ID: 968468558

View in Genome Browser
Species Human (GRCh38)
Location 4:765625-765647
Sequence CTGAAGCAGGAAACCAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968468552_968468558 -10 Left 968468552 4:765612-765634 CCTTTGGGCCCCTCTGAAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 171
Right 968468558 4:765625-765647 CTGAAGCAGGAAACCAATGGTGG 0: 1
1: 0
2: 0
3: 16
4: 182
968468550_968468558 -2 Left 968468550 4:765604-765626 CCCTGGGGCCTTTGGGCCCCTCT 0: 1
1: 1
2: 1
3: 25
4: 248
Right 968468558 4:765625-765647 CTGAAGCAGGAAACCAATGGTGG 0: 1
1: 0
2: 0
3: 16
4: 182
968468541_968468558 23 Left 968468541 4:765579-765601 CCATGAGTGCCATGAGCAGAGGG 0: 1
1: 0
2: 2
3: 15
4: 209
Right 968468558 4:765625-765647 CTGAAGCAGGAAACCAATGGTGG 0: 1
1: 0
2: 0
3: 16
4: 182
968468549_968468558 -1 Left 968468549 4:765603-765625 CCCCTGGGGCCTTTGGGCCCCTC 0: 1
1: 0
2: 1
3: 37
4: 298
Right 968468558 4:765625-765647 CTGAAGCAGGAAACCAATGGTGG 0: 1
1: 0
2: 0
3: 16
4: 182
968468551_968468558 -3 Left 968468551 4:765605-765627 CCTGGGGCCTTTGGGCCCCTCTG 0: 1
1: 0
2: 5
3: 33
4: 297
Right 968468558 4:765625-765647 CTGAAGCAGGAAACCAATGGTGG 0: 1
1: 0
2: 0
3: 16
4: 182
968468544_968468558 14 Left 968468544 4:765588-765610 CCATGAGCAGAGGGTCCCCTGGG 0: 1
1: 0
2: 5
3: 25
4: 260
Right 968468558 4:765625-765647 CTGAAGCAGGAAACCAATGGTGG 0: 1
1: 0
2: 0
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968468558 Original CRISPR CTGAAGCAGGAAACCAATGG TGG Intronic
900187762 1:1340303-1340325 CTGAAGGAGGAGGCCTATGGAGG + Exonic
900271972 1:1795254-1795276 GTGAACCAGGAAGCCAGTGGAGG - Intronic
904516028 1:31056057-31056079 CTGTAGCAGGAAATCAAGGTAGG - Intronic
905945859 1:41901000-41901022 CTGCAGCAGTCAAGCAATGGTGG + Intronic
907196971 1:52694961-52694983 CTGAAACAGTAAACCACTGGAGG + Intronic
907299429 1:53477319-53477341 CTGCAGCAGGCAACCAAAGCAGG - Intergenic
907496062 1:54845584-54845606 CTCAAGCAGGTTACCACTGGGGG - Intergenic
910295286 1:85637842-85637864 CTGAAGAAGCAAACCTATGAAGG + Intergenic
910338747 1:86162074-86162096 CTGAAGCAGGAAAAAGAAGGGGG - Intergenic
912191560 1:107346938-107346960 CTGACCCAGGAAAACAGTGGTGG + Intronic
912213900 1:107585441-107585463 AAGAAACAGGAAACCATTGGAGG - Intronic
914356111 1:146885886-146885908 CTATGCCAGGAAACCAATGGGGG - Intergenic
915252793 1:154602516-154602538 CTTAAGCAGGAAACTACTGGGGG + Exonic
917351829 1:174086085-174086107 CAGAAGCAGAAAAGTAATGGGGG - Intergenic
917527097 1:175797770-175797792 CTGAAGCAGGAAACAGAAGGAGG + Intergenic
917541180 1:175916248-175916270 CTGCTGCTGGAAATCAATGGAGG + Intergenic
919087174 1:192934158-192934180 CTGATGCAGGAAGACAAGGGAGG - Intergenic
919595134 1:199552165-199552187 CTGAGGCAGAAAACCAGTAGAGG - Intergenic
920361286 1:205418331-205418353 CTGAAGCTAGAAACCACTGCAGG + Intronic
922982042 1:229835402-229835424 CTGAAGCAGGCACCAAATGCTGG + Intergenic
1062816051 10:500831-500853 CTGAAGCCTGAAACCTATGGGGG - Intronic
1068786395 10:60980036-60980058 GTGAAACAGGGAGCCAATGGAGG + Intronic
1070212534 10:74340680-74340702 ATGAAACTGGAAACCAGTGGAGG + Intronic
1074472537 10:113740615-113740637 ATGAAACGGGAAACCACTGGAGG + Intergenic
1076078521 10:127556861-127556883 GTGAAAGAGGAAACCACTGGAGG + Intergenic
1081192329 11:40119277-40119299 CTGAAGCCAGAAAGCAATGGAGG - Intronic
1086304122 11:85461233-85461255 CTGAAAAAGGAAACCAAGAGAGG - Intronic
1093879016 12:24382529-24382551 CTGAGGTAGGAAGCCATTGGAGG + Intergenic
1094215175 12:27932926-27932948 CTGATAGAGGAAACAAATGGAGG - Intergenic
1094269734 12:28599918-28599940 CTGGACCAGGAATCCAGTGGGGG - Intergenic
1095777545 12:46026037-46026059 ATGAAGCAAGAAACCAGTGACGG - Intergenic
1096320584 12:50609041-50609063 CTGAAGCAGGAGAATCATGGAGG + Intronic
1098605663 12:72387018-72387040 CTGAATGAGGTAACCAAGGGAGG - Intronic
1098746237 12:74240707-74240729 GAGAACCAGGAAACCAGTGGTGG - Intergenic
1098763148 12:74450193-74450215 CTGAAGCAAGAAAAAAATGCAGG + Intergenic
1098825152 12:75287458-75287480 CTGAAGGAGGAAACCCAGGAAGG - Intronic
1099215176 12:79844689-79844711 GTGAAATAGGAAGCCAATGGAGG - Intronic
1099517028 12:83609787-83609809 CAGAAGACGGAAATCAATGGAGG - Intergenic
1099794055 12:87374435-87374457 ATGAAGCTGGAAACCAATAATGG - Intergenic
1099931764 12:89083296-89083318 CTTAAGCAGAAAACCAAGGCAGG - Intergenic
1103129053 12:118450990-118451012 GTGAAGCAGGAAGTCAATGATGG - Intergenic
1104998188 12:132672293-132672315 CTGCAGCAGGAAGTCAAAGGCGG + Exonic
1105585707 13:21741040-21741062 CTGAAGCTTGAAACCAGAGGTGG - Intergenic
1106961270 13:35001158-35001180 CTGAAGGAAGAAACAAATGCTGG + Intronic
1111328021 13:86724699-86724721 CTGAGGAAGAAAAACAATGGAGG + Intergenic
1114179110 14:20350235-20350257 CTGAGGCAGGAAAAAACTGGAGG + Intronic
1114415810 14:22543250-22543272 ATGAAGCAGGAGAGCAAGGGAGG + Intergenic
1116452632 14:45082315-45082337 GTGGAGGAGGAAACCAGTGGAGG + Intergenic
1116960655 14:50965149-50965171 GTGTAGCAGGAAGCCACTGGTGG - Intergenic
1119498068 14:75098005-75098027 CTGATAGAGGAAACCACTGGAGG + Intronic
1120558053 14:85954973-85954995 GTTAAGCACTAAACCAATGGAGG + Intergenic
1125611905 15:40977068-40977090 CTGAAGCAAGAAAGAAATGAGGG + Intergenic
1125726697 15:41871816-41871838 CAGAAGCAGGCAGCCAAAGGAGG - Exonic
1126387464 15:48108850-48108872 CTTAAGAAGGAAACCTAAGGTGG + Intergenic
1127298675 15:57631843-57631865 CTGCAGCATAAAATCAATGGCGG + Intronic
1128271744 15:66316388-66316410 CTGAAGCAGGAGAGCTGTGGGGG - Intronic
1130570006 15:85033896-85033918 CTAAAGAAGGAAACAAATAGTGG + Intronic
1130631256 15:85570855-85570877 CTGAAGCAGGGACCCAAGGAGGG + Intronic
1132717864 16:1301155-1301177 CTGGAGCAGGAGACCAGGGGAGG - Intergenic
1132930920 16:2458955-2458977 CTGAAGGAGGAAACCACTCCAGG + Intergenic
1133803266 16:9102020-9102042 CTGAAGCAGGAGAACCCTGGAGG + Intronic
1139232175 16:65294338-65294360 CTGCTGCAGGAATGCAATGGGGG + Intergenic
1139977905 16:70829576-70829598 CTATGCCAGGAAACCAATGGGGG + Intronic
1140547011 16:75820511-75820533 AGGCAGCAGGAAACAAATGGTGG + Intergenic
1141927518 16:87179012-87179034 CTCACCCAGGAGACCAATGGGGG - Intronic
1142397313 16:89839596-89839618 GGGAAGCAGGAAACCCCTGGAGG + Intronic
1143755554 17:9064705-9064727 TGGAAGCAGGAAACCAAGGAAGG - Intronic
1144431283 17:15194213-15194235 ATGACGCAGGAATCAAATGGAGG + Intergenic
1151458633 17:74241673-74241695 GTGAAGCAGAAAACCATTGCTGG + Intronic
1152344509 17:79742991-79743013 CTGAAGCAGGAGACCCGGGGTGG - Intergenic
1154091424 18:11367424-11367446 TTGATGCAGGAAACAGATGGAGG - Intergenic
1155873332 18:31054061-31054083 AGAAAGCAGGAAACCACTGGGGG + Intergenic
1156276997 18:35593215-35593237 CAGAGTCAGGAAACCAATAGAGG + Intronic
1156290869 18:35747825-35747847 ATGAAGCAGGAAATAAATGAGGG + Intergenic
1156562338 18:38139507-38139529 GGGGAGCGGGAAACCAATGGTGG + Intergenic
1157488567 18:48107005-48107027 CTGAACCAGGAAACGAGTGGAGG + Intronic
1158492949 18:57926825-57926847 CTGGAGCAGGATATAAATGGGGG + Intergenic
1160265350 18:77337011-77337033 CTTCAGAAGGAAACCACTGGAGG - Intergenic
1160783941 19:891217-891239 CAGAAGTGGGAAAACAATGGAGG + Intronic
1161160559 19:2759502-2759524 CTGAAGCAGGAACCCAAAACAGG - Intronic
1163302740 19:16457999-16458021 CTGATGCAGGAAAGGAATGTTGG - Intronic
1163533298 19:17863069-17863091 CTGACGCAGGAGCCCAGTGGGGG + Intronic
1168577741 19:57527423-57527445 CTGGAGCCGGAAACCGGTGGAGG + Exonic
1168623588 19:57898543-57898565 CTGAAACAGGAAAAAACTGGAGG + Intronic
926762871 2:16294926-16294948 CTGAAGCAGGCATGAAATGGAGG - Intergenic
926776066 2:16424368-16424390 CTGAAGCATGAAAGCAAGAGGGG + Intergenic
930218347 2:48720291-48720313 GTGAAGAAGAAAACCAATGTTGG - Intronic
931002651 2:57805333-57805355 CTAAAGCAAGAATCCAATGACGG + Intergenic
932485115 2:72079993-72080015 GTGAAGGAGGAAAGCAAGGGGGG + Intergenic
936392947 2:112092295-112092317 TTGAAGCAGGAAAACAGAGGGGG + Intronic
938448979 2:131399769-131399791 CCGAAGCAGGAAAGCCATGCTGG - Intergenic
939448302 2:142337847-142337869 CTGAAGCAAGAAAGAAATAGTGG - Intergenic
939637430 2:144599462-144599484 CTGAAGCAGGATAGAAATGGTGG - Intergenic
941005134 2:160240072-160240094 CTTCAGCAGGAACCCATTGGAGG + Intronic
944020263 2:195094525-195094547 TTGAAGCAGGGAACCCAAGGAGG - Intergenic
945689823 2:213019744-213019766 CTGAAGCTGGAACCAAGTGGGGG - Intronic
946429781 2:219619144-219619166 GAGAAGCAGGAAATCAGTGGTGG + Intergenic
1173432730 20:43005184-43005206 CAGCAGTAAGAAACCAATGGAGG - Intronic
1174034628 20:47661064-47661086 GTGTATCAGGAAGCCAATGGAGG - Intronic
1174070741 20:47897414-47897436 GTGAAGCTGGAGACCAAAGGAGG + Intergenic
1174274211 20:49391859-49391881 GTGCAGCAGGACACCACTGGAGG - Intronic
1176428146 21:6561193-6561215 CTGATGGAGGAAAGCAAAGGTGG - Intergenic
1179703637 21:43169510-43169532 CTGATGGAGGAAAGCAAAGGTGG - Intronic
1181299916 22:21872385-21872407 CTCATGCAGTTAACCAATGGTGG - Intergenic
1182609961 22:31539225-31539247 AGGAAGCAGGAGACCAATGAGGG - Intronic
1183428428 22:37751718-37751740 GTCCAGCAGGAAGCCAATGGGGG - Intronic
1184379627 22:44137223-44137245 CTGACACAGGAAACCACTCGTGG + Intronic
1184401381 22:44276615-44276637 GTGAAGCAGGAAAGAAAGGGAGG + Intronic
1185203657 22:49523860-49523882 CTGGAGCAGGAGACCAAGGCAGG - Intronic
949699401 3:6738603-6738625 CTTGACCAGGAAACCAATGGGGG + Intergenic
952428360 3:33198573-33198595 GTGAAACAGGAAACCATTGTAGG - Intronic
953703363 3:45213483-45213505 CTGAAGCAGCAAACAGATGTGGG - Intergenic
955417154 3:58703096-58703118 ATGAAGCAGGATACTTATGGTGG - Intergenic
955800549 3:62681627-62681649 CTGAAGAATGAAATAAATGGTGG + Intronic
957533797 3:81475096-81475118 ATGAAGCAGGAAATGAGTGGAGG - Intergenic
960927402 3:122808634-122808656 CTGAGCTAGGAAACCACTGGAGG + Intronic
961019690 3:123495142-123495164 CTAAAGCAGGAAAAGAAAGGAGG - Intronic
962425019 3:135262063-135262085 CTGAATCAGGAGCCCAAAGGTGG - Intergenic
962969315 3:140384251-140384273 CTGGAGCAGGAATGAAATGGTGG - Intronic
966736442 3:183190628-183190650 CTGAATCAGTAAGCCATTGGTGG + Intronic
967838994 3:193989096-193989118 CAGCAGCAAGAAACAAATGGAGG + Intergenic
968468558 4:765625-765647 CTGAAGCAGGAAACCAATGGTGG + Intronic
974057530 4:56998863-56998885 CTGAAGCAGGAGGCCTGTGGTGG + Intronic
975042204 4:69760223-69760245 CTGAAGCATGCAAGGAATGGAGG - Intronic
975107395 4:70582923-70582945 GTGAAGTAGGAAGCCATTGGAGG - Intergenic
977231814 4:94460428-94460450 CTGATGGAGGAAACCGATGTAGG + Intronic
977457218 4:97276649-97276671 ATCCAGCAGCAAACCAATGGTGG + Intronic
978645524 4:110926396-110926418 CTGAATCAGTGAACTAATGGAGG + Intergenic
978688397 4:111477667-111477689 CTAAATTAGGAAACCAAAGGAGG - Intergenic
983250986 4:165346227-165346249 CTGAAGCAGAAAACACAAGGTGG - Intergenic
986841165 5:11699309-11699331 CAGAAGCATGAATGCAATGGAGG + Intronic
987023556 5:13899969-13899991 GTGTACCAGGAAACCATTGGAGG - Intronic
989266044 5:39475149-39475171 TTGAAGCAGGAAACCAGGTGGGG + Intergenic
991493179 5:67203196-67203218 CTGAAGATGGAAACCCATGAAGG - Intergenic
993714293 5:91259685-91259707 ATGAAGCAGGAAATCACTGGAGG - Intergenic
993848685 5:92978220-92978242 CTGTAGCTGGAAACCAATATAGG + Intergenic
993962291 5:94314173-94314195 ATGAAGCATGAAAGCAAAGGTGG + Intronic
994147251 5:96409313-96409335 TCCAAGCAGGAAGCCAATGGAGG - Intronic
994507297 5:100658008-100658030 ATGAATGAGGAAACGAATGGAGG + Intergenic
994781889 5:104099593-104099615 CTGAATCAGGCAACAAATGAGGG + Intergenic
997777773 5:136626836-136626858 CTGGAGAAGGAAAAAAATGGTGG + Intergenic
1000551708 5:162674010-162674032 CAGAAGCAGAAAACAAAAGGTGG - Intergenic
1001951501 5:175819863-175819885 CTGAAGCAGGTAGCCCAGGGAGG + Intronic
1002676902 5:180924259-180924281 CTTAAGCAGAACACCAATGGTGG - Intronic
1004354367 6:14918521-14918543 CTGAAGGATGGAACCAAAGGAGG + Intergenic
1005037827 6:21573312-21573334 CTGAAGAAGAAAAACAATGATGG - Intergenic
1005804483 6:29461786-29461808 CAGAAGGAGGAAGCCCATGGGGG - Exonic
1011331091 6:86207315-86207337 CTGAAGCATGAATCAAAAGGTGG - Intergenic
1014418176 6:121209681-121209703 CAGAACCAGGAAACTAATGCAGG + Intronic
1014488452 6:122031353-122031375 GTGTAGCAGGCAACCACTGGGGG - Intergenic
1014743374 6:125171338-125171360 CAGAAGCTGGAAATCACTGGGGG - Intronic
1015020734 6:128471347-128471369 CTGAGGCAGGAAATGAATGGGGG + Intronic
1015851420 6:137576948-137576970 CTAAAGCAGTACACAAATGGTGG + Intergenic
1017718648 6:157229488-157229510 GTGAAGCAGGAATACACTGGGGG + Intergenic
1018355200 6:163007631-163007653 AAGAAGCAGGACACAAATGGGGG - Intronic
1019508148 7:1403758-1403780 CTGAAGGAGGAAGCCACAGGCGG + Intergenic
1020523637 7:9228472-9228494 CTGAAACAGGAGAGCATTGGCGG + Intergenic
1020814016 7:12882150-12882172 CTAAAAAAGGAAGCCAATGGAGG - Intergenic
1020923389 7:14293778-14293800 GTGCAGCAGGAAGCCATTGGAGG - Intronic
1021402528 7:20226033-20226055 CTGAAGCAGCAAACATTTGGGGG - Intergenic
1021599024 7:22345250-22345272 CTTCAGCAGGATACCAATTGTGG + Intronic
1023929829 7:44698482-44698504 CAACAGCAGGAAGCCAATGGAGG - Intronic
1023952890 7:44861156-44861178 ATGAATTAGGAAATCAATGGAGG - Intergenic
1025810824 7:64874513-64874535 CTGAAACTGGAAAACCATGGGGG - Intronic
1027659453 7:80971467-80971489 CTGAAACCAGAACCCAATGGGGG - Intergenic
1031936762 7:127743038-127743060 CTGAAGCAAGAATAAAATGGGGG - Intronic
1032181700 7:129684916-129684938 CTGAGGCAGGAGAACAAAGGAGG + Intronic
1033286189 7:140042549-140042571 GGGAAGCAGGAAACAAATGTAGG + Intronic
1037943404 8:22971816-22971838 CTGAAGCAGGAGAAGAGTGGAGG - Intronic
1041811979 8:61921786-61921808 CTGAGAAAGGAAACCAATGAAGG - Intergenic
1045081596 8:98631264-98631286 GTGAAACAGGAAACCATTGCAGG - Intronic
1048908362 8:139110407-139110429 CTGAAGAAGGAAACCAGTAGTGG + Intergenic
1049334129 8:142073471-142073493 CAGAAGGAGGAAACCAACAGAGG - Intergenic
1049337752 8:142095615-142095637 CTGAAGCAGGGCGCCCATGGGGG + Intergenic
1049478302 8:142807063-142807085 CTGAAGCAGGGAGACATTGGGGG - Intergenic
1050708970 9:8438039-8438061 CTGAAGCAGGAAAAGAATGAGGG + Intronic
1051608518 9:18939616-18939638 CTGAAGCAGAAAAGAAATGTAGG + Intronic
1052907325 9:33847326-33847348 CTGAAGCAGGAGATCACTTGAGG - Intronic
1053055449 9:34990876-34990898 AGGAAGCAGGAAGGCAATGGAGG - Intronic
1056455916 9:86759919-86759941 CTGAATCAGGCATCCACTGGGGG - Intergenic
1059423721 9:114207963-114207985 CTCAAACAAGCAACCAATGGAGG - Intronic
1059488190 9:114643613-114643635 CTGAACAATGAAAGCAATGGGGG - Exonic
1059522349 9:114955408-114955430 CTAAAACAGGAAAACAGTGGGGG - Intergenic
1059701748 9:116781701-116781723 CTGCATCAAGAAACCCATGGAGG - Intronic
1061224062 9:129270377-129270399 CTCAGGCAGGAAACCAAGGTAGG - Intergenic
1061249583 9:129418622-129418644 CAGAAGCAGGAGACCAGGGGCGG + Intergenic
1062170296 9:135131155-135131177 CTGACACAGGAAACCTCTGGGGG + Intergenic
1062537697 9:137028123-137028145 CTGGTGCAGGAAGCCCATGGCGG + Exonic
1186981029 X:14957689-14957711 CTGAAGCAGGAGATCGATTGAGG - Intergenic
1189301724 X:39957130-39957152 CAGAATCAGGAGATCAATGGAGG + Intergenic
1190973802 X:55379601-55379623 CTGCACCAGCAAACCAATGGGGG - Intergenic
1192280123 X:69676170-69676192 GTGAAATAGGAAACCAATGGAGG + Intronic
1192329800 X:70166049-70166071 CTGAAGCAGGAGACCAGGGAGGG - Exonic
1198488188 X:137109323-137109345 CTGAATCAGGAAACCAAGAGAGG - Intergenic
1198523606 X:137476568-137476590 CTAAAGCAGGAGACCACAGGAGG - Intergenic
1199330006 X:146548460-146548482 CTGAAACAGGAAAACACTTGGGG + Intergenic
1200774894 Y:7161448-7161470 CTAAAGCAGAAAAGCATTGGTGG - Intergenic
1201790092 Y:17830096-17830118 CTGAAACAAGCAAGCAATGGGGG + Intergenic
1201811462 Y:18075893-18075915 CTGAAACAAGCAAGCAATGGGGG - Intergenic