717014-8717036 CCACCCCACACTCAGGAGGAAGG + Intergenic
1146376684 17:32299268-32299290 CCACCCCACCCACACGAGGCTGG + Intronic
1148512375 17:48182770-48182792 CCAACCCACACACATGAAACGGG + Intronic
1149291874 17:55225431-55225453 ACACCGCACACAGAGGGCACAGG - Intergenic
1151461423 17:74256404-74256426 ACATCCCACACGCAGAGGACAGG - Intronic
1151756187 17:76076496-76076518 ACACCGCACACAGAGGAGGTGGG - Intronic
1152130373 17:78472616-78472638 ACACCCCACACACAGCCCCCGGG - Intronic
1153903202 18:9637155-9637177 ACACCCCAGGCACAGGCTACGGG - Intergenic
1155073039 18:22332867-22332889 CCAGCCCACACTCAGGAGAGGGG - Intergenic
1157730969 18:50003951-50003973 ACACAGCACACACAGGATGCTGG + Intronic
1157785095 18:50474436-50474458 ACACCCCACACCAAAGAGCCAGG - Intergenic
1158228886 18:55231263-55231285 ACACCTTACACAAAGGAGACTGG + Intronic
1160241252 18:77124644-77124666 AGAGCCCACCCACAGGAGATAGG + Intronic
1161379693 19:3958555-3958577 GCACCCCACACCCGGGGGACCGG + Exonic
1161725893 19:5928569-5928591 ACACACCACACACACGGGACTGG - Intronic
1161805602 19:6441477-6441499 ACACCCCAACCACAGGAGCACGG - Exonic
1162609394 19:11737967-11737989 AAAGCCCACACACACGAGTCTGG + Intronic
1162747360 19:12806270-12806292 TCACCCCACTCCCAGGACACGGG - Intronic
1163637207 19:18442623-18442645 ACACACCACACACACCAGCCAGG + Intergenic
1163699893 19:18781812-18781834 GCACCCCACCCCCAGGAGCCAGG + Exonic
1164310221 19:24039369-24039391 ACAACTCACACATAGGAGATGGG - Intronic
1164523086 19:28993732-28993754 ATACACCAAACAAAGGAGACAGG - Intergenic
1164588341 19:29491719-29491741 ACAGCCAACACACAGCAGCCAGG + Intergenic
1165151296 19:33761989-33762011 ACATCACACACACAGGAAGCAGG + Intronic
1166934168 19:46321054-46321076 CCACCCCACACCCAGGAGCATGG - Intronic
1168543755 19:57233299-57233321 ACACCCCACACACCAGTAACTGG + Intronic
925234845 2:2269053-2269075 GCACCCCACACACAGGAGACTGG - Intronic
925911157 2:8574445-8574467 ACCCCAGACACACAGGAGGCAGG + Intergenic
928166076 2:28973102-28973124 ACAGCCCACACAGAGGAAAGAGG - Intronic
928819458 2:35343019-35343041 ATACCCAACAGCCAGGAGACAGG + Intergenic
929810964 2:45188953-45188975 ACACCCCACACACACCCCACAGG + Intergenic
930118959 2:47744246-47744268 ACACACCACACACAAGAACCTGG + Intronic
935054042 2:99550232-99550254 ATACCAGACACACAGGACACAGG + Intronic
936758074 2:115738351-115738373 ACACCCCACAGATAGTACACAGG - Intronic
937470528 2:122170341-122170363 ACCCCCAACACACAGGGCACTGG - Intergenic
938216509 2:129522395-129522417 AAACCCCACCCACAGGGGAAAGG - Intergenic
941193705 2:162419778-162419800 TCACATCACACACAGGAGCCTGG - Intronic
943677627 2:190731682-190731704 TCAACCCACACACAGGAGCACGG - Intergenic
944984552 2:205160462-205160484 TCACCCCACACATAGGCCACTGG + Intronic
945304765 2:208248803-208248825 ACACCCTAAACACAGAAGATGGG + Intronic
946353006 2:219168013-219168035 ACAATCCACACACAGGCCACTGG + Exonic
946488414 2:220123771-220123793 ACACTGTACACACAGGTGACAGG - Intergenic
947201620 2:227619312-227619334 AAACCTCACACACAGGAGAAAGG - Intronic
948130625 2:235597949-235597971 ACGCTCCACACAAAGGAAACGGG - Intronic
948973210 2:241445310-241445332 ACAACCCACTCACAAGAGAAAGG - Intronic
949008658 2:241666101-241666123 ACTCCCCACTCAGAGGAGCCAGG - Intronic
949055876 2:241928074-241928096 CCACCCCACTCACAGCAGAGGGG + Intergenic
949056163 2:241929134-241929156 CCACCCCACTCACAGGAGAGGGG + Intergenic
949056210 2:241929311-241929333 CCACCCCACTCACAGCAGAGGGG + Intergenic
949056257 2:241929485-241929507 CCACCCCACTCACAGCAGAGGGG + Intergenic
949056288 2:241929602-241929624 CCACCCCACTTACAGGAGAAAGG + Intergenic
1170046509 20:12091064-12091086 ACACCCAACACACAGCAGCTTGG - Intergenic
1175878442 20:62242643-62242665 ACACCTTACACCCAGGAGAGAGG - Intronic
1176218743 20:63960091-63960113 ACCTCCCAAACACAGGAGCCAGG - Exonic
1176284706 21:5013254-5013276 ACACCTCAGCCACAGGAGACAGG + Intergenic
1176845999 21:13877154-13877176 ACAAGACACACACAGGAGAGAGG + Intergenic
1176848734 21:13896698-13896720 ACAAGACACACACAGGAGAGAGG + Intergenic
1179016328 21:37596955-37596977 ATACACCAAACAAAGGAGACGGG - Intergenic
1179109908 21:38437572-38437594 TCACCCCAGACACTGGGGACAGG - Intronic
1179276861 21:39899738-39899760 CCAACTCACACACAGGAGACAGG - Intronic
1179872475 21:44250221-44250243 ACACCTCAGCCACAGGAGACAGG - Intronic
1180857474 22:19057614-19057636 CCACCCAACACCCAGGAGAAAGG + Intronic
1180915335 22:19482101-19482123 ACACCCCACAGAGAGGGGATGGG + Intronic
1180972869 22:19824732-19824754 ACACCCCACTCAAGGGAGGCAGG + Intronic
1181115987 22:20632832-20632854 TCACCCCACCCACAGCAGCCAGG + Intergenic
1181375766 22:22456836-22456858 ACACCCCACACACAAGTGAAAGG + Intergenic
1181436817 22:22915944-22915966 TCACCCCACCCACAGGGGCCTGG + Intergenic
1181437658 22:22919870-22919892 TCACCCCACCCACAGGGGCCTGG + Intergenic
1181438306 22:22922925-22922947 TCACCCCACCCACAGGGGCCTGG + Intergenic
1181550889 22:23638591-23638613 CCACCCCACCCACAGGGGCCTGG - Intergenic
1181727233 22:24820069-24820091 CCAGCCCACACCCTGGAGACTGG - Intronic
1181797397 22:25320098-25320120 CCACCCCACCCACAGGGGCCTGG + Intergenic
1184046882 22:41977361-41977383 ACACACCACGCACAGGTGCCAGG + Intronic
1184457228 22:44617980-44618002 ACACCACACACACACCACACTGG + Intergenic
949250120 3:1973441-1973463 ACAAGCCACACAGAGAAGACTGG + Intergenic
952604792 3:35132494-35132516 ACACACCACACACAATAGGCAGG - Intergenic
953905663 3:46867206-46867228 AGACCCCAGACACAGGAACCAGG + Intronic
955489220 3:59465558-59465580 ACACCACACACAAAGTAGAGAGG - Intergenic
956556711 3:70531966-70531988 ACATGCCCCACACAGGAGAAGGG + Intergenic
960359374 3:116692682-116692704 ACACCCCCCACACACCATACAGG - Intronic
961414034 3:126744478-126744500 ATAGCCAACACACAGGAGATAGG - Intronic
961642547 3:128373731-128373753 CCACCCCAAGGACAGGAGACTGG - Intronic
963717769 3:148823054-148823076 TCACCCCACACTCAGGAATCAGG + Intronic
966402383 3:179561454-179561476 CCACCCCACACACAAAAGACTGG + Intergenic
967721203 3:192818242-192818264 AAACCCCAGACACAGAACACAGG - Intronic
968466713 4:755312-755334 ACACCCCACACACAGGAGACTGG - Intronic
968615164 4:1574451-1574473 TCTCCCCACACACAGGGCACCGG - Intergenic
968894304 4:3389805-3389827 ACACCCCACATACATGACCCCGG + Intronic
969484818 4:7466412-7466434 ACGCCCCACTCAGAGGAGGCTGG + Intronic
971581117 4:28342167-28342189 GCACGCCAAACAAAGGAGACAGG - Intergenic
972343329 4:38171899-38171921 ACTCCCCCCACCCAGGAGAGGGG - Intergenic
973257634 4:48129064-48129086 AGACCCCACACCAAGGAGAGGGG + Intronic
975484104 4:74915600-74915622 AGACACCTCACACAGGAGCCTGG - Intergenic
977608995 4:99013545-99013567 GCACACCAAACAAAGGAGACGGG + Intronic
977610020 4:99021626-99021648 GCACACCAAACAAAGGAGACAGG + Intronic
985238387 4:187902026-187902048 ACACCGAACAAACCGGAGACAGG + Intergenic
992337700 5:75789977-75789999 GCACTCCAGACACAGGAAACCGG - Intergenic
992498448 5:77317471-77317493 ACACCCCACACAGAGCTGGCAGG + Intronic
993966551 5:94366825-94366847 GTACCCCAAACAAAGGAGACAGG + Intronic
995369072 5:111398307-111398329 ACACCCCATCCACAGCTGACTGG - Intronic
997447705 5:133953498-133953520 CCACCCCACACACAGGATGGGGG + Intergenic
997628814 5:135350679-135350701 ACAACCCAGGGACAGGAGACAGG + Intronic
998414589 5:141936996-141937018 TCACCCAACACAAAGGAGAGGGG - Intronic
999128904 5:149267491-149267513 TCACCCCACACAAAGGAGCATGG + Intergenic
1002375511 5:178786250-178786272 CCCTCTCACACACAGGAGACCGG + Intergenic
1004880701 6:20004350-20004372 TCACCCACCACATAGGAGACGGG - Intergenic
1007366558 6:41398186-41398208 AGACCCCAAAGACAGGAGAAGGG + Intergenic
1012853225 6:104471410-104471432 ACACTGCTCACACAGGAGTCAGG - Intergenic
1016702892 6:147073483-147073505 ACCCCCCACACACAGGGGGGTGG - Intergenic
1017123590 6:151045917-151045939 ACACACCACACTGAGGAGACAGG - Intronic
1018685018 6:166297726-166297748 ACACGCAGCACACAGGAGACAGG - Intergenic
1018992491 6:168684748-168684770 ACAGCCCACATGCAGGAGGCGGG + Intergenic
1019540824 7:1550257-1550279 ACACCCCACACACCTGGGACAGG - Intronic
1019637038 7:2081534-2081556 ACCCACCCCACACAGGAGGCGGG + Intronic
1019707130 7:2502198-2502220 ACACCCCACCTCCAGGGGACAGG - Intergenic
1021523449 7:21559919-21559941 ACACCACACACACAGAACTCTGG - Intronic
1023361813 7:39424843-39424865 ACACTCCACACTCTGGAGGCAGG - Intronic
1023884818 7:44346850-44346872 ACACCTCACACATAGTAGAATGG - Intergenic
1024526336 7:50353157-50353179 ACAGCCCAGGCACAGGAGGCAGG + Intronic
1025149922 7:56539927-56539949 TCCCCCCACACACATGAGGCTGG + Intergenic
1027347669 7:77278052-77278074 ACACCCCACATACAAAAGAATGG + Intronic
1031943917 7:127818615-127818637 ACAACGCACACACAGCAGAGTGG - Intronic
1032854639 7:135824285-135824307 CCCCACCAGACACAGGAGACGGG - Intergenic
1033147309 7:138882542-138882564 ACCACCCACATAAAGGAGACAGG + Intronic
1033305135 7:140219757-140219779 ACACCACACCCCCATGAGACGGG + Intergenic
1034281465 7:149857812-149857834 ATACCCTCCAAACAGGAGACGGG - Intronic
1035302629 7:157907352-157907374 ACACCCCACACGCAGGGGACAGG - Intronic
1035302642 7:157907393-157907415 ACACCCCACATGCAGGGGACAGG - Intronic
1035302665 7:157907475-157907497 ACACCCCACACGCAGGGGACAGG - Intronic
1035302677 7:157907516-157907538 ACACCCCACACGCAAGGGACAGG - Intronic
1035302686 7:157907557-157907579 ACACCTCACACACAGGAGACAGG - Intronic
1035302697 7:157907598-157907620 ACACCCCACATGCAGGGGACAGG - Intronic
1035302711 7:157907641-157907663 ACACCCCACACGCAGGGGACAGG - Intronic
1035302725 7:157907684-157907706 ACACCCCACACGCAAGGGACAGG - Intronic
1035302736 7:157907725-157907747 ACACCCCACACGCAGCGGACAGG - Intronic
1035309198 7:157954153-157954175 ACACAGCACACACAGTACACAGG - Intronic
1035309206 7:157954243-157954265 ACACAGCACACACAGTACACAGG - Intronic
1035309211 7:157954306-157954328 ACAGCACACACACAGTACACGGG - Intronic
1035309219 7:157954398-157954420 ACACAGCACACACAGTACACAGG - Intronic
1035309227 7:157954490-157954512 ACACACCACACACAGTACACAGG - Intronic
1035309234 7:157954577-157954599 ACACACCACACACAGTACACAGG - Intronic
1035749921 8:1990113-1990135 ACAGCTCACACACTTGAGACAGG - Intronic
1037870765 8:22494047-22494069 ACACACCACATACAGGACAATGG - Intronic
1038734562 8:30156859-30156881 ACACCCCACCCTCCAGAGACAGG - Intronic
1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG + Intergenic
1041583210 8:59486386-59486408 CCAGCCCACACACAGGAGGAGGG - Intergenic
1044951653 8:97441229-97441251 ACACCCCAGACACAGCATGCTGG - Intergenic
1047964585 8:130036470-130036492 TAACCCCAAACTCAGGAGACTGG - Intergenic
1049094560 8:140540747-140540769 ACACCTCTCACACTGCAGACAGG + Intronic
1049932348 9:469650-469672 ACATGCTGCACACAGGAGACAGG - Intergenic
1051103940 9:13556239-13556261 TCCCCCGACAAACAGGAGACAGG + Intergenic
1052744544 9:32427362-32427384 CCACGCCACTCCCAGGAGACAGG - Exonic
1053575710 9:39356277-39356299 TCACCCCACACAGGGGAGGCTGG - Intronic
1053840230 9:42184234-42184256 TCACCCCACACAGGGGAGGCTGG - Intronic
1054097280 9:60914982-60915004 TCACCCCACACAGGGGAGGCTGG - Intergenic
1054118686 9:61190611-61190633 TCACCCCACACAGGGGAGGCTGG - Intronic
1054589071 9:66991953-66991975 TCACCCCACACAGGGGAGGCTGG + Intergenic
1056583823 9:87915088-87915110 TCACCCCACACAGAAGAGGCTGG - Intergenic
1056584315 9:87918557-87918579 TCACCCCACACAGAAGAGGCTGG - Intergenic
1056612554 9:88134365-88134387 TCACCCCACACAGAAGAGGCTGG + Intergenic
1056613046 9:88137833-88137855 TCACCCCACACAGAAGAGGCTGG + Intergenic
1057160101 9:92883172-92883194 TCACCCCACACAGAGGAGGTTGG - Intergenic
1057485205 9:95477458-95477480 ACACACAGCACACAGGAGGCTGG + Intronic
1058755787 9:108081959-108081981 ATGCCCTACACACAGGAGCCTGG - Intergenic
1060368908 9:123050172-123050194 ACACATCACACAGAGCAGACTGG - Intronic
1060970017 9:127732506-127732528 TCACCCCACACCCAGGGGCCAGG - Intronic
1061393412 9:130330279-130330301 ATTCCCCACAGACAGGAGAAGGG - Intronic
1061834218 9:133318228-133318250 GCACCCCACAGGCTGGAGACGGG - Intergenic
1061918979 9:133771908-133771930 CCACCCCAGCCACAGGGGACAGG - Intronic
1061974882 9:134063040-134063062 ACACCCCGGCCCCAGGAGACAGG + Intronic
1062287244 9:135778624-135778646 ACTCCCCACCCACAGGACCCCGG - Intronic
1062402941 9:136380377-136380399 TCACCCCACCCCCAGGTGACGGG + Intronic
1062426859 9:136510139-136510161 AGACCCCAAGCACAGGAGACGGG - Intronic
1185731780 X:2467504-2467526 AAACACCAGAAACAGGAGACCGG + Intronic
1189825652 X:44914048-44914070 GCACACCAAACAAAGGAGACAGG - Intronic
1192521897 X:71809546-71809568 ACAAGCCAGACAGAGGAGACTGG - Intergenic
1195263143 X:103153695-103153717 ACACCACACTCACTGGGGACAGG - Intergenic
1195300400 X:103524570-103524592 ACACCCCACTCACTGGGGCCAGG + Intergenic
1199637728 X:149829470-149829492 ATACACCAAACAAAGGAGACAGG - Intergenic
1199875106 X:151922474-151922496 GCACCCCACACAGGGGTGACAGG + Intronic
1202337248 Y:23825320-23825342 ACACCCCACAAACAAGTGACTGG + Intergenic
1202533517 Y:25844751-25844773 ACACCCCACAAACAAGTGACTGG - Intergenic