ID: 968466777

View in Genome Browser
Species Human (GRCh38)
Location 4:755874-755896
Sequence CTGAAGAAGAAAAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1275
Summary {0: 1, 1: 0, 2: 2, 3: 127, 4: 1145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968466777_968466781 15 Left 968466777 4:755874-755896 CCCTCCTCATTTTTCTTCTTCAG 0: 1
1: 0
2: 2
3: 127
4: 1145
Right 968466781 4:755912-755934 TTTTTTTTTTTTTTTTTTTTTGG 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
968466777_968466782 21 Left 968466777 4:755874-755896 CCCTCCTCATTTTTCTTCTTCAG 0: 1
1: 0
2: 2
3: 127
4: 1145
Right 968466782 4:755918-755940 TTTTTTTTTTTTTTTGGAGATGG 0: 2676
1: 87395
2: 67301
3: 106475
4: 184656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968466777 Original CRISPR CTGAAGAAGAAAAATGAGGA GGG (reversed) Intronic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
902223344 1:14980843-14980865 CTCAGGAGGAAAAATGAGGGAGG + Intronic
902391196 1:16107934-16107956 CTGGAAAAGAAAGATCAGGAGGG + Intergenic
902814395 1:18907960-18907982 CTGAAGGAGAGAAAGGTGGAAGG - Exonic
903086477 1:20864213-20864235 CAGAAGAAGAAAAAAGAATATGG + Intronic
903352488 1:22726188-22726210 GAGAAGGAGAAAAAGGAGGAAGG - Intronic
903527432 1:24002513-24002535 ATGAAGAAGATAAAAGAGGCCGG + Intergenic
903623330 1:24713864-24713886 CTGAAAAAAAAAAAAAAGGAAGG - Intergenic
903728855 1:25474476-25474498 CTGAAGAAGAAAAAGCAAAAAGG - Intronic
903934091 1:26882872-26882894 CTGAGGCAGGAAAAGGAGGAGGG - Intronic
904105548 1:28079064-28079086 CTGGGGAAAAAAAATGAGAATGG - Intronic
904596640 1:31650589-31650611 CTCAGGAAGAAAAGTGAAGAAGG + Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
904781322 1:32951135-32951157 TTGAAGAAAAAAAATGAAAAAGG - Intronic
904865614 1:33576802-33576824 CTGAAGAAGAAAAAAAAAAACGG - Intronic
905274148 1:36806244-36806266 CTGGTGAAGAACAACGAGGAGGG - Exonic
905529088 1:38662177-38662199 ATGAAGGAGAAAAAGAAGGAAGG + Intergenic
905749934 1:40453344-40453366 CAGATGGAGAAAAATGAGCAAGG + Intronic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
905970292 1:42136753-42136775 GAGAAGGAGAAAAAGGAGGAGGG - Intergenic
906644909 1:47467660-47467682 CTGAAGAATAAAAAGAAGGTTGG - Intergenic
907191676 1:52654342-52654364 CTGAAAAAGAATAATGAAGTTGG + Intronic
907227773 1:52965209-52965231 CTGAAAAAGAAAAACTATGAGGG - Intronic
907244888 1:53102490-53102512 CTGAAGATGACAAACGTGGAGGG + Intronic
907665857 1:56433334-56433356 CTGAAGTAGGAAGATGAGGAAGG - Intergenic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908438036 1:64126126-64126148 CAGGTGAAGAAAAATGAGAATGG + Intronic
908621525 1:65986582-65986604 CAGAATAAGACAAAGGAGGAGGG - Intronic
908793003 1:67801959-67801981 GTGAGGAAGAAAAAGGAGGGAGG + Intronic
908822425 1:68102246-68102268 GGGAAGAAGTAAAAAGAGGAAGG - Intronic
908992596 1:70111230-70111252 CTGAAGAAGAAAAGAGTGGATGG - Intronic
909772161 1:79437442-79437464 AAGAAAAAGAAAATTGAGGATGG + Intergenic
909836085 1:80256856-80256878 CTTAGGAAGAAAAATGTAGATGG - Intergenic
909950081 1:81708709-81708731 TTGAAGCATAAAAATTAGGATGG + Intronic
910123836 1:83818960-83818982 CAAAAGAAGAAAAATAAGCAAGG + Intergenic
910692099 1:89975332-89975354 CTGAAGTAGCTAAATGAGGGTGG + Intergenic
910902485 1:92136405-92136427 CTAAAGAAACAAAATGAGGAAGG - Intronic
910917216 1:92302303-92302325 GGAAAAAAGAAAAATGAGGATGG + Intronic
911187596 1:94919044-94919066 CTAAAGAAGAAAAAGAAGGGGGG + Intronic
911303234 1:96201852-96201874 TTGAAGAAGAGAAATGAAGGTGG + Intergenic
911483655 1:98477412-98477434 CTGAAAAAGTAAGATAAGGAAGG - Intergenic
911496857 1:98642575-98642597 CTGATGAAGGAAATTGAAGAGGG + Intergenic
911931287 1:103907272-103907294 TTTAAGAATAAAAATGAGAAGGG - Intergenic
912164651 1:107028858-107028880 GTGAAGAATAATAATGAAGAAGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912392106 1:109310531-109310553 CTGAAGCAGGAAAATGAACATGG - Exonic
912400564 1:109388015-109388037 CTCAGGATGAAAAAAGAGGAGGG - Intronic
912555764 1:110514835-110514857 CTGAAGGGGAAAAATGGGAAGGG + Intergenic
912695581 1:111839497-111839519 CTGAAGCAGGAAAATGAACAAGG - Intronic
912917282 1:113828036-113828058 TTGAAGAAAATAAATGAGCATGG - Intronic
913200948 1:116494953-116494975 CTGAAAGAGAACAATTAGGAAGG + Intergenic
913293638 1:117298173-117298195 CTGAAGAGGTAAACTGAAGAGGG - Intergenic
913673956 1:121124085-121124107 CTGAGGCAGGAAAATGAGGCAGG - Intergenic
914025737 1:143911437-143911459 CTGAGGCAGGAAAATGAGGCAGG - Intergenic
914219380 1:145665430-145665452 CTTAAGAAAAAAAATCAGGTAGG + Intronic
914471963 1:147988300-147988322 CTTAAGAAAAAAAATCAGGTAGG + Intronic
914786507 1:150837235-150837257 CTGAAAAAGAGAGATGAGGTGGG - Intronic
914918314 1:151831553-151831575 CTGGAGGAGAAACAGGAGGAGGG - Intronic
915119321 1:153618759-153618781 CTCAAGAAAAGAAATCAGGATGG + Intergenic
915667229 1:157456185-157456207 CTCAAGAAGAAAAAAAAGAAAGG - Intergenic
915864903 1:159488907-159488929 CTGAAGAAGACAAGAGAGGATGG + Intergenic
916271061 1:162942175-162942197 CTGAAGAAGAAAATTAAGCATGG + Intergenic
916473083 1:165142739-165142761 ATGAAGGAGAGAAAGGAGGAAGG - Intergenic
916565294 1:165970639-165970661 TTGAAGAAGAAAAATAAGAAAGG - Intergenic
916870147 1:168904713-168904735 CTGGAACAGAAAAATGATGATGG + Intergenic
916944851 1:169716220-169716242 CTGGTGAAGTAAGATGAGGATGG - Intronic
917345326 1:174022750-174022772 TGGAAGAAGAAAAATGGGGTGGG - Intergenic
917786098 1:178458905-178458927 CTTAAGAAAAAAAATTAAGAAGG - Intronic
917911686 1:179654345-179654367 CTGAAGGAAGAAAATGAGGTAGG + Exonic
917923531 1:179770536-179770558 CTGGAGATGAAAAATGAGACTGG - Intronic
918219719 1:182425945-182425967 CTGAAAAAGAAAAAGAAAGAAGG + Intergenic
918514622 1:185349317-185349339 TTGAAGGAGAGAAATGGGGAGGG - Intergenic
918638779 1:186812655-186812677 CACAGAAAGAAAAATGAGGAGGG + Intergenic
918675037 1:187273545-187273567 CGGAAAAAGAAAAATGTAGAAGG + Intergenic
918701530 1:187614903-187614925 CTGTAGAAGATAAATCAGTATGG - Intergenic
919016832 1:192049241-192049263 ATGAAGAAGATAACTCAGGATGG + Intergenic
919108776 1:193190564-193190586 CTGAAGGAGAAAAATAAGGCAGG - Intronic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919406081 1:197186021-197186043 CTGAAGGAGAAAAATAAGGTTGG + Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919616704 1:199816851-199816873 CTGAAGAAGAGATATTTGGAGGG + Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920089565 1:203442615-203442637 CTGAAGAACAAACATGAATAAGG + Intergenic
921191065 1:212709085-212709107 CTGAAGGAGAAAAAAGTGGGTGG + Intergenic
921252275 1:213309334-213309356 CTGAAGAAGACAAATGGAAATGG + Intergenic
921256401 1:213344118-213344140 CTTAAGAAAAAAATTGAAGAAGG + Intergenic
921366158 1:214376406-214376428 CTGAAGAAGAAACTAGAAGAGGG - Exonic
921630948 1:217433093-217433115 GGGAAGAAGAAAACTGATGATGG - Intronic
921781141 1:219165988-219166010 TTGAAGAAGTAAATAGAGGAGGG + Intergenic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
922222643 1:223620201-223620223 CTGGACAAGAAAGTTGAGGATGG - Exonic
922319074 1:224469376-224469398 CTAAAGAAGAAAAATCAGGCTGG - Intronic
922439864 1:225646054-225646076 CTAAAGAAGATAAATTAGGGGGG - Intronic
923385850 1:233464659-233464681 CTGAAGAAGGGAAGTGGGGATGG - Intergenic
923841441 1:237676046-237676068 CCGAAGAACAAAAATGAGGTAGG + Intronic
923951394 1:238959505-238959527 CTGAAGAATTTAAATTAGGAAGG - Intergenic
923980919 1:239322476-239322498 CTGCACAAGAAAAGTGAGGGAGG - Intergenic
924107899 1:240667700-240667722 GTGAAGACGAAGAATGAAGAGGG - Intergenic
924178853 1:241420778-241420800 GTGAAGAAGATATATGAGGCTGG - Intergenic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
924395076 1:243609743-243609765 CTGAACAAGAAAAATAATGTAGG + Intronic
924509936 1:244721910-244721932 CTGAAGCAGCAAAGTGGGGAAGG - Intergenic
1063029355 10:2216712-2216734 CTGAATATGAAAAATGAAGATGG + Intergenic
1063585820 10:7351333-7351355 CTTAACCAGAAGAATGAGGATGG + Intronic
1063879507 10:10516927-10516949 CGGAAGGAGAAAAAAGAGGTGGG - Intergenic
1064107877 10:12515608-12515630 CTCAAAAAAAAAAAAGAGGAAGG - Intronic
1064777054 10:18790288-18790310 ATGAATGAGAAAAATGAGGGAGG - Intergenic
1064809563 10:19179977-19179999 CAGAAGAAGAAAAAAAAAGAAGG + Intronic
1065002296 10:21348050-21348072 CAGGTGAAGAAAAATGATGATGG - Intergenic
1065687891 10:28303672-28303694 CTTAAATAGAAAAATGAGTAGGG + Intronic
1065762731 10:28997727-28997749 CTTAAAAAAAAAAATAAGGAGGG + Intergenic
1065763907 10:29008860-29008882 CTGAGCAAGAACAATGAGAAGGG + Intergenic
1065975678 10:30840125-30840147 CTTAAGAAGAAACAATAGGATGG - Intronic
1065978475 10:30865449-30865471 ATGAAGAAAAAAAATGACAAAGG + Intronic
1066236320 10:33488436-33488458 CTGATGTAGTAAAATGAGAAAGG - Intergenic
1066239772 10:33522315-33522337 CTCAAGAAGAGAAATTGGGAAGG + Intergenic
1066365428 10:34771558-34771580 CTGAGAAAGAAAAATGACGTCGG + Intronic
1066557826 10:36634675-36634697 CTTAAGAAGAAAAATGGTCAAGG - Intergenic
1066661968 10:37745648-37745670 CTGCAGAAGAAAAAAGATTATGG + Intergenic
1066720630 10:38334043-38334065 CTGAAGAAGAAAAATTGGAAGGG + Intergenic
1067392777 10:45880192-45880214 CTGAAGGAGAAAAAAGTTGAAGG + Intergenic
1067521211 10:47007773-47007795 TTGAAGAAAGAAAATGGGGAGGG + Intergenic
1067724662 10:48761014-48761036 CTGAGGTAGAAGAATGAGAATGG + Intronic
1067861102 10:49849310-49849332 CTGAAGGAGAAAAAAGTTGAAGG + Intronic
1068170592 10:53388456-53388478 CTTTAGAAAAAAAATGAGGTAGG + Intergenic
1068690371 10:59907361-59907383 ATGAAGAAAAAAAAAAAGGAAGG + Intergenic
1069021719 10:63495767-63495789 AAGAAGAAGAAAATTGAGAAAGG + Intergenic
1069026650 10:63549807-63549829 GGGAAGAGGAAAGATGAGGAGGG + Intronic
1069108419 10:64411822-64411844 ATGAGGAAGAAAAAAGAGAATGG + Intergenic
1069177915 10:65316963-65316985 CTGCACAAAGAAAATGAGGAAGG + Intergenic
1069466368 10:68642959-68642981 CTCAATAAGAAAAATTAGGTTGG + Intronic
1069771023 10:70900367-70900389 TTGAAGAAGAAAAATGAGATTGG - Intergenic
1070200997 10:74206285-74206307 CTGAAGAAGAAAGATAAGATTGG + Intronic
1070347030 10:75554353-75554375 CTGCAGAAGAGAAATGATGTTGG + Intronic
1070667129 10:78353186-78353208 CTGCAAAAGGAAAATGAGCAAGG - Intergenic
1071026339 10:81118401-81118423 CTGAAAAATAAAAATGTAGAAGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071382592 10:85083025-85083047 CTTAATAAGAACAATGTGGAAGG - Intergenic
1071492556 10:86145760-86145782 ATAAAGAACACAAATGAGGAAGG - Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071741580 10:88364433-88364455 CTGGGGATGTAAAATGAGGATGG - Intronic
1071928927 10:90443497-90443519 CTAACAAAGAAAAATGAGAAAGG + Intergenic
1071952273 10:90717372-90717394 ATGAAGAAGGAAAAGGAGCATGG + Intergenic
1072065635 10:91868439-91868461 CTGAAGAAGAAAAATAAAGCAGG + Intergenic
1072161710 10:92772987-92773009 TTGAAAAATAAAAATGAGCATGG - Intergenic
1072264458 10:93714002-93714024 CTGAAGAAGAGAACTGAGTGTGG - Intergenic
1072946799 10:99817525-99817547 TTGAAGAGAAAAAGTGAGGATGG + Intronic
1073001208 10:100287383-100287405 TTGAAGGTGCAAAATGAGGAGGG + Intergenic
1073066486 10:100762580-100762602 CTGCATAAGAAAAATTAGTAGGG + Intronic
1073200210 10:101729195-101729217 CTGTGAAAGACAAATGAGGAAGG + Intergenic
1074096303 10:110316367-110316389 CTGCAGTAGAAACTTGAGGAAGG - Intergenic
1074758800 10:116648495-116648517 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
1074852489 10:117449847-117449869 CTAAACAGGAAAAAGGAGGAAGG + Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075396680 10:122132820-122132842 CTGCAGGAGAAAAGAGAGGAGGG - Intronic
1075844665 10:125535632-125535654 AGGAAGAAGAAAAGGGAGGAAGG - Intergenic
1076028168 10:127134459-127134481 CAGCAGAAGATAAATGGGGAGGG - Intronic
1076080305 10:127574391-127574413 CTGAAACAGAAAAATAAAGAAGG + Intergenic
1076150892 10:128161252-128161274 CTGCAGAAGAGTAAAGAGGAAGG - Intergenic
1077613800 11:3660935-3660957 CAGAAGAAGAACCATGAGGATGG + Intronic
1078007406 11:7542493-7542515 CTGAGGAAGAACAATGGGGTGGG - Intronic
1078313486 11:10270695-10270717 TTTAAGAAGTAAAATGAGGACGG + Intronic
1078437014 11:11333784-11333806 CTCTACAAGAAATATGAGGAAGG - Intronic
1078583858 11:12562928-12562950 CTTAAAAAGACAAATGTGGAGGG + Intergenic
1078627126 11:12967948-12967970 CTGAAGGAGAAAGAGCAGGAAGG - Intergenic
1079050607 11:17154704-17154726 CAGAGGAAGAAAAGTGAGGAAGG + Intronic
1079652905 11:22952145-22952167 CTGAAATATAAACATGAGGAAGG - Intergenic
1079679507 11:23276616-23276638 CTAAAGAAGAAGAATGAAAATGG + Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1079857838 11:25628542-25628564 CTAAAGAAGAAAAATTAGCTGGG - Intergenic
1080445835 11:32336238-32336260 CAGTAGAAGAAAAATGGGCAGGG - Intergenic
1080514137 11:33004222-33004244 CAGAAAAACAAAAATAAGGAAGG - Intergenic
1080550379 11:33369267-33369289 CTGAGGCAGCACAATGAGGATGG - Intergenic
1080556623 11:33422784-33422806 ATGAAAAAGAAAAAAAAGGAAGG + Intergenic
1081060593 11:38470572-38470594 AGGATGAAGAAAAAGGAGGAGGG - Intergenic
1081294674 11:41370891-41370913 CTGAGGAAGAGAAAGGAGAAGGG - Intronic
1081554656 11:44147297-44147319 CTGAAAAACACAAATGAGGTAGG - Intronic
1083361694 11:62113118-62113140 CTAAAGAAAAAAAAGGGGGACGG - Intergenic
1083497585 11:63071608-63071630 CAGAAGAAGCTAAATCAGGATGG + Intergenic
1083516857 11:63267941-63267963 AAGAAGAAGAAAAAAGAAGAAGG - Intronic
1084052071 11:66606416-66606438 CTAAGGAGGAAAAATGAGGCAGG + Intergenic
1084839617 11:71834583-71834605 CTGGAGAAGAAAACACAGGATGG + Intronic
1085179289 11:74520051-74520073 CTGAAGGACAAAAAGGAGGGTGG - Intronic
1085201419 11:74704485-74704507 CTGAAGGAGAAACATAAGAAAGG - Exonic
1085633371 11:78138641-78138663 GAGAAAAAGAAAAAAGAGGAAGG + Intronic
1085858349 11:80202174-80202196 GTGAAGAAGAAATATGAAGGTGG + Intergenic
1085887047 11:80533388-80533410 CTGAAGAAGACACAAGTGGATGG - Intergenic
1086089854 11:82994391-82994413 GTGAAGGAGAAAATTGAGAAAGG + Intronic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086614109 11:88794177-88794199 CTGAAGCAGAATAGTGGGGACGG - Intronic
1087071662 11:94087761-94087783 CTGATGAGGACACATGAGGAAGG - Intronic
1087259187 11:95991724-95991746 CTAAAGAAGAGAAAGGGGGAAGG + Intronic
1087500523 11:98946094-98946116 CTGAAGGAAATAAAAGAGGAAGG + Intergenic
1087600871 11:100313780-100313802 CTGAAGAGGAAGAATCAGCAAGG + Intronic
1087661898 11:100998157-100998179 CTCCAGAAGAAAGATGAAGATGG + Intergenic
1087826837 11:102774463-102774485 TTGATGAAGAAAAAAGAGAAAGG + Intronic
1087968211 11:104445953-104445975 ATCTAGAAGAAAATTGAGGAAGG - Intergenic
1087977596 11:104569007-104569029 TTAAAGAAGAAAAAAGAGTATGG + Intergenic
1088806866 11:113360531-113360553 TTGAATAAGAAAACTGAGAAAGG + Intronic
1088924578 11:114287683-114287705 TTAAAGAAGAAAAATAAGGTGGG - Intronic
1089026411 11:115275042-115275064 CTCAAGAGAAAAAATGAGCATGG + Intronic
1089082270 11:115786708-115786730 CTTAAGAAGCAAAATGAGCTTGG + Intergenic
1089268258 11:117282381-117282403 CTGAGGAAAAAAAATGTTGAGGG - Intronic
1089369621 11:117946136-117946158 CACAAGAATAAAAATGAGGGTGG + Intergenic
1089984712 11:122802600-122802622 CTGAACAGAAAAAATGAGTATGG - Intronic
1090038428 11:123269073-123269095 CTCAAGAAAAGAAATGAGGCTGG + Intergenic
1090174223 11:124633437-124633459 CAGAAGTAGAAGAATGGGGATGG + Exonic
1090283050 11:125474332-125474354 CTCAAAAAGAAAAATTAGGCCGG - Intronic
1090430908 11:126645630-126645652 CTGAAGAAGAAAAGGTAAGAAGG + Intronic
1090610730 11:128468082-128468104 CTGAAGAAGAAATACCAGGTAGG + Intronic
1090650683 11:128803386-128803408 CTGAAGTAGAGCAATGTGGAGGG - Intronic
1090793890 11:130117396-130117418 CTGAAGAACTGAAATCAGGAGGG - Intronic
1090815054 11:130285586-130285608 CAGAAGAACAAAAAAGAGGCTGG - Intronic
1091096907 11:132831919-132831941 CAAAAGAAGGAAAATGAAGAGGG - Intronic
1091110511 11:132962237-132962259 CTCAGGAAGAAAACTGAGCAAGG + Intronic
1091375277 12:21060-21082 CTCAAGAAGGGTAATGAGGATGG + Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091576280 12:1739178-1739200 CTGAACATAAAAAATGATGAAGG + Intronic
1092023174 12:5219255-5219277 ATGAAAATGAAAAAAGAGGATGG + Intergenic
1092083854 12:5739677-5739699 CTGGAGAAGTAAAGTAAGGATGG + Intronic
1092231273 12:6776939-6776961 CTGAATAAGATAAATGTGGCCGG + Intronic
1092358485 12:7816531-7816553 GTGAAGAAGAAAAAAGAAGATGG - Intronic
1092551119 12:9501291-9501313 CCGAAAAAGAAAAAGAAGGAAGG - Intergenic
1092601805 12:10074593-10074615 GAGAATAAGAAAAATTAGGAGGG + Intronic
1093002962 12:14019286-14019308 TTGAAAAAGAAAAATGAAGTTGG - Intergenic
1093364823 12:18280928-18280950 TAGAAGAAGAAAGATGAGGAAGG + Intronic
1093711848 12:22336290-22336312 TTGAGGAAGAAAAATGGGAATGG - Intronic
1093772549 12:23034458-23034480 GGGAAGAAGAAAAAAGAGGGAGG - Intergenic
1094026106 12:25960661-25960683 CTTGAGGAAAAAAATGAGGAAGG - Intronic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094443830 12:30508094-30508116 CCGAAGAACAAAGAGGAGGATGG - Intergenic
1094520685 12:31185065-31185087 CCGAAAAAGAAAAAGAAGGAAGG + Intergenic
1094749084 12:33384487-33384509 CTGTGGAAGAAAAATGATAAGGG - Intronic
1095302881 12:40607469-40607491 GGGAAGAACAAAAATAAGGAAGG - Intergenic
1095376618 12:41536775-41536797 AAGAAGAAGAAAAATCAAGAAGG - Intronic
1095518889 12:43038332-43038354 GTGAAGAAAGAACATGAGGAAGG - Intergenic
1095545625 12:43364685-43364707 AAGAAGAAGAAAAATGAATAGGG + Intronic
1095654101 12:44649174-44649196 GAGAAGGAGAAAAATAAGGAAGG - Intronic
1096055528 12:48648177-48648199 CTGAAGAGGCACAATGAGGGTGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096783245 12:54002800-54002822 CTTAAAAAGAAAAACAAGGAAGG + Exonic
1096904179 12:54917680-54917702 CTGATGAAGGAAATTGAAGAAGG + Intergenic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1097345993 12:58493023-58493045 TTGAAGAAGAAAAATGAAGTTGG - Intergenic
1097496465 12:60343837-60343859 CTGAACAAGAAAAATAAAGAAGG - Intergenic
1097665886 12:62476731-62476753 CTAAAGAAGAAATGTGAGGCTGG - Intronic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097935335 12:65243042-65243064 CTGAAGAATAAAAATTAGCAGGG - Intronic
1098017834 12:66125182-66125204 ATGTAGAAGATAAATGAGAAGGG + Intronic
1098049103 12:66434554-66434576 CTGAAAAAGAGAAATGAAGTAGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098563741 12:71907515-71907537 ATGATGAAAATAAATGAGGATGG + Intronic
1098610358 12:72449892-72449914 TAGAAGGAGAAAAGTGAGGAAGG - Intronic
1098853102 12:75621037-75621059 TTGAAGAAGAGAAATAAGGTAGG + Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100023867 12:90103932-90103954 ATGAAGAAAAAAAATCAAGAAGG - Intergenic
1100535307 12:95503396-95503418 GAGAACAAGAAAAATGAGTATGG + Intronic
1100622887 12:96297175-96297197 CTGAAGAAGAGTTATGAGGCTGG + Intronic
1100673572 12:96842745-96842767 GAGAAGAGGAAAAAGGAGGAAGG - Intronic
1100854446 12:98746302-98746324 CTGCAGCAGAAAAATCAGGTGGG - Intronic
1101322432 12:103684397-103684419 TGATAGAAGAAAAATGAGGAGGG + Intronic
1101324847 12:103706516-103706538 AGGATGAAGAAAAATGAGAAAGG - Intronic
1101538882 12:105646247-105646269 CTGATGAAACAAAATGAGGCTGG + Intergenic
1101793888 12:107955335-107955357 CTGAAGAAGATAAAAGAACAGGG - Intergenic
1101868306 12:108540669-108540691 TTGAAGAGGAAAAAGGTGGATGG + Intronic
1101951943 12:109183864-109183886 CTGAAGGAAGAAAAAGAGGAAGG - Intronic
1102050754 12:109860272-109860294 CTTAAGAAGATAAACGAGGCTGG - Intronic
1102065382 12:109970717-109970739 TTGCAGAAGAATAATGTGGAAGG - Intronic
1102235752 12:111293557-111293579 CGGAAAAACAAAAGTGAGGAAGG + Exonic
1102662980 12:114545839-114545861 CTCAAAAAAAAAATTGAGGAGGG - Intergenic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102754701 12:115328044-115328066 ATGTGGAAGAAAATTGAGGAAGG - Intergenic
1103824009 12:123721544-123721566 CTCATGAAGAAAACTGATGATGG - Intronic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104433545 12:128737005-128737027 CTGAAGAAGAAAGAAAAGGAAGG + Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1105962645 13:25356052-25356074 TTGATCAAGAAAAATGAGAACGG - Intergenic
1106067298 13:26367310-26367332 ATTAAGAAGAAAAATAAGAAAGG + Intronic
1106577088 13:30984965-30984987 TTTAAGAACAAAACTGAGGATGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106588382 13:31076900-31076922 CTGAAGAATAAAAGTGATGCGGG - Intergenic
1106662033 13:31809858-31809880 CAGAAGAAGAAAAAAGACAAGGG + Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1107497646 13:40943847-40943869 GTGAAGAAGAAAAACAAAGATGG - Exonic
1107666924 13:42700159-42700181 CTGAAGAAGTAAAGACAGGAAGG + Intergenic
1107739115 13:43430468-43430490 CTGAAGAACAAAAAAAAAGAGGG - Intronic
1108042886 13:46355937-46355959 ATAAAGAAAAAAAATAAGGATGG + Intronic
1108102533 13:46972177-46972199 CTGAAGAAGCATAATGTGTAAGG - Intergenic
1108149582 13:47519468-47519490 CAGAAGAAGTCAAATGAGAATGG - Intergenic
1108283353 13:48881448-48881470 CTGGAGAAGAGAAAGGAGAATGG + Intergenic
1108819541 13:54330932-54330954 TTGAAGGAGAAAAATAAAGATGG + Intergenic
1109106201 13:58253544-58253566 GCAAAGAAGAAAAATGAGGAGGG - Intergenic
1109185770 13:59265797-59265819 ATGAAAAAGAAAAAAAAGGAAGG - Intergenic
1109527414 13:63594785-63594807 CTTAAGAAGAAAAATAATAAAGG + Intergenic
1109674362 13:65654486-65654508 CTAAAGAAAAAAAATGTGGTTGG + Intergenic
1110028608 13:70575026-70575048 GTTATGAAGAAAATTGAGGATGG + Intergenic
1110333053 13:74294807-74294829 TTGCAGGGGAAAAATGAGGAAGG - Intergenic
1110521278 13:76479781-76479803 CTAAAGAAGAAAAATAATGTGGG - Intergenic
1110533710 13:76626942-76626964 CTCAAAAAAAAAAATGAGAAAGG - Intergenic
1110751208 13:79118666-79118688 CTAAAAAAGAAAAAGAAGGAAGG + Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111108316 13:83674482-83674504 CGGAAGAAAAGAATTGAGGAAGG - Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111424426 13:88060547-88060569 CAGAAGAAGAAAATGGAAGAGGG - Intergenic
1111846973 13:93522904-93522926 CTGAAGGAGACAAAGGTGGAGGG + Intronic
1112175547 13:97019985-97020007 GTGAAGATGAAATATGATGATGG - Intergenic
1112289442 13:98132225-98132247 CTGAGGAAGAATAAGGAGGTGGG - Intergenic
1112428789 13:99331225-99331247 CAGAAGAAAAAAAATAAGAAAGG - Intronic
1113137244 13:107105460-107105482 CTGATGAAAAAAATTGAAGAGGG - Intergenic
1113141842 13:107161261-107161283 TTGAAGGAGGAAGATGAGGAGGG + Intergenic
1113196070 13:107808033-107808055 CTTTAAGAGAAAAATGAGGAGGG + Intronic
1113225679 13:108157256-108157278 CTTAAGAAAAAAAATCATGAAGG + Intergenic
1113322226 13:109245223-109245245 ATGAAGAAAGAAAATGAGAAGGG - Intergenic
1113497164 13:110740210-110740232 CTGAAGAATAAAAAGGAGATTGG + Intergenic
1113538624 13:111088337-111088359 TTAAAGGAAAAAAATGAGGAAGG - Intergenic
1114133820 14:19823843-19823865 GAGAAAAAGAAAAATAAGGAAGG + Intronic
1114239643 14:20854669-20854691 CTGAACAGCAAACATGAGGAGGG + Intergenic
1114336451 14:21696120-21696142 TTGAAAAAGAAAAATAAGGTGGG + Intergenic
1114353269 14:21878217-21878239 CTGAGGGATAAAAATGAAGAAGG + Intergenic
1114818667 14:25990110-25990132 CTTAACAAGAAAAATGAAGATGG + Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115028972 14:28772883-28772905 CTTAAGTAGAAAAATAAAGAGGG - Intronic
1115461495 14:33666034-33666056 CTTGAGAAGAAAAATGAGATAGG + Intronic
1115565167 14:34618861-34618883 ATTATGAAGAAAAATGAGGGAGG - Intronic
1115952312 14:38734966-38734988 CTAAAGAAGAAAAAGAAGGAGGG + Intergenic
1115977079 14:39008557-39008579 TTTAAGAAGAAAAACTAGGATGG + Intergenic
1116176592 14:41478802-41478824 CTAAAGAAGAATAAGGTGGAAGG - Intergenic
1116368143 14:44095069-44095091 CAAAAGAAGAGAAAAGAGGAAGG + Intergenic
1116769087 14:49106524-49106546 CTGAAGAAAAAAAAAAAAGAGGG + Intergenic
1116959455 14:50955141-50955163 CTGAAGAAGATAAATAAAAATGG + Intergenic
1117202992 14:53411547-53411569 CTAGAGAAGAAAAATGTTGAAGG - Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117548261 14:56810309-56810331 TTAAAGAACGAAAATGAGGAAGG + Intronic
1117739653 14:58803859-58803881 CTACTGAAGAAAAATGAGGATGG + Intergenic
1118012140 14:61620652-61620674 CTTAATGAGAAAAATGAGAAAGG - Intronic
1118026981 14:61779378-61779400 CTGAAGAAGAGAAAAGATGCAGG - Intronic
1118268432 14:64317952-64317974 CTGAATAAGAACAATAAGCATGG - Intronic
1118807677 14:69251778-69251800 CTGAGGTAGAAGAAAGAGGAAGG + Intergenic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1118850861 14:69582304-69582326 ATTAAGAAGAAAAAGGAGGGGGG - Intergenic
1118881822 14:69834308-69834330 ATCAAGAAAAAAAATGAGAATGG - Intergenic
1119531886 14:75367557-75367579 ATGAAGAAGGAAAAAAAGGAAGG + Intergenic
1119642250 14:76324132-76324154 CTGAAGAAGGAAAAATAGGGCGG + Intronic
1119882724 14:78113827-78113849 CTAAAGAAGTAAAACAAGGAGGG - Intergenic
1119887913 14:78159488-78159510 CTCAAAAAAAAAAATGAGGTGGG - Intergenic
1119915243 14:78393553-78393575 TTGAAAAAGAAAAATGAAGTAGG - Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1119965377 14:78909577-78909599 CAGAAGAAGTCAAATCAGGATGG - Intronic
1119989835 14:79183935-79183957 CCCAAGAAGAAAATTGAGGCTGG + Intronic
1120114692 14:80601013-80601035 ATGAAGAAGAAAAATCATTAAGG + Intronic
1120242976 14:81971611-81971633 AAGAAGAAGAAAAAGAAGGAAGG - Intergenic
1120610370 14:86634335-86634357 AAGAAGAAGAAAAATGGAGAAGG + Intergenic
1120633704 14:86925267-86925289 CAGATAAAGAAAAATGAGAAGGG - Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1120935959 14:89895405-89895427 CTAAAGACGAAAAATAAGGAGGG + Intronic
1121184758 14:91956841-91956863 CTTGAGAAGAAAAATGTGCAGGG + Intergenic
1121454986 14:94032544-94032566 CGGAAGAAAAAAAATGGGTATGG + Intronic
1121538632 14:94708455-94708477 TTTAAGGAGAGAAATGAGGATGG + Intergenic
1121647792 14:95532666-95532688 CTTTAAAGGAAAAATGAGGAGGG - Intergenic
1121923297 14:97903650-97903672 GTGAAGGAGAGTAATGAGGATGG - Intergenic
1123576891 15:21679430-21679452 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1123613513 15:22121898-22121920 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1124100826 15:26691061-26691083 CTGAAGAAAAAAGAAGGGGAGGG - Intronic
1124242256 15:28038275-28038297 CTGAGGAAGAAACATGAGTAAGG + Intronic
1124664314 15:31579172-31579194 CTGAGGAAAAAACATGAGGCAGG + Intronic
1124957790 15:34370959-34370981 CGGAAGAAGGAAGAAGAGGAGGG - Intergenic
1125057654 15:35381419-35381441 AAGAAAAAGAAAAAAGAGGAAGG + Intronic
1125144546 15:36451542-36451564 ATGAAAAAGATAAAAGAGGAAGG - Intergenic
1125202786 15:37115379-37115401 GTGAAGAAGAAACATGAAGTAGG + Intergenic
1125291497 15:38153184-38153206 CTTTAAAAGAAAAATAAGGAGGG + Intergenic
1125959947 15:43821424-43821446 CTGAAGAAGAATAAAGCTGATGG + Intronic
1126122273 15:45264292-45264314 CAAAAGAAAAAAAATAAGGAAGG + Intronic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126244085 15:46483327-46483349 TGGAAGGAGAAAAATGAGGCTGG + Intergenic
1126357486 15:47811878-47811900 GGGAGGAAGAAAGATGAGGAAGG - Intergenic
1126506656 15:49412710-49412732 CTTAATTAGAAAAATGAGGGAGG + Intronic
1126553316 15:49956913-49956935 CTGAAAAAAATAAATGAGAAAGG + Intronic
1126981408 15:54248279-54248301 GTCTAGAAGAAAAATTAGGAAGG - Intronic
1127011806 15:54639184-54639206 CTGAAATAAAAAAATAAGGAGGG + Intergenic
1127246296 15:57179051-57179073 GTGAAAAAGAAAAATTAAGATGG + Intronic
1127407968 15:58672825-58672847 CTGAAAAAAAAAGAAGAGGAAGG + Intronic
1127524221 15:59776127-59776149 CTGGAGAAGAGAAATGAGCTGGG - Intergenic
1127657107 15:61065996-61066018 CAGAAGAGGAAAATTGAGCATGG - Intronic
1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG + Intergenic
1127945417 15:63745914-63745936 CTGACCAAGAAAAATGAGAGAGG - Intronic
1128092976 15:64931456-64931478 CACAAGAAGAGCAATGAGGATGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128187524 15:65655667-65655689 CTGAAGATGAAAAGATAGGACGG + Exonic
1128337639 15:66797587-66797609 CAGATATAGAAAAATGAGGATGG + Intergenic
1128825491 15:70712077-70712099 CTCAAGAAGAATCATGAAGAAGG - Intronic
1128845378 15:70890184-70890206 ATGAAGAAGAAAAATGGTGTAGG + Intronic
1129149394 15:73678252-73678274 CTCATCAAGAAAACTGAGGAAGG + Intergenic
1129544371 15:76379292-76379314 CAAAAGAAGAAAAAACAGGAAGG + Intronic
1129553470 15:76479161-76479183 ATGAGGAAAAAAAAGGAGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129735739 15:77961321-77961343 CAAAAGAAGAAAACTGAGGTAGG - Intergenic
1130525627 15:84703772-84703794 CTGAGGAAGAGATATGTGGATGG + Intronic
1130772971 15:86943659-86943681 GTGATGAAGAAAAAGGAAGAGGG + Intronic
1130874017 15:87996400-87996422 CTGAAGGAGAACCAAGAGGATGG + Intronic
1131321113 15:91392103-91392125 CTGGAGAAGACAAATATGGATGG + Intergenic
1131490336 15:92857162-92857184 CAGAAGTAGAAAGATCAGGATGG - Intergenic
1131537139 15:93246811-93246833 CAGAAGCAGAAAAATCAGCAAGG - Intergenic
1131744725 15:95434853-95434875 AGGAAGAAGAAAAAGAAGGAAGG - Intergenic
1131895521 15:97024906-97024928 CTGAAGAAGAAAAAAATTGAGGG + Intergenic
1131910460 15:97194222-97194244 ATGAATAAGAATAATGATGAGGG + Intergenic
1131938190 15:97531195-97531217 ATAAAGAAGGAAAATGAGGTAGG + Intergenic
1132117597 15:99148923-99148945 CTGAAAAACAAAAAACAGGAAGG - Intronic
1132184733 15:99793112-99793134 CTAAAAAAGAAAAATGCTGAAGG - Intergenic
1132213144 15:100041154-100041176 CTGATTAAGATAATTGAGGAAGG + Intronic
1132432250 15:101771530-101771552 CTAAAAAAGAAAAATGCTGAAGG + Intergenic
1202985759 15_KI270727v1_random:413675-413697 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1133070746 16:3245286-3245308 CTCAAGAAGAAAAGAAAGGAAGG + Intronic
1133083446 16:3342581-3342603 CTGAACAATAAAAACGAGGCCGG + Intergenic
1133096681 16:3451915-3451937 CTCAAAAAAAAAAATGAGCATGG + Intronic
1133263021 16:4564439-4564461 CTGAGGGAGTAAAATGGGGAGGG - Intronic
1133543747 16:6785185-6785207 CTGGAGAAAAAAAATGACAAAGG + Intronic
1133626563 16:7575443-7575465 TTTAAGAAGAAAAAGGAAGAGGG + Intronic
1133644549 16:7751860-7751882 ATAAACAAGAAAACTGAGGAAGG + Intergenic
1133856951 16:9558696-9558718 CTCAAAAAGAAAAATAAGGAAGG + Intergenic
1134278855 16:12800715-12800737 CTGGAGCAGAAAGATGAGGTTGG - Intronic
1134555689 16:15162068-15162090 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1134916271 16:18073779-18073801 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1135464886 16:22676702-22676724 CTGAATTAGAAAAATCAGGCAGG + Intergenic
1135833767 16:25804287-25804309 ATGCAGAAGAAAAATGAAAAAGG - Intronic
1135850704 16:25960486-25960508 CTCAATAAAACAAATGAGGAAGG + Intronic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1137348251 16:47685037-47685059 CAGAAGAAAGAAAATGTGGAAGG - Intronic
1137417906 16:48301924-48301946 CAGAAGAAGACTAATCAGGAGGG - Intronic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137497226 16:48979891-48979913 CTGAAGAACAAGATTGAGCAGGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137836077 16:51593986-51594008 CTGCAGAAGGAAACTGAGGGAGG - Intergenic
1137977292 16:53042424-53042446 GGCAAGAAGAAAAAGGAGGAGGG - Intergenic
1138013312 16:53404852-53404874 ATTAAGAAGAGAAATGAGGCCGG - Intergenic
1138313539 16:56048912-56048934 CTGAAGTAAGAAAAGGAGGAAGG - Intergenic
1138482904 16:57315823-57315845 ATGAATAAGAAAACTGAGGCTGG + Intergenic
1138821841 16:60269905-60269927 CTCAAGTAGATAAATGAAGAGGG - Intergenic
1139254468 16:65527876-65527898 CTGAAGAAAAATGAAGAGGAAGG + Intergenic
1139264865 16:65629200-65629222 CTGCAAACAAAAAATGAGGAAGG - Intergenic
1139277727 16:65743467-65743489 CTGAAGAATAAAAGTGAGATGGG + Intergenic
1139598588 16:67972319-67972341 CTGAAAAAGAAAAATTAGCCAGG + Intergenic
1139723609 16:68877483-68877505 AGGAAAAAGAAAAATGTGGAGGG + Intronic
1140139720 16:72244121-72244143 CAGAAGAAATAAAAAGAGGAAGG + Intergenic
1140264076 16:73405341-73405363 CTGAAAAAGAAAAATCAGCCAGG - Intergenic
1140269918 16:73456360-73456382 CAGAAGAAGATAAAGGAGGAAGG - Intergenic
1140468260 16:75199358-75199380 CTGAAAAAGTAAAAAGAGGCCGG - Intergenic
1140520845 16:75580182-75580204 CTGAAGAAGAATGATGTGGTTGG + Intergenic
1140553020 16:75887780-75887802 ATAAAGAAGAAAAATGATGAAGG + Intergenic
1140857472 16:78990643-78990665 TGAAAGAAGAAAAAGGAGGAAGG + Intronic
1141167694 16:81671464-81671486 CTTTGGAAGAAAAATGATGAGGG - Intronic
1141535384 16:84676248-84676270 CTGGAGAAGAGACATGTGGATGG + Intergenic
1141544148 16:84752465-84752487 TAAAAGAATAAAAATGAGGAAGG - Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1144041397 17:11414140-11414162 GTACAGAAGAAAGATGAGGAAGG - Intronic
1144445730 17:15326356-15326378 ATGAAGCTGAGAAATGAGGAGGG + Intronic
1145824648 17:27867633-27867655 CTTCAGAAGCAAAATGAAGAAGG - Intronic
1145979387 17:29002861-29002883 CTGGAGGAGAAAAGAGAGGAAGG - Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146136353 17:30324229-30324251 ATGAGCAAGAAATATGAGGAGGG + Intronic
1146168362 17:30611562-30611584 TTAAAGAAGAAAAATGTGGCCGG + Intergenic
1146205948 17:30905926-30905948 CTGAACAAGGGACATGAGGAAGG + Intronic
1146488052 17:33260138-33260160 CTAAAAAAGAAAAATGCAGAGGG + Intronic
1147134194 17:38425801-38425823 CTAAAGAAGATAGATGAGGTGGG + Intergenic
1147326370 17:39671653-39671675 CAGAGGAAGGAAAATGGGGATGG - Exonic
1147759060 17:42785777-42785799 AAGAAAAAGAAAAATGGGGAGGG - Intronic
1147912372 17:43863456-43863478 GTGAAGAAGAAAAGAGTGGAAGG - Exonic
1148019605 17:44544780-44544802 CTGAGGATGAAAAATGAGCAAGG - Intergenic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148552114 17:48556576-48556598 CTCAAAAAGAAAAAGGGGGAGGG - Intronic
1148628663 17:49089889-49089911 CTGGAGAAGACATATGTGGATGG + Intergenic
1148893666 17:50827019-50827041 CTGAAGAAGGAAAATAAAGTTGG - Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149130878 17:53300739-53300761 CTGAAAAAGAAAAATGAATTTGG + Intergenic
1149520106 17:57312331-57312353 TTGAAAAAGAAAAATTAGGAAGG - Intronic
1149612467 17:57967635-57967657 CTGAGGGAGAAGAATGGGGAGGG - Intergenic
1149958733 17:61082888-61082910 GTGAGGAAGAAAAAACAGGAGGG - Intronic
1150409038 17:64927064-64927086 ATGAAGAAGAAAACTAAGAAAGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150864090 17:68831512-68831534 CGGAAGAAGAAAATTAGGGAGGG - Intergenic
1150952987 17:69823025-69823047 CTAGAGAAGGAAAAAGAGGAGGG - Intergenic
1151029297 17:70717582-70717604 ATGAAGAAGAAAAAAAATGATGG - Intergenic
1151411840 17:73935796-73935818 ATCATGAAGAAAAATGTGGAAGG - Intergenic
1151764131 17:76123366-76123388 CTGAAAAAGAAAAAGAAGGAAGG - Intergenic
1151968783 17:77446359-77446381 CTCAAAAAAAAAAAAGAGGAAGG - Intronic
1152049800 17:77964227-77964249 CTGAAGAAGAAAAACAGAGAGGG - Intergenic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152652806 17:81503562-81503584 CTCAAAAAGAAAAAAAAGGAAGG + Intergenic
1203172753 17_GL000205v2_random:165339-165361 CTGTAGGAGAAAAATTAGGCTGG - Intergenic
1153182523 18:2451086-2451108 GGGAAGAAGAAAAAGAAGGAAGG + Intergenic
1153467921 18:5410344-5410366 CTGAATGAGAAACATGAGGCTGG + Intronic
1153822182 18:8841605-8841627 CTGAAGCAGAAAAAGGAATATGG - Intergenic
1153853731 18:9123789-9123811 TTGTAAAAGAAAAATGAGGCAGG - Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1155446782 18:25921300-25921322 CTGAAGGACAAAGATGAAGAGGG - Intergenic
1155495369 18:26437099-26437121 CAGTAGAAGAAAATTAAGGAGGG + Intergenic
1155652092 18:28154662-28154684 ATGAAAAAGAATAATGAGAACGG - Intronic
1155701167 18:28745633-28745655 CTCAAGAAAAAAAAAAAGGAGGG + Intergenic
1155729833 18:29141665-29141687 TTTAAGGAGAAAAATGAGCATGG + Intergenic
1155854828 18:30820096-30820118 CAGAAGAAGCCAAATCAGGACGG - Intergenic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1156730278 18:40185764-40185786 GAAAAGAAGAAGAATGAGGAGGG + Intergenic
1156961617 18:43038768-43038790 CCTAAGAAGAAAAAAGAAGAGGG - Intronic
1157165466 18:45354699-45354721 CAGATGAGGAAAAATTAGGAAGG + Intronic
1157236271 18:45967646-45967668 CTGAAGATGAAAAAAAAGAATGG - Intergenic
1157298385 18:46462163-46462185 CTGTAGAGGAATAATGAGGGAGG + Exonic
1158174553 18:54639765-54639787 CTGCAAAAGAAAGATTAGGAAGG + Intergenic
1158299756 18:56038096-56038118 CGGAAAAAGAAAGATGGGGAAGG - Intergenic
1158379725 18:56915940-56915962 CTGACGGAGGAAAATGTGGACGG - Intronic
1158925444 18:62253086-62253108 ATGAAGAAGAAAAATAAAGCAGG + Intronic
1158971750 18:62674602-62674624 CTGAAGAACTAAAAGCAGGAAGG - Intergenic
1159229036 18:65580900-65580922 CTGAAGTAGAGTTATGAGGAGGG + Intergenic
1159374161 18:67570400-67570422 ATGAAGAAGATTAATGAGGTTGG + Intergenic
1159591007 18:70335046-70335068 AAGAAGAAGAAAGATGAAGAAGG - Intergenic
1159678278 18:71313608-71313630 CTGAAAAATAAAAATAAGGCTGG + Intergenic
1159733018 18:72055352-72055374 ATGAACAAGGAAAGTGAGGAAGG - Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1160134739 18:76262606-76262628 CTGAAGAACAAACAGGAGGCTGG + Intergenic
1160161434 18:76474764-76474786 ATCAAGAAGAAAAAAGAGGTTGG + Intronic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160287690 18:77560121-77560143 AGGAAGTAGAAAAATGGGGAAGG - Intergenic
1160338215 18:78061764-78061786 TTGATGAAGAAAAATGTTGAGGG + Intergenic
1160356183 18:78229797-78229819 ATGAAGAAGAGAAAGGAGGGAGG - Intergenic
1160518712 18:79492281-79492303 CTCAAAATGAAAAATGAGGCTGG + Intronic
1160573187 18:79832292-79832314 CTGAGGAAGGACAGTGAGGATGG - Intergenic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1163001482 19:14370590-14370612 GTAAAGAAAAAAAATGGGGAAGG + Intergenic
1163058410 19:14740102-14740124 CTAAAAAAAAAAAAAGAGGATGG + Intronic
1163142860 19:15362252-15362274 CTGTAGAAGGAAAACAAGGAGGG + Intronic
1163208333 19:15820885-15820907 CTGAAGAAGAAAAATAACCTTGG + Intergenic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164457426 19:28420508-28420530 CTGATGAAGTAAAATGAGGGGGG + Intergenic
1164485408 19:28651656-28651678 CTGAAGAATAAAAATGGTGAGGG - Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167073696 19:47235999-47236021 AGGAAGAAGAAAAAAGAAGAAGG - Intergenic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1167618904 19:50550743-50550765 CTGCAGGAGAAAAATGAGCCCGG - Intronic
1167726094 19:51213830-51213852 AAGAAAAAGAAAAATGAGGCTGG - Intergenic
1167863745 19:52307145-52307167 CTGAAGAAGTCATATAAGGATGG - Intronic
1168210604 19:54887322-54887344 CTAAAAAAGAAAAAAGAGGCTGG + Intronic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
925441034 2:3885466-3885488 ATGAAGAAGTGAAAGGAGGAAGG - Intergenic
925476435 2:4221916-4221938 CTGGAGAAGAGAGATGGGGAAGG + Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925763927 2:7212734-7212756 CTGAGGAATAAATAGGAGGAAGG + Intergenic
926097334 2:10090483-10090505 CTGAAGAAGAAAAAGAACAAGGG - Intergenic
926097411 2:10091208-10091230 AAGCAGAAGAAAAATGAGAAGGG + Intergenic
926233018 2:11019106-11019128 AGGAAGAAGAAAAAGGAGGTGGG - Intergenic
926423978 2:12724730-12724752 CAGAAGGAGAAATATGAGGCTGG - Intronic
926574461 2:14564705-14564727 CTCAAGAAGAAGAAACAGGAGGG + Intergenic
926623864 2:15073180-15073202 TTTAAGAAGTAAAATAAGGATGG + Intergenic
926828785 2:16937170-16937192 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
927300900 2:21513075-21513097 TTCAAAAAGAAAAATGAGGAGGG - Intergenic
927629605 2:24761195-24761217 CTGAAGGAGAGGAATAAGGATGG - Intronic
928224582 2:29437207-29437229 GGGAGGGAGAAAAATGAGGAAGG - Intronic
928393499 2:30926997-30927019 CTTAAGAAAAAAAAATAGGAAGG - Intronic
928736168 2:34292101-34292123 CAGAAGAAAAGAAATGAGAATGG + Intergenic
928781633 2:34829330-34829352 CTGATGAAAAAAATTGAAGAGGG - Intergenic
929273529 2:40000394-40000416 CTGAATAAGATAAACGAGGAAGG - Intergenic
929341672 2:40826328-40826350 CTGAAGAAGAAAATTAGGGATGG - Intergenic
929421191 2:41791555-41791577 CTGAAAATGAAAAAGGAGAATGG + Intergenic
929458647 2:42085019-42085041 GGGAAGAAGAATAAGGAGGAGGG + Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930018219 2:46985191-46985213 CTCAGGAAGAAAGAAGAGGAAGG - Intronic
930200574 2:48548794-48548816 ATAAAAAAGAAAAATGAGGCCGG - Intronic
930203080 2:48563012-48563034 CTGAAGTGGGAAACTGAGGAGGG + Intronic
930349765 2:50235796-50235818 CTCAAGGATAAAAAAGAGGATGG + Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
931000756 2:57779496-57779518 CTGCAGAAGAACAGTAAGGATGG - Intergenic
931165826 2:59746680-59746702 TGGAAGAAAAAAAAAGAGGAAGG + Intergenic
931174235 2:59836858-59836880 TTGAAGAAGAATACTGATGAAGG - Intergenic
931208821 2:60173120-60173142 CTGAAGAAGAAAGAAGAGGGAGG + Intergenic
932052429 2:68412022-68412044 CTGAGGGAGAAAAAAGAGGATGG + Intergenic
932415900 2:71573795-71573817 AAGAAAAAGAAAAATCAGGAGGG - Intronic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
932985025 2:76715733-76715755 CAGAATAAGAAACATGAGAACGG + Intergenic
933002700 2:76945917-76945939 GTGAAGAACAAGAATGAGAAGGG - Intronic
933126001 2:78606907-78606929 TTAGAGAAAAAAAATGAGGAAGG + Intergenic
933377324 2:81496534-81496556 CTGAGGAAGAAAAGAGATGAAGG - Intergenic
933573741 2:84043381-84043403 GTGAAGAAGAAAGAAGAAGAAGG + Intergenic
933686445 2:85145393-85145415 ATGAGGAAGAAAAATGAAGTAGG + Intronic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
935452281 2:103223715-103223737 CTTAATAAGAAATATGAGGCCGG + Intergenic
935754870 2:106269328-106269350 CTGAAAAACAAAAATTAGCAGGG + Intergenic
936004430 2:108870405-108870427 CAGAAGGAGAAAAAAGAGAAAGG + Intronic
936045153 2:109181711-109181733 CTGGAGAAGAAAGAGGAGGCAGG - Intronic
936412137 2:112269507-112269529 CAGATGAAGAAAAATCAGCAAGG + Intergenic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
937075748 2:119105143-119105165 GTGGAGAAGAACAATCAGGAGGG - Intergenic
937483099 2:122283199-122283221 AGGAAGAAGAAAAAGGGGGAGGG - Intergenic
937636160 2:124157466-124157488 CTGAAAAAGAAACATAAGGTGGG - Intronic
937642788 2:124232609-124232631 CTCAAAAGGAGAAATGAGGAGGG - Intronic
937651813 2:124327475-124327497 CTGAATTACAAAACTGAGGAGGG - Intronic
938153965 2:128912345-128912367 CTGAAGAAGAATAATGCTGGAGG - Intergenic
938215811 2:129513139-129513161 CTAAAGAAGGAAAATGAAGTTGG - Intergenic
938264360 2:129915798-129915820 CAGAACAAGAAAACTGAGAAGGG + Intergenic
938613020 2:132968885-132968907 CTGAAGAACTAAAAAGAAGAGGG + Intronic
938621558 2:133059932-133059954 CAGAAAAAAAAAAATGAGGGAGG + Intronic
938732765 2:134159296-134159318 GGGAAGAAAAAAAAAGAGGAAGG - Intronic
938889182 2:135685295-135685317 CACAAGAAGGAAAGTGAGGAAGG - Intronic
938982830 2:136542787-136542809 CTCAAGAGGAAGAATGAGAATGG - Intergenic
939106833 2:137958677-137958699 CAGAAGAAGAAAAATGAAAAAGG + Intergenic
939113658 2:138036635-138036657 TTCAAGAAGAAAGATGAGTACGG - Intergenic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939642830 2:144661190-144661212 GTGAAGTTGAAAAATGAGGAAGG + Intergenic
939893262 2:147762616-147762638 CTGAAAAAGAAAAGTGATGAGGG - Intergenic
940481827 2:154242007-154242029 CTGAAAAAGAGAAAAGAAGAGGG - Intronic
940841870 2:158593136-158593158 TAGAAGAATAGAAATGAGGAAGG + Intronic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
941089897 2:161162258-161162280 TTGAAAAGGAAAAATGAAGAGGG - Intronic
941284680 2:163594988-163595010 CTGAAAAAGAAAAAAAAAGAAGG - Intronic
941293080 2:163700372-163700394 TTGAAGAAGAGAAAGAAGGAAGG + Intronic
941484818 2:166067035-166067057 CTGAAGGTTAAAAAGGAGGAGGG - Intronic
941515318 2:166466680-166466702 GTGAAAAAGAAAAGGGAGGAGGG - Intronic
942167942 2:173261040-173261062 CTGAAAAACAAAAGTTAGGATGG - Intronic
942381614 2:175397488-175397510 CTGAACAAGAAATATTTGGAAGG - Intergenic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942602189 2:177652700-177652722 ATGAAGGAGAAAAATCATGATGG + Intronic
943017991 2:182537662-182537684 ATGAACAAGAAAAATTAAGAAGG + Intergenic
943149217 2:184090237-184090259 CTGAAAAAGAAAAGTGAGAAAGG + Intergenic
943332260 2:186573523-186573545 ATTAAGAGGAAAAATGAGGAAGG + Intergenic
943587106 2:189754140-189754162 ATGAAAAAGGAAAAAGAGGAAGG - Exonic
943691644 2:190875432-190875454 CTGAAAAAGAAAAACGAGCCAGG - Intergenic
943725696 2:191249219-191249241 TTTAAGAAGAGAAATAAGGAGGG + Intronic
944091580 2:195917543-195917565 CTGAAGCAGAAACAAAAGGAAGG - Intronic
944208178 2:197179239-197179261 TTGAAAAAGAAAACTGATGAGGG - Intronic
944495009 2:200298306-200298328 CTGCAGAAGACAAGTCAGGAGGG - Intergenic
944522599 2:200586949-200586971 CTGAAGGAGGAAACTGAGGCAGG + Intronic
944567064 2:201002135-201002157 CTCAATAAGAAAAATGGGGCTGG + Intronic
944832686 2:203548881-203548903 CTCCAGAAGAAAAAAGAGCAGGG - Intergenic
945076479 2:206044602-206044624 GAGATAAAGAAAAATGAGGATGG + Intronic
945575071 2:211520498-211520520 ATGAAGAAGAAAGAAGAGAAGGG + Intronic
945648227 2:212528066-212528088 CTGAAGAATACAATGGAGGAGGG + Intronic
945844231 2:214924737-214924759 CTGATGAAGGAAATTGAAGAGGG - Intergenic
946118253 2:217483208-217483230 CTGAAGAAGAAAATTAAATAGGG + Intronic
946393104 2:219428573-219428595 CTGAAGAATAAAACAGAGAAGGG - Intergenic
946463663 2:219892192-219892214 AAGAGGAAGGAAAATGAGGAGGG + Intergenic
946655411 2:221940504-221940526 CTCAAGAGCCAAAATGAGGAGGG - Intergenic
946852615 2:223921838-223921860 CTGAGGATGACAAATGAGGATGG - Intronic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947266495 2:228288094-228288116 CTGAAGAAGAAACTGGAGGCTGG + Intergenic
947647350 2:231753161-231753183 CTGGAGGAGAAAAATGAGTTGGG - Intronic
947693294 2:232160522-232160544 CTGATCAAGAAAAACAAGGAGGG - Intronic
947766648 2:232642086-232642108 ATGAAAAAGACAAATGAGGCCGG + Intronic
947783639 2:232794134-232794156 CTTAAGAAGGAAAAGGGGGATGG - Intronic
947942267 2:234068232-234068254 CTGAAGAAGAAAATTGTGTTAGG - Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948483294 2:238263922-238263944 CTGAAGGAGGAAGAAGAGGAAGG + Intronic
948559007 2:238838125-238838147 CTGAAGAAGTTAAATGAATAGGG + Intergenic
948744274 2:240074920-240074942 TTGAAAAAGAACAATGAGGTGGG - Intergenic
948815133 2:240506662-240506684 CTGAGGGAGAAAAAGGGGGAAGG - Intronic
948924084 2:241082681-241082703 CTGAGGAAGAGAAGAGAGGAAGG - Intronic
1168977313 20:1976945-1976967 CTCAAGAAGAAAATGGAGCATGG - Intergenic
1169023450 20:2347972-2347994 CTGATGAATAAAAGTCAGGATGG + Intergenic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169153515 20:3309082-3309104 CTGAAGAAGAAAAACAAGGTGGG - Intronic
1169882367 20:10361206-10361228 CTGAAAAAAAAAAATGTGTAAGG - Intergenic
1169904614 20:10589422-10589444 ATGAAGAAGAAAAATAATGTTGG + Intronic
1169921837 20:10742751-10742773 CTGAAAAAGAAAAAAGAGAATGG - Intergenic
1170045019 20:12075757-12075779 TTGAAGAAGACAGATGAGAAGGG - Intergenic
1170067485 20:12329286-12329308 AAGAAGAAGAAAGATAAGGATGG - Intergenic
1170193722 20:13669417-13669439 CAGAAGAAGAAAAAAGAAAAAGG - Intergenic
1170978427 20:21188583-21188605 CTAAAAAAAAAAAATGTGGAGGG - Intronic
1171130907 20:22652275-22652297 CTGCAGAAAAAAGAGGAGGATGG - Intergenic
1171136144 20:22696328-22696350 CTGAAGAAGAACCATCAGAAAGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1172087928 20:32403343-32403365 CTGAAAAAGAAAAACGAAGGTGG - Intronic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173858323 20:46265775-46265797 AAGAAGAAGAAAAAGGAGAATGG - Intronic
1173917628 20:46720493-46720515 CTAAAGATGAAAAATGAAAAGGG - Intronic
1174588845 20:51629198-51629220 CTGAAGATGAAAAGCGAGAAGGG + Intronic
1174664560 20:52245844-52245866 CTGGGTAGGAAAAATGAGGATGG + Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1175579663 20:60088574-60088596 CTAAAGAAGAAATGAGAGGAGGG - Intergenic
1175674455 20:60934730-60934752 CTGCAAACGGAAAATGAGGATGG - Intergenic
1175745234 20:61451835-61451857 CTGCACAACATAAATGAGGAGGG + Intronic
1176328747 21:5527122-5527144 CTGTAGAATAAAAATTAGGCTGG - Intergenic
1176399010 21:6293829-6293851 CTGTAGAATAAAAATTAGGCTGG + Intergenic
1176438147 21:6695275-6695297 CTGTAGAATAAAAATTAGGCTGG - Intergenic
1176462409 21:7022345-7022367 CTGTAGAATAAAAATTAGGCTGG - Intergenic
1176485970 21:7404123-7404145 CTGTAGAATAAAAATTAGGCTGG - Intergenic
1176911170 21:14566836-14566858 CTCAAAAAGAAATATGAGAAAGG - Intronic
1177392349 21:20492553-20492575 CTGAGGAAGAAGAATGAAGTAGG - Intergenic
1177485613 21:21751508-21751530 ATGAAGGAGAAAAATTAGGCAGG + Intergenic
1177637197 21:23802638-23802660 CTGAAAAAAAAAAGTGGGGAAGG + Intergenic
1178525972 21:33329418-33329440 ATGAAACAGAAAATTGAGGATGG + Intronic
1179320874 21:40290170-40290192 CTGAAGAAGAAAATTAAAGCAGG + Intronic
1179531075 21:42020051-42020073 CACAAGAAGAACAAAGAGGAAGG - Intergenic
1180723014 22:17923398-17923420 CTGTAGAAAAAAAATGTGGTAGG - Intronic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181911732 22:26243814-26243836 CCAGAGAAGAAAAATGAGCAGGG + Intronic
1182236217 22:28878933-28878955 CTCAAAAAGAAAAAGGAAGAAGG - Intergenic
1182263153 22:29090652-29090674 TTGAAGAAAAAAAATAAGGGAGG + Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1182864207 22:33588392-33588414 CTCTAGAAGAAAGATGAGGAAGG + Intronic
1183981848 22:41545246-41545268 CGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184027464 22:41868531-41868553 CTGCAGCAGAAACCTGAGGATGG - Intronic
949196069 3:1309564-1309586 CTGAAGAAGAAGAATAAAGTTGG - Intronic
949434525 3:4013944-4013966 CAGAAGAAGTCAAATCAGGACGG + Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
949916108 3:8965850-8965872 AGGAAGAAAAAAAATAAGGAAGG - Intergenic
950242728 3:11386165-11386187 CTGAAGAAAATAAATGAAGGCGG - Intronic
950718740 3:14867733-14867755 CAGTGGAAGACAAATGAGGATGG - Intronic
950733651 3:14986477-14986499 AAGAAGGAGAAAATTGAGGAAGG + Intronic
951305551 3:21056519-21056541 AAGAAAATGAAAAATGAGGAGGG + Intergenic
951360267 3:21716666-21716688 TTTAAGTAGAAAAATGAAGAAGG - Intronic
951800265 3:26588008-26588030 CAGCAGAAGAGAAATTAGGAAGG - Intergenic
952153325 3:30616324-30616346 CTAAAGTAGGAAAATGATGAAGG - Intronic
952241201 3:31532886-31532908 AGGAGGAAGAAAAAGGAGGAGGG - Exonic
952439740 3:33313741-33313763 CTGAATAAGTTAAATGAGGCTGG - Intronic
952654258 3:35765273-35765295 CCGAAGAAGAAAAAAGATGAGGG - Intronic
952688004 3:36171956-36171978 CTGAATTACAAAAAGGAGGAGGG + Intergenic
952985528 3:38777644-38777666 TTCAAGAAGACAAATAAGGAGGG + Intronic
953029149 3:39166135-39166157 CTGAAGAAAAAAAGGGTGGAAGG + Intergenic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953420523 3:42750248-42750270 CTGGAGAAGGAAGATGGGGAAGG - Intronic
953648266 3:44775195-44775217 TTGAAGAAGAAAACTGAAAAAGG - Intronic
953750856 3:45607412-45607434 CACAACAAGAAAGATGAGGAAGG - Intronic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954068135 3:48123174-48123196 CTGAAAGATAAAAATGAGGCAGG - Intergenic
954725298 3:52603516-52603538 GAGAAGAAGAAAAAAGAGGTTGG - Exonic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955099135 3:55830254-55830276 CTGAAGATGAAACATGATAAAGG + Intronic
955777121 3:62445798-62445820 CTAAAGAGGAAAGAAGAGGATGG + Intronic
955883722 3:63575345-63575367 TGGAAGAAGAAAAATCTGGAAGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956102096 3:65779168-65779190 GTGAAGAAAAAAAATGAGTGAGG - Intronic
956312553 3:67897469-67897491 GTGAAGAAGAAAAATTGGCAGGG - Intergenic
956318656 3:67969413-67969435 CTGAAGAACACAAATGAAGAAGG - Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957157074 3:76557843-76557865 CTGAAAAGCAAGAATGAGGAAGG - Intronic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957477594 3:80746489-80746511 CTGAAGAGGAAAAATTATGATGG + Intergenic
957911854 3:86629198-86629220 TTTAAGAAGAAAAAGAAGGAAGG - Intergenic
958772458 3:98442258-98442280 CTGAAGAAGAACAAAGTTGAAGG - Intergenic
958785307 3:98591689-98591711 CTTAAGAAAAAAAATTAGTAAGG - Intronic
958868429 3:99528333-99528355 ATGAAGAAGAAAAATAATTAAGG - Intergenic
959455780 3:106559564-106559586 CTGAAGAATAAAAATAAAAATGG + Intergenic
960013916 3:112863868-112863890 CTGATGAAAAAAATTGAAGAGGG - Intergenic
960227733 3:115186488-115186510 CTGAAGATGACAAAGGGGGAAGG - Intergenic
960288921 3:115860865-115860887 CCGAGCAGGAAAAATGAGGATGG + Intronic
960365825 3:116771088-116771110 CTAAGGAAGGAAAATGAGAATGG + Intronic
960394240 3:117116999-117117021 TCAAAGAAGACAAATGAGGATGG - Intronic
960559806 3:119071770-119071792 TTGAAAAAGAAAAATGAAGTGGG - Intronic
960581686 3:119284729-119284751 CTGATGAAGGAAATTGAAGATGG - Intergenic
961106918 3:124250172-124250194 CTTAAGGAGAAAGAGGAGGAGGG + Intronic
961748286 3:129080103-129080125 CTGAAGAACAAAGAGGAGGTTGG + Intergenic
961773381 3:129266643-129266665 CAGAATAATAAAAATGAGAAAGG - Intronic
962058307 3:131897894-131897916 TTAAAGAAAAAAAAAGAGGATGG + Intronic
962593183 3:136912646-136912668 CTTAAAAAAAAAAAAGAGGAGGG - Intronic
962865938 3:139448083-139448105 AGGAAGAAGAGAAAGGAGGAAGG - Intergenic
962942208 3:140135561-140135583 CTGAAGGAGGAAACTGAGAACGG + Intronic
963002541 3:140695690-140695712 AGGAAGAGGAAAAATCAGGAAGG - Intronic
963083943 3:141419662-141419684 CGTAAGAAGGAAAATAAGGAGGG + Intronic
963108324 3:141665190-141665212 TTAAAGAAGAAAAAAGAGGCTGG + Intergenic
963180004 3:142344949-142344971 CTGAAAAAGAAAAACAAAGAGGG + Intronic
963431286 3:145207685-145207707 ATGAAAAAGAAAAAGAAGGAGGG + Intergenic
963537410 3:146544991-146545013 CTTAAGACTACAAATGAGGAGGG + Intergenic
964426142 3:156555528-156555550 TTGAAGAAGAAAGAAGAGAAAGG + Intergenic
964927770 3:161978461-161978483 CTGAGGACAAAAAATGATGAAGG - Intergenic
965023235 3:163262909-163262931 CTGAAAAAGAGAAATGAAGTTGG - Intergenic
965056530 3:163723805-163723827 CAGAAGAAGAAAAAAAAAGAGGG - Intergenic
965134672 3:164747362-164747384 TTGAATATGAAAAATGAGGCAGG + Intergenic
965306931 3:167077230-167077252 CTGCAGAAGAAAAAAAAGTAGGG + Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965944140 3:174219234-174219256 CTGAAGCAGTAAAGTGGGGATGG + Intronic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966755309 3:183364646-183364668 CTTAAGAAGAAAAAAGAGAAGGG + Intronic
967086038 3:186096157-186096179 GGGAAGAAAAAAAATGAAGAGGG + Intronic
967574081 3:191069786-191069808 CTGAAGAAGAAAAAGAAGAATGG + Intergenic
967664887 3:192159085-192159107 AGGAAGTAGAGAAATGAGGAGGG - Intronic
967692324 3:192490311-192490333 TTGATGAAGAAAAATAAAGATGG - Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968513649 4:1006123-1006145 CTCAAAAAGAAAAAAGAGGCTGG - Intergenic
969955206 4:10882414-10882436 AAGAAGAAGAAAAAGGAAGAGGG - Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970388662 4:15583989-15584011 CTGATGAAAGAAATTGAGGAAGG + Intronic
970970822 4:21981444-21981466 CAGAAGGAGAAATATGTGGAAGG - Intergenic
971017279 4:22501330-22501352 TTGAAGGAGAACAATGAGAAAGG + Intronic
971444825 4:26732025-26732047 AAGAAGAAGAAAAAATAGGAAGG - Intronic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
971860887 4:32104078-32104100 CTGAAGAGGAAAAAAAAGAAAGG - Intergenic
972025604 4:34372447-34372469 CTAAAGAAGATAATTGAGTAGGG + Intergenic
972250106 4:37290801-37290823 GTGAAGAGCAAAAATGATGATGG - Intronic
972322718 4:37987285-37987307 CTGAAAAAAAAAAAAGTGGAAGG - Intronic
972400236 4:38694924-38694946 CTTAAGAAGAAAGATGAAGTGGG - Intronic
972430019 4:38972130-38972152 CTTAAGAAGAGAAATCAGAAAGG + Intronic
972450844 4:39196819-39196841 TTGGAGCAGACAAATGAGGAGGG - Intronic
972541238 4:40041295-40041317 CAGAAGAAAAAAATTGAGGCTGG + Intergenic
972548001 4:40100013-40100035 CTTAAGAAGAAAAACAAAGAGGG - Intronic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972990505 4:44817799-44817821 CAGAAAAAAAAAACTGAGGAAGG - Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973254837 4:48099625-48099647 CTGAAAAAGAATAATGAGGGAGG + Intronic
973303976 4:48622876-48622898 CTGAAAATGAAAAATGTGAAAGG + Intronic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973802320 4:54491660-54491682 CTTGAGAAGAAAAATGAGTGGGG + Intergenic
973885773 4:55319417-55319439 ACTAAGAAGAAAAAGGAGGAGGG + Intergenic
973937769 4:55866668-55866690 GTGAATAAGAAAAATGAACACGG + Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
975411912 4:74062766-74062788 CAGAGGAAGAAAAATGGGAAAGG - Intergenic
975445461 4:74459041-74459063 TCGAAGAAAAAAAATGAAGAAGG - Intergenic
975713950 4:77187907-77187929 CTGAAGAAGAAAAAATTGGCTGG + Intronic
976359496 4:84160945-84160967 AAGAAGAAGGAAGATGAGGAAGG - Intergenic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976380881 4:84396936-84396958 ATGAAGAAGAAAAAATATGATGG + Intergenic
976776217 4:88708998-88709020 CTTAAGAAGGAAAATGTGGATGG + Intergenic
976902783 4:90199618-90199640 CTGAAGAAAAAAAATATGTATGG + Intronic
977344607 4:95801769-95801791 CTGAGGAAGATAAAAGAGGCAGG - Intergenic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977473891 4:97478743-97478765 ATGACTAAAAAAAATGAGGAAGG + Intronic
977676862 4:99757647-99757669 CTTAGGAAGAAAAAGGAGTAGGG - Intergenic
978174598 4:105714440-105714462 CTAGAAAAGAAAAAAGAGGAAGG + Intronic
978309715 4:107373042-107373064 CTGAAGGAGAAAAATAAAGTTGG + Intergenic
978310268 4:107379607-107379629 GAGAAAAAGAAAAATGAGGTGGG - Intergenic
978403764 4:108358792-108358814 CTGAAGCAGAACAAGAAGGACGG + Intergenic
978721874 4:111919714-111919736 TTGATGATGAAAAATGAGAATGG - Intergenic
979156944 4:117406145-117406167 GTGGAGAAGAAAAATCAAGATGG + Intergenic
979171983 4:117611336-117611358 GGGAAGAAGAAAGATCAGGAGGG + Intergenic
979785378 4:124711445-124711467 ATGAGGAAGAAAAATGCAGAAGG - Intronic
980876811 4:138670082-138670104 CTGAAGCAGAAGATTGAGGCAGG + Intergenic
981053634 4:140337375-140337397 CTGAAAAAGAAAAATAAAGTTGG + Intronic
981141997 4:141279304-141279326 TTGAAAAAGAAAACTAAGGAAGG - Intergenic
981895358 4:149792660-149792682 CTAAAGAAGGTAAATGAAGATGG - Intergenic
981995134 4:150965873-150965895 CTGAAGGAGAGAGATGAGCAAGG + Intronic
982463930 4:155706515-155706537 CTGAAAAAAAAAAAAGAGGAGGG - Intronic
982581888 4:157189194-157189216 CTCAAAAAAAAAAATGGGGAGGG - Intergenic
982624045 4:157742619-157742641 CTGAAAATGAAAAATGAAAATGG + Intergenic
982924243 4:161316043-161316065 ATGAAGAGGGAAAATTAGGATGG + Intergenic
983464114 4:168065219-168065241 CTGAAGTAGAAAATTAAGAAAGG + Intergenic
983535124 4:168849428-168849450 CTGCAGAAGAAAAAGGAGAAAGG + Intronic
983637325 4:169911075-169911097 CTGATGGAGGAAAAGGAGGATGG - Intergenic
984006925 4:174323306-174323328 CTGATGCAGAAACATGAGGGGGG - Intronic
984139454 4:175985040-175985062 CTGAAAAAGAAAAAGAAGGTGGG - Intronic
984448307 4:179866806-179866828 CTGAAGAGGAAAACTGGGAAAGG + Intergenic
984538936 4:181013085-181013107 CAGAAGGAGAATAAAGAGGATGG + Intergenic
985323073 4:188735530-188735552 CTGAAGAAGAAAGAAAAGGAAGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986637245 5:9835426-9835448 CAAAAGAAAAAAAATGTGGATGG - Intergenic
986668683 5:10125134-10125156 CTCAAAAAGAAAATTGGGGAAGG + Intergenic
986811979 5:11369711-11369733 GTGTTGAAGAAAAATGAGGCAGG + Intronic
986917228 5:12636149-12636171 CTGAAAAAGATAAGTGATGACGG + Intergenic
987154045 5:15070003-15070025 TTGTAAAGGAAAAATGAGGAGGG + Intergenic
987442158 5:17968967-17968989 GAGAAGAAGACTAATGAGGAGGG - Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988219964 5:28331999-28332021 ATGAAGAAGAAAAAAGAGTATGG - Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988269847 5:28999731-28999753 CTGAAGAGTTAAAATGAAGATGG + Intergenic
988690439 5:33566720-33566742 CAGAAGAAGAAAAAGGATTATGG - Intronic
989225182 5:39019119-39019141 CTGCAGAAGAAAAGTGTGAATGG + Intronic
989252094 5:39329172-39329194 CTGTAGAAGTAAAAAGGGGAGGG - Intronic
989391673 5:40906997-40907019 GTAAAGAACAAAAATAAGGAAGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989702549 5:44287389-44287411 TTGAAGAAGAAAAATCTAGAAGG - Intergenic
989985420 5:50691287-50691309 CTGAAGAGAAAACCTGAGGATGG - Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990276814 5:54205956-54205978 CAGAAGAAGAATAAGGGGGAAGG - Intronic
990575021 5:57115875-57115897 CTGAAGAACAGAAGTGAAGAAGG + Intergenic
991055531 5:62315633-62315655 ATGAAGAAGATAAGGGAGGAGGG + Intronic
991211489 5:64110047-64110069 CTCAAGAAGACATAAGAGGAAGG + Intergenic
991368910 5:65897507-65897529 CTGAGGCAGAAGAATCAGGAGGG + Intergenic
991974539 5:72173185-72173207 CTGAATAAGAAAAATGGCTAAGG - Intronic
992149032 5:73883159-73883181 CAGAAGAAGAAAAAAGGGGTGGG - Intronic
992353683 5:75957134-75957156 CTGAGGAAGAGCAATGATGATGG + Intergenic
992358939 5:76016213-76016235 GTGCAGCAGAAAAAAGAGGAAGG + Intergenic
992750831 5:79859117-79859139 CAGAAGAAGAGAAAAGAGCAAGG + Intergenic
993233955 5:85278839-85278861 CTGAAAAAGAAAAATCAATATGG + Intergenic
993941227 5:94061412-94061434 TTGAACAAGAATAGTGAGGATGG - Intronic
994005599 5:94833780-94833802 CTGCAGAAGAAAAATTGGGGTGG + Intronic
994057513 5:95434957-95434979 TTGATGAAGAAAAATTGGGAGGG + Intronic
994205430 5:97029785-97029807 GGAAAGAAGAAAAATGAGGGAGG + Exonic
994232669 5:97325840-97325862 CTCCAGAAGAAAAAACAGGAGGG - Intergenic
994587899 5:101734268-101734290 CTGAAGAAGAAAAATAAGAAAGG - Intergenic
994656191 5:102595806-102595828 CTGAAGAAAAAAAATCAGCTAGG + Intergenic
996277825 5:121689043-121689065 ATGAAGAGCAAAAATGGGGAAGG + Intergenic
996498692 5:124191610-124191632 CTGAAGTAGAAAAATATTGATGG + Intergenic
996942280 5:129022657-129022679 TTACAGAATAAAAATGAGGAGGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997143433 5:131407020-131407042 CTTAAGAAGGAAAATGGAGATGG + Intergenic
997486325 5:134234009-134234031 CAGAAGAGGGCAAATGAGGATGG - Intergenic
997718161 5:136057452-136057474 GTGGCTAAGAAAAATGAGGAAGG + Intronic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
998700084 5:144688309-144688331 CAGAAGAAGAAAGAAGAGGTAGG - Intergenic
998716121 5:144886612-144886634 GTGAAGAAAAAAAAAGAAGAAGG + Intergenic
999135159 5:149313836-149313858 ATGAAGATGAAAAATTAGCAGGG + Intronic
999171417 5:149598439-149598461 AGGAAGAAGAAAGAAGAGGAAGG - Intronic
1000380373 5:160623555-160623577 CTTTGGAAGAAAAAAGAGGACGG + Intronic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000638468 5:163671760-163671782 ATCAAGAAAATAAATGAGGAAGG + Intergenic
1000727012 5:164784373-164784395 CTAAAGAAGAGAAAGGGGGAAGG + Intergenic
1000866024 5:166515797-166515819 CTGAAGATGAAAAGTGTGGAAGG + Intergenic
1000891063 5:166803192-166803214 CAGAAGAAGAAAAATACGAAAGG + Intergenic
1000911177 5:167024481-167024503 GTGATGAAGAAAAATGGAGATGG + Intergenic
1001163669 5:169344032-169344054 CTGAAGCAAAAAAATGAACATGG + Intergenic
1001450922 5:171823669-171823691 ATAAAGAAGAAAACTGAGGTTGG - Intergenic
1002624479 5:180515601-180515623 TTGAAGTTGAGAAATGAGGAGGG + Intronic
1002652481 5:180710354-180710376 AGGATGAGGAAAAATGAGGAAGG + Intergenic
1002652548 5:180711271-180711293 ATGAAGAATAATAATGAGAATGG + Intergenic
1002695874 5:181088109-181088131 CTGAAAAATAAAAATGAAGAGGG + Intergenic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003362176 6:5438250-5438272 CTGAAAAACAAAAATGGGGGGGG - Intronic
1003515189 6:6811864-6811886 CTCAAAAAGAGAAATGACGAAGG - Intergenic
1003522930 6:6873989-6874011 CGGAAAAAATAAAATGAGGAAGG - Intergenic
1003597903 6:7490840-7490862 CTGCAGAAAAAAAAGGCGGATGG - Intergenic
1003629385 6:7772842-7772864 CTAAAGAAGAAATGTGAGAATGG - Intronic
1003681425 6:8261279-8261301 CTGATGAATGAAAATGACGATGG + Intergenic
1004100804 6:12608996-12609018 CTGGAGAAGAGAAATGGGGTTGG + Intergenic
1004275749 6:14233764-14233786 CTGAGGAAGAGAAATTTGGAAGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1004409314 6:15366015-15366037 GTGATGAAGGAAAATGAGAAAGG - Intronic
1004757059 6:18621804-18621826 CCAAAGAAGTAAAATGAGGATGG - Intergenic
1004786281 6:18971408-18971430 ATGAAAAAGAAAAATGAATAGGG - Intergenic
1005037827 6:21573312-21573334 CTGAAGAAGAAAAACAATGATGG - Intergenic
1005369516 6:25116549-25116571 TTGAAAAAGAAAAATTAAGAAGG - Intergenic
1005417094 6:25611589-25611611 GAGAAAAAGAAAAGTGAGGAAGG + Intronic
1005442846 6:25889788-25889810 ATGAAACAAAAAAATGAGGAGGG + Intergenic
1005701077 6:28400668-28400690 ATGAAAAAGAAAAATGGTGAGGG + Intergenic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1005942381 6:30570376-30570398 CTGAAGAAAACAAAGGAGGGAGG + Intergenic
1006277587 6:33018046-33018068 GTAAAGAAGAAAGATGAGGGTGG - Intergenic
1006290092 6:33128204-33128226 CTATAGAAGAAAAATGGGGTCGG - Intergenic
1006418188 6:33917705-33917727 CTGAAGCAGAAACATGAAGAAGG - Intergenic
1006590317 6:35150443-35150465 CTGATGAAGTACAAAGAGGAGGG - Intergenic
1006609444 6:35285040-35285062 AGGAAGAAGAGAAATGAGAAAGG - Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007235615 6:40389716-40389738 ATGAATGAGAAAGATGAGGAGGG + Intergenic
1007407364 6:41642743-41642765 CCGTGGAGGAAAAATGAGGAAGG - Intronic
1007647453 6:43393970-43393992 CAGAAGAAGAAAAATGAGTAAGG + Intergenic
1007771968 6:44199498-44199520 CTGAAGAAGAAAAAGAAGAGGGG - Intergenic
1007828922 6:44623225-44623247 AGAAAGAAGAAAAAGGAGGAAGG - Intergenic
1007949741 6:45860654-45860676 CTAATGAGGAAGAATGAGGATGG + Intergenic
1008124751 6:47655650-47655672 CTAAGGAAACAAAATGAGGAAGG + Intergenic
1008491408 6:52090589-52090611 CTGAAGAAATAAAGAGAGGAGGG - Intergenic
1008521690 6:52367726-52367748 GTGTAGAGGAAAGATGAGGATGG + Intronic
1008928744 6:56914911-56914933 CTAAGGAAGGCAAATGAGGAAGG + Intronic
1009435852 6:63617807-63617829 ATGAAGAGCAAAAATGAAGATGG - Intergenic
1009451671 6:63808302-63808324 ATGAAGAAGAAAAGTGAGAGTGG + Intronic
1009585024 6:65589329-65589351 CTGAAGAAGAGCACTGAGTAAGG - Intronic
1010245530 6:73658518-73658540 CTAAAGAATAAATATGAGGCCGG - Intergenic
1010289216 6:74115964-74115986 CTGAAGAAGGAAAAAGAGATTGG - Intergenic
1010848213 6:80738465-80738487 CTGAAAAAAAAAAAAAAGGAAGG - Intergenic
1010863754 6:80946829-80946851 TTGAAGTAGATAAATGAGGAAGG - Intergenic
1011012885 6:82721874-82721896 GTTAAGAAGAAATAAGAGGAAGG - Intergenic
1011222802 6:85074476-85074498 CAGAAAAGGAAAAGTGAGGATGG + Intergenic
1011390602 6:86848417-86848439 CTGAAGAAGAAATAGAAGGTTGG - Intergenic
1011556837 6:88578653-88578675 TTGAAGAAGAAAAATAAAGTTGG - Intergenic
1011869439 6:91874080-91874102 CCAGAGAAGAAAAATGAGGCTGG + Intergenic
1012330965 6:97986600-97986622 AGGAAGAACAAAAATGAGGGTGG + Intergenic
1012443733 6:99287738-99287760 CTCAAGAAGTAACATGAGAAGGG - Intronic
1012744682 6:103070599-103070621 CTGATGAAAAAAATTGAAGAGGG + Intergenic
1012874184 6:104706584-104706606 CTGAAGGACAAAGAAGAGGATGG + Intergenic
1013004086 6:106054666-106054688 CTGAAGAAGTAAAATGCACATGG - Intergenic
1013207825 6:107960060-107960082 GTGCAGAAAAAAAGTGAGGAGGG - Intergenic
1014207597 6:118672993-118673015 ATGATGAAGAAAGATGAGGGAGG + Intronic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014598049 6:123369861-123369883 GTGAAGGAGAAAACTGATGAGGG - Intronic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1014925518 6:127266433-127266455 TTCAAGAAAAAAAATGGGGAGGG - Intergenic
1015132815 6:129833036-129833058 TTGAAAAAGAAAAATGATGCAGG + Intronic
1015495467 6:133877836-133877858 TTGAAGAAAAAAAATGGGCATGG + Intergenic
1015557295 6:134476402-134476424 CTGCATCAGAATAATGAGGAAGG - Intergenic
1015590608 6:134819331-134819353 GAGATGAAGAAAAATGAGGGGGG - Intergenic
1015969194 6:138727497-138727519 TGGAAAAAGAAAAATGAGGCAGG + Intergenic
1016048724 6:139507156-139507178 ATGAAAAAGAAAAAGGAGAATGG - Intergenic
1016447261 6:144146882-144146904 CTGAAAAAGTAAATTGTGGATGG + Intergenic
1016447350 6:144147703-144147725 CTGAAAAAGTAAATTGTGGATGG - Intergenic
1016524431 6:144985536-144985558 CAGAAGAAGAAGAATGGGAAAGG - Intergenic
1016573961 6:145546825-145546847 TTGAAGGGGTAAAATGAGGAGGG - Intronic
1017042189 6:150316476-150316498 CTGGAAGAGAAAAGTGAGGAGGG + Intergenic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017481804 6:154864876-154864898 CTGCAGAAGAAGAATTAGGCTGG - Intronic
1017659519 6:156660032-156660054 CAGAAGGAGAAAAAAGAGAAAGG + Intergenic
1018694331 6:166379731-166379753 CTGATGAAGTAAAAAGAGGAAGG + Intronic
1018954661 6:168400716-168400738 CTAAGGAAGAAACATGAGGCAGG - Intergenic
1019233810 6:170591588-170591610 CTACAGAAGAAAAAAGAGCACGG + Intergenic
1019971119 7:4541684-4541706 TTGAAGAAGGAAAACAAGGAAGG - Intergenic
1020355622 7:7271955-7271977 CTCAAGATAAAAAATGTGGAAGG + Intergenic
1020406093 7:7836391-7836413 CTAATGAAGAAAAATCAGGTTGG - Intronic
1020690291 7:11346671-11346693 GTGAAGAAGAGAAGAGAGGAGGG - Intergenic
1020729423 7:11862981-11863003 CTAAAGAAGAAAAATTAATATGG - Intergenic
1020949284 7:14654370-14654392 CTGATGAAAAAAATTGAAGAGGG + Intronic
1021124643 7:16837082-16837104 CTGCAGATGAAAAATGAGAGTGG + Intergenic
1021205874 7:17780247-17780269 CTGAACAAGAATGATGAGAATGG - Intergenic
1021447124 7:20745769-20745791 GTGAGGAAGAAAAATGATAAAGG - Intronic
1021563728 7:21995565-21995587 CTGAAAAAGAAAAACTATGAGGG + Intergenic
1022353767 7:29591055-29591077 TTGAAAAAGAAAAATGAAGCTGG - Intergenic
1023091851 7:36624919-36624941 CTGAAACAGTAAAAAGAGGAAGG - Intronic
1023305825 7:38825892-38825914 CTGATGCAGAGAAATGAGGACGG + Intronic
1023446035 7:40232572-40232594 ATTAAGAAGAAAAATGGGGTAGG + Intronic
1023581618 7:41690131-41690153 AAGAAGAAGAAAGAAGAGGAGGG - Exonic
1023648192 7:42341219-42341241 ATGAAAAAGAAAAATGGGCAAGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024558616 7:50624727-50624749 GTGAGAAAGAAAACTGAGGAAGG + Intronic
1024763947 7:52633942-52633964 ATGAAGAAGAACAATTAAGAGGG - Intergenic
1024862106 7:53856762-53856784 CTGAAGAAATACAATGAGGCTGG - Intergenic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1025057917 7:55779961-55779983 AAGAAGATGAAAAATGAGGCTGG - Intergenic
1025800433 7:64781785-64781807 CTGAAGAAAATAATGGAGGATGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1026659257 7:72284928-72284950 CTGTAGAGGAAAAAAAAGGAAGG - Intronic
1027595717 7:80171418-80171440 CTGACGAAGAAAAATATTGAAGG + Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027869365 7:83687214-83687236 TGCAAGAAGAAAAATAAGGAAGG + Intergenic
1028105566 7:86873736-86873758 TTGATGAAAAAAATTGAGGATGG + Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028305223 7:89254953-89254975 TTAAAGAAGAAAAATAAAGAGGG + Intronic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1028753525 7:94409478-94409500 GGGAAGAAGAAGAATGAAGATGG + Intronic
1028975706 7:96911235-96911257 CTTAAGAAGAAAGATGGTGAGGG - Intergenic
1029328200 7:99828097-99828119 CTGAAAAAGAAAACTGGTGATGG + Exonic
1029651129 7:101892897-101892919 CTGAAGAAGGAAAAAGAGAAAGG - Intronic
1029838108 7:103334462-103334484 CTGAGGCAGAAGAATGAGGCAGG + Intronic
1030318640 7:108141728-108141750 CTGGAGAGCAAAAATGAGGGTGG + Intergenic
1030521188 7:110600060-110600082 CTGCAAAAGTAAAATGTGGAAGG + Intergenic
1030680470 7:112428532-112428554 CTGAAGAGGAAATAGGATGAAGG + Intronic
1030828280 7:114188282-114188304 ATGAAGAAGAAAAACTAGGCAGG - Intronic
1031096801 7:117429724-117429746 CTGAAAAAGAAGAATAAAGAAGG + Intergenic
1031368313 7:120931514-120931536 CTGAAGAAGTAAATTATGGATGG - Intergenic
1031779946 7:125948173-125948195 CTGAAGAAAAAAAAACAGAAAGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1032026565 7:128447247-128447269 CTGTGGAAGTAAAGTGAGGATGG - Intergenic
1032139554 7:129315084-129315106 CAGAAGGAAAAAAATGAAGATGG - Intronic
1032457258 7:132082790-132082812 ACAAAGAAGAAAAAGGAGGAAGG + Intergenic
1032540581 7:132699712-132699734 CTCAAAAAAAAAAAAGAGGAAGG + Intronic
1032624339 7:133573644-133573666 CAAAAGAAGAAAAGAGAGGAGGG - Intronic
1032768800 7:135026884-135026906 CTGAGGAATAAAAATGAGATGGG - Intronic
1032847235 7:135762056-135762078 CTCAGGGAGAAAAATGACGAAGG + Intergenic
1033416468 7:141166066-141166088 CTGAGGAAGAAAAAGCAGGCTGG + Intronic
1033832587 7:145271469-145271491 AGGAAGAAGAAAAAGAAGGAAGG + Intergenic
1033840910 7:145371931-145371953 AAGAAGAAGAAAAATAAGGTGGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034103591 7:148471935-148471957 CAGAACGAGAAAAAGGAGGAAGG + Intergenic
1034233402 7:149550204-149550226 CTGAAGAAGAAAAGAGGGGTTGG + Intergenic
1034983462 7:155493006-155493028 TTAATGAGGAAAAATGAGGACGG + Intronic
1035280184 7:157773502-157773524 CTGATGGAGAAAACTGAGCACGG - Intronic
1036071598 8:5446552-5446574 CTGAAGAAGAACAAAGTTGAAGG + Intergenic
1036076145 8:5503042-5503064 CAGATGGAGCAAAATGAGGAAGG - Intergenic
1036278134 8:7374528-7374550 CTGGAGAAGAAAACACAGGATGG + Intronic
1036343388 8:7937363-7937385 CTGGAGAAGAAAACACAGGATGG - Intronic
1036731136 8:11265929-11265951 TTTTTGAAGAAAAATGAGGAGGG - Intergenic
1036838727 8:12098125-12098147 CTGGAGAAGAAAACACAGGATGG - Intergenic
1036860515 8:12344369-12344391 CTGGAGAAGAAAACACAGGATGG - Intergenic
1037323389 8:17664910-17664932 CTAAAGAAGAAAAAAAAGGTGGG + Intronic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037612906 8:20491405-20491427 CTGTTCAAAAAAAATGAGGAAGG + Intergenic
1037851013 8:22328372-22328394 CTGAAAAAGAAAAATAAAGTTGG - Intronic
1038547685 8:28438379-28438401 AAGAAGAAGAGAAATGGGGACGG + Intronic
1038552227 8:28480179-28480201 CTGAAAAAGGAAAATGATAAAGG - Intronic
1039005136 8:33027811-33027833 CTGAAGAAGAATAAACAGAAGGG - Intergenic
1039118766 8:34122243-34122265 CTGAAGAAGACAAAAGAGTCTGG + Intergenic
1039252738 8:35684559-35684581 CTGAGAGAGAAAAATGGGGAGGG - Intronic
1039558450 8:38494148-38494170 CTGAGGAAGAAAAATGGGCCAGG + Intergenic
1039598527 8:38812752-38812774 ATGAAGGGGAAAAATGAGGATGG - Intronic
1039837353 8:41267320-41267342 CTGATGAAGATAAATGAGCGTGG + Intronic
1039968756 8:42303801-42303823 ATGCAGAAGAAAAATGGGGCTGG - Intronic
1040709047 8:50165647-50165669 CTGAAGAAGGAAAATAAAAATGG - Intronic
1041674483 8:60524245-60524267 CTGAAGAATTAAAATGAAGGAGG - Intronic
1041854922 8:62440675-62440697 AAGAAGAAGAAAAAGAAGGAAGG - Intronic
1041899929 8:62970946-62970968 CAGAAAAAGAAAAATGACAATGG + Intronic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042884596 8:73533991-73534013 CTATGGAACAAAAATGAGGAGGG + Intronic
1043005922 8:74818528-74818550 CTGAAGAAGAATAAGCATGAAGG - Intronic
1043035964 8:75199689-75199711 CTGAAGAAGGAAATTGAAGAGGG - Intergenic
1043039716 8:75247308-75247330 CTGAAGGAGAAAAATGAATAGGG - Intergenic
1043425326 8:80142539-80142561 CTGAAGTACAAAAATGAGCCAGG + Intronic
1043430755 8:80192283-80192305 CAGAAGAAGAAAATAGATGATGG - Intronic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043740856 8:83809828-83809850 CTGATGAAAAAAAATTAGAATGG - Intergenic
1043764238 8:84109399-84109421 ATGAAAAAGAAAAATAAGGAAGG - Intergenic
1044245450 8:89939206-89939228 ATGAAAAAGAAAAATAGGGAGGG + Intronic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1044464461 8:92487442-92487464 TCAAAGATGAAAAATGAGGAGGG + Intergenic
1044503037 8:92983875-92983897 CTGAAAAATAAACATGAGAATGG + Intronic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1045209506 8:100082050-100082072 CTCAAGTAAAAAAATTAGGAGGG + Intronic
1045411744 8:101927169-101927191 GTGAAGAGGTAAAATGAGGTGGG - Intronic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046522505 8:115343447-115343469 TTGCAGAAGGAAAATGGGGAAGG - Intergenic
1046560870 8:115835932-115835954 TTGAAGAGGAAAGATGAGAAAGG + Intergenic
1047080072 8:121450142-121450164 GTGAAGATTAAAAATGAGCAAGG - Intergenic
1047083720 8:121493479-121493501 ATGTTGGAGAAAAATGAGGATGG + Intergenic
1048106880 8:131420686-131420708 ATGAAGGAAAAAAAAGAGGAAGG - Intergenic
1048155851 8:131950234-131950256 CTGAAGTAGCAAAATGAGAATGG + Intronic
1048285083 8:133135254-133135276 CTGAAGCAAGACAATGAGGATGG + Intergenic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1048984148 8:139723237-139723259 CTGACGAAGCAACATGAGAAAGG - Intergenic
1049004570 8:139846516-139846538 AATAAGAAGAAAAATGAAGATGG + Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049183710 8:141237571-141237593 CTGGAGGAGAAAGATTAGGAAGG - Intronic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050308731 9:4331671-4331693 ATGACGAAGAAATATGATGAAGG + Intronic
1050625816 9:7502603-7502625 GTGAAGTAGAATTATGAGGAAGG + Intergenic
1050910619 9:11065000-11065022 CTGACGAAGAAAAGGGAAGATGG - Intergenic
1051311865 9:15783596-15783618 GTGAAGTATAAAAAAGAGGAAGG - Intronic
1051352927 9:16215280-16215302 CTGCAGAACAAAAACGAGGTGGG + Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051517746 9:17949680-17949702 CTGGAGAAGAAAGATAAGAAAGG - Intergenic
1051518009 9:17952248-17952270 CTAAAGAAAAAAAATGAGGCTGG - Intergenic
1051581784 9:18684039-18684061 GTGGAGGAGAAAAATGAAGAGGG - Intronic
1051798889 9:20908628-20908650 CTGAAGATAAAAATTGAGTAAGG - Intronic
1051908486 9:22125220-22125242 CTGAAGAAGTAAAAAAAGAATGG + Intergenic
1052088946 9:24303263-24303285 CAGAAGGAGAAAAATGAGAAAGG - Intergenic
1052364092 9:27591857-27591879 CTGAGGCAGAAAACTGACGAAGG + Intergenic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1052496984 9:29239666-29239688 CTGAATCAGAAATTTGAGGATGG + Intergenic
1052982915 9:34461893-34461915 CAGAAAAAGATAAAGGAGGATGG + Intronic
1053202226 9:36160573-36160595 CAGAAGAAAAAAAATGTGCAAGG + Intronic
1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054637341 9:67506852-67506874 ATGAAGAAGCCAACTGAGGAAGG - Intergenic
1054721213 9:68605775-68605797 CTGAAAAATAAAAATGAGGTAGG + Intergenic
1054723856 9:68630629-68630651 GTGAAGGAGAAAAAGGAGGAGGG + Intergenic
1055049825 9:71967450-71967472 ATGAAAATGAAAAATGAGGTTGG - Intronic
1055096037 9:72415008-72415030 CTCAAGAAAAAAAAAGAAGAGGG + Intergenic
1055164842 9:73178627-73178649 CTGAAGCTGAAAATGGAGGATGG + Intergenic
1055328694 9:75159661-75159683 CTAAAGAAGAAAAATGCAGCTGG - Intergenic
1055601839 9:77927572-77927594 CTGAAGAAAAAAAAGGGGGTGGG + Intronic
1056026389 9:82500739-82500761 ATGAAGTAGAAAAATAAAGAAGG - Intergenic
1056395102 9:86174744-86174766 ATGAACAAGACAAATGAGGTGGG - Intergenic
1056417014 9:86386536-86386558 CTGAAGGAGAAAGGTGAGAATGG + Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056623010 9:88230281-88230303 CTGAAAAAGAAAAATAATGAGGG - Intergenic
1056685262 9:88753883-88753905 CTGAAGAAGAAAAGTGAATCAGG - Intergenic
1057344052 9:94231987-94232009 CTGAAGAAACAAAGTGAGGTGGG + Intergenic
1057737152 9:97673778-97673800 TTGAAAATGAAAGATGAGGAAGG + Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058116509 9:101090966-101090988 GGGAAGAAGAAAAGGGAGGAGGG - Intronic
1058199306 9:102019011-102019033 CTCAAGAAGAAATATGTGGATGG + Intergenic
1058242850 9:102587922-102587944 TTGAAGAAGAAAATAAAGGATGG - Intergenic
1058250737 9:102692589-102692611 CAGAAGATGAAAAATGATGAAGG + Intergenic
1058292207 9:103256797-103256819 GTGCAGAAGAAAAATGTGGTTGG - Intergenic
1058341776 9:103906179-103906201 CTCAGGAAGAAAAATGGGGAAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058858641 9:109092111-109092133 CTGAAGAGAAAGAATGAGAAAGG - Intronic
1059222513 9:112638202-112638224 TTGAAAAAGAAAAATAAAGAAGG + Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1059993812 9:119890460-119890482 CTGGAGAATAAAAATGACCAAGG + Intergenic
1060328276 9:122640144-122640166 GTAAAGAAGGAAAATGAAGAAGG - Intergenic
1060761899 9:126260089-126260111 TTCAAGAGGAAAAATGAGAAAGG - Intergenic
1061365231 9:130169181-130169203 TGAAAGAAGAAAAATGAGGCGGG - Intergenic
1061777946 9:132978221-132978243 AGGAAGAAGGAAAATAAGGAAGG + Intronic
1061934959 9:133852361-133852383 CAGAAGAATAAAAAGAAGGAAGG + Intronic
1062676205 9:137745983-137746005 ATCCAGAAGAAAAATGAGCAGGG - Intronic
1203433362 Un_GL000195v1:113340-113362 CTGTAGGAGAAAAATTAGGCTGG + Intergenic
1185668080 X:1784027-1784049 CAAAAGAAGAAAAGTGAGGAAGG + Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1186094193 X:6082211-6082233 TTGAAAAAGACAAATGAGGTAGG + Intronic
1186322374 X:8443021-8443043 TTGAAGAAGAAAAATGATTATGG - Intergenic
1186393383 X:9183201-9183223 GTGAAGGAGAAAAATGGGGGTGG - Intergenic
1186796788 X:13054422-13054444 CTGAAGAATGAAACTGAGAAGGG - Intergenic
1186854613 X:13613893-13613915 TTGAAGAAAAAAAATGGGGATGG - Intronic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1188135444 X:26488960-26488982 CTTAAGTAGAAAAAAGAAGATGG - Intergenic
1188269297 X:28118878-28118900 GGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1188503657 X:30857400-30857422 CTGAAGGAAAAAAATATGGAAGG + Intronic
1188519288 X:31020108-31020130 CTGAAGAGGAGGAATAAGGAGGG + Intergenic
1188519673 X:31024235-31024257 CTGAAGAAGAAAGATAAGGTAGG - Intergenic
1188531354 X:31144790-31144812 CAGAGAAAGAGAAATGAGGAAGG + Intronic
1188661194 X:32760897-32760919 ATGAAGAAGAAATAAGAGGAAGG - Intronic
1188955095 X:36424831-36424853 CATAAGAAGGAAAATGAGGTTGG + Intergenic
1189058542 X:37727180-37727202 TGGAAGAAGAGAAATGAGGCAGG + Intronic
1189097891 X:38159445-38159467 CTGATGAAGAAAAATTGGGCTGG - Intronic
1189173057 X:38927667-38927689 TGGAACAAGAAAAATTAGGAGGG - Intergenic
1189197089 X:39161989-39162011 CAGAGGAAGAAAAATGAAGTTGG - Intergenic
1189237828 X:39501859-39501881 CTGAAAAAGAAAAAGGCAGAAGG + Intergenic
1189765954 X:44372427-44372449 CTGAAGGGGATAAAGGAGGAAGG - Intergenic
1190021874 X:46886044-46886066 ATGAGGAAGAAAATTGAGGCTGG + Intergenic
1190176808 X:48157432-48157454 CTGTTGAAGAGAAATGAGCATGG - Intergenic
1190194484 X:48305339-48305361 CTGTTGAAGAGAAATGAGCATGG + Intergenic
1190583596 X:51914103-51914125 CTGAGGAAGAAAAATAAAGTTGG - Intergenic
1190660986 X:52653964-52653986 CTGTTGAAGAGAAATGAGCATGG + Intronic
1190718797 X:53129383-53129405 AAGAAGAAGAAAAATCAGGCTGG - Intergenic
1190723911 X:53174065-53174087 CTGAAGAAGAACTATGATGGAGG + Intergenic
1190799076 X:53771822-53771844 CTTAAGAAGGAAAAAGTGGAAGG + Intergenic
1190883059 X:54507102-54507124 CTTAAAAAGAAAAATCAGGCCGG - Intergenic
1191012537 X:55775477-55775499 CTGAAGAAGTAAAGAGAGCATGG + Intergenic
1191104663 X:56765049-56765071 ATGAAGAAGAAAAAAGTGAAGGG - Intergenic
1191107644 X:56781617-56781639 GTGAAGAAGAAAAAAGTGAAGGG - Intergenic
1191109098 X:56791147-56791169 GTGAAGAAGAAAAAAGTGAAGGG - Intergenic
1191790336 X:64965229-64965251 CTGAGGAAGAATAATGAAGTTGG + Intronic
1191860676 X:65664654-65664676 CTGAGGGAGAAAGATGAGGTTGG - Intronic
1191927692 X:66331423-66331445 CTGAGAAAGAAAAATGAGAGAGG - Intergenic
1192295566 X:69844081-69844103 TTGAAGAAGAAAAAAGGGGGTGG + Intronic
1192339051 X:70247178-70247200 CTACAGAAGAAAAATTAGCAAGG + Intergenic
1192480795 X:71483814-71483836 CAGAAGAAAAAAAATAATGAGGG - Intronic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1192918354 X:75678873-75678895 TTAAAAAAGAAAAATGAAGAGGG + Intergenic
1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG + Intergenic
1193981186 X:88184025-88184047 CTGAAGAAGAAAAAGCTGGAAGG - Intergenic
1194101704 X:89713527-89713549 CAGAACAAGAACAATGAGAAAGG - Intergenic
1194113733 X:89871139-89871161 GAGAAGAAGAAAAATTAGGCAGG - Intergenic
1194189179 X:90813553-90813575 CTGGAGAATAAAAATCAGCATGG + Intergenic
1194363776 X:92988654-92988676 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1194547052 X:95249603-95249625 TTTAAGAAGAAATGTGAGGAAGG + Intergenic
1194769346 X:97882140-97882162 TGGAAGAGGTAAAATGAGGATGG - Intergenic
1194847735 X:98832531-98832553 AACAAGAAGAAAAAGGAGGAAGG - Intergenic
1194946266 X:100071909-100071931 CTACAAAAGAAAAATGATGATGG + Intergenic
1194965365 X:100282298-100282320 CTGATGAAGGAAATTGAAGAGGG - Intergenic
1195084982 X:101405622-101405644 CTAAAAAAGAAAAAAGAGGCCGG + Intronic
1195309405 X:103616246-103616268 GGGAAGAAAAAAAAGGAGGATGG - Intronic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195526248 X:105893385-105893407 GTGAAGAAGCAAAATATGGAGGG - Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196022812 X:111007872-111007894 CTCTAGAAGACAAATGAGAAAGG + Intronic
1196421873 X:115530891-115530913 CATAGTAAGAAAAATGAGGAAGG + Intergenic
1196461069 X:115931720-115931742 TTCAAAAAAAAAAATGAGGAGGG - Intergenic
1196471713 X:116036072-116036094 CTGGAAAAGAAAAATCTGGAGGG - Intergenic
1196480748 X:116144650-116144672 CTTTAGAAGAAAAATGATGGAGG - Intergenic
1196581108 X:117380087-117380109 CACAAGAAGAAAAAGGAAGATGG + Intergenic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1196736461 X:118985113-118985135 CTCAAGTAGTAAAATGAAGAAGG + Intronic
1197087785 X:122499441-122499463 CTGTAGAAGAAACAGGATGAAGG - Intergenic
1197375654 X:125678979-125679001 CTGAAGAATAAAAGTGATGAAGG + Intergenic
1197565469 X:128079041-128079063 CTCATGAAGACAAATTAGGATGG + Intergenic
1197592468 X:128425420-128425442 GTAAAGAAGAAAAATGAGATAGG + Intergenic
1197765296 X:130056150-130056172 CGGAAGGAGAAAGAAGAGGAGGG - Exonic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1197905429 X:131419861-131419883 TTGAAGAAGAAAAATAATGAAGG + Intergenic
1198021150 X:132659273-132659295 CGAAAAAAGAAAAATGAGGCTGG - Intronic
1198155454 X:133955429-133955451 CTTATGAAGGAAAATGAGGAGGG - Intronic
1198381769 X:136090805-136090827 TTGAAGAAGAACAATAAGGTGGG + Intergenic
1198385037 X:136120749-136120771 TTGAAAAAGAAAAATGAAGTTGG - Intergenic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198744925 X:139880156-139880178 CTCAAGATGAAAGATGATGAGGG + Intronic
1198869935 X:141167244-141167266 GTGATGGTGAAAAATGAGGATGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199426623 X:147709294-147709316 CTGAAGTAATAAAAAGAGGATGG + Intergenic
1199549861 X:149047619-149047641 CTGAAAAAGAAAAATATAGATGG - Intergenic
1199579498 X:149347189-149347211 CTCAAGAAGAAAAGGGAGGAAGG - Intergenic
1199707809 X:150445872-150445894 TTCAATAAGAAAAATGAGGAAGG + Intronic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1199876021 X:151929154-151929176 CTGAGGAAGAAAAGTGGGAAGGG + Intergenic
1199975135 X:152890320-152890342 ATGATGAAGAAAACTGAGGGAGG + Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200454652 Y:3374611-3374633 CAGAACAAGAACAATGAGAAAGG - Intergenic
1200466411 Y:3526177-3526199 GAGAAGAAGAAAAATTAGGCAGG - Intergenic
1200535759 Y:4395446-4395468 CTGGAGAATAAAAATCAGCATGG + Intergenic
1200672008 Y:6104893-6104915 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201060954 Y:10046404-10046426 CTCAAGAAGACAACAGAGGAAGG - Intergenic
1201467494 Y:14299547-14299569 CTGAAGAAAATAAAAGAAGATGG + Intergenic
1201541060 Y:15105448-15105470 AAGAAGAAGAAAGAAGAGGAGGG - Intergenic
1201637611 Y:16142750-16142772 CGGAAGAAAATAAAGGAGGAAGG - Intergenic
1201854700 Y:18528701-18528723 CTGAAGAAGAAAAAAGCTAAAGG - Intergenic
1201860959 Y:18596801-18596823 CTAAAAAAAAAAAATGAGAAAGG - Intergenic
1201872364 Y:18723579-18723601 CTAAAAAAAAAAAATGAGAAAGG + Intergenic
1201878621 Y:18791684-18791706 CTGAAGAAGAAAAAAGCTAAAGG + Intronic