ID: 968469161

View in Genome Browser
Species Human (GRCh38)
Location 4:770375-770397
Sequence TTGCAAACCCTCATTTAAAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968469156_968469161 25 Left 968469156 4:770327-770349 CCAATGTCTCGATTTGCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 968469161 4:770375-770397 TTGCAAACCCTCATTTAAATTGG 0: 1
1: 0
2: 1
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968469161 Original CRISPR TTGCAAACCCTCATTTAAAT TGG Exonic
903451889 1:23459281-23459303 TTGCAAACCATCATTCATTTAGG - Intronic
905715095 1:40142396-40142418 TTGCAAACCATCTGTTTAATAGG + Intergenic
908420493 1:63954195-63954217 TTGGTAGCCCTCATTTGAATGGG + Intronic
911708844 1:101045424-101045446 TTGCAAAACCTAAATTATATTGG + Intergenic
912917382 1:113828942-113828964 TGGCAAAGCCTCAATTAAAATGG - Intronic
923096798 1:230781443-230781465 TTGCCAACATTTATTTAAATTGG - Intronic
924732272 1:246723575-246723597 TTAAAAACTCTCATTAAAATAGG - Intergenic
1065692053 10:28344519-28344541 TTGCCAACCCTTCTTTTAATCGG - Intergenic
1068182905 10:53545635-53545657 TTTCAAAACTTAATTTAAATCGG + Intergenic
1068229534 10:54153841-54153863 TTGCACACCCTGATTTATAAAGG + Intronic
1068473221 10:57491481-57491503 GTAAAAACCCTCATTAAAATGGG - Intergenic
1068725985 10:60304034-60304056 TTTCAATTCCTCATGTAAATGGG - Intronic
1072849241 10:98870045-98870067 TTGCAAACTGTCATTTTATTAGG + Intronic
1077832394 11:5888080-5888102 TTAAAAATACTCATTTAAATTGG - Intronic
1078473375 11:11609807-11609829 TTCCATTCCCTCAATTAAATGGG + Intronic
1081415058 11:42804581-42804603 CTGCAAAACCTCATTTATTTGGG + Intergenic
1087466886 11:98519171-98519193 TTGAAAACCCTCAAGTAACTAGG - Intergenic
1089916226 11:122159479-122159501 TTCCAAACCCTGAGTGAAATGGG - Intergenic
1091155921 11:133372854-133372876 ATGCAAACAATTATTTAAATTGG - Intronic
1093362327 12:18245938-18245960 TTGCAAAACCTCATTAGTATTGG + Intronic
1094153827 12:27316297-27316319 TTGCAAAACCTGATCTAAAATGG - Intronic
1094784699 12:33833983-33834005 ATGCAAAACCTTATTTAAACTGG + Intergenic
1098759851 12:74409362-74409384 TTGCAAACCACCATTTCAAATGG + Intergenic
1099873261 12:88374021-88374043 TTGCAACCTCTCATATAAATGGG + Intergenic
1101210623 12:102531934-102531956 GTGCAAACCCTTATAAAAATGGG - Intergenic
1103011891 12:117464285-117464307 TAGCAAACCGTCATATACATGGG - Exonic
1104150245 12:126075264-126075286 TATCAAACCATCATTTACATTGG + Intergenic
1106684235 13:32041195-32041217 TTGCAAGCCCTCATTTTTAGGGG - Intronic
1107007444 13:35630162-35630184 TTTTAAACCCTCATTTAAATTGG - Intronic
1107485599 13:40824186-40824208 TTAGAAAGCCACATTTAAATGGG + Intergenic
1108653277 13:52503209-52503231 TTGCATACACTCATTGAACTGGG - Intergenic
1109188657 13:59299865-59299887 TTGCAAGCCCCCAGCTAAATTGG + Intergenic
1110641082 13:77824840-77824862 TTGAAAACACTCAGTAAAATAGG + Intergenic
1111465278 13:88600295-88600317 TTGCAAAAGCTTATTTAAAAGGG - Intergenic
1112919239 13:104590475-104590497 TTTCAAAGCCTCCTATAAATTGG - Intergenic
1120522066 14:85535112-85535134 ATGCAAAGCCTCTTCTAAATGGG + Intronic
1120912357 14:89678806-89678828 TTCCCAAACCTCATTTAAAAAGG - Intergenic
1202847819 14_GL000009v2_random:197383-197405 TTGCAAACACACATATAAAAGGG - Intergenic
1202917294 14_GL000194v1_random:187922-187944 TTGCAAACACACATATAAAAGGG - Intergenic
1126059753 15:44768967-44768989 TTGGAAGTCCTCATCTAAATGGG + Intergenic
1127831012 15:62751457-62751479 TTGCAAATCCTTATGTAAACTGG + Intronic
1135291042 16:21238324-21238346 TTGAAAACCCCAATATAAATGGG - Intronic
1137785746 16:51135857-51135879 TTACAATTCCTCATTTAAAGAGG + Intergenic
1140619658 16:76714172-76714194 ATGGAAACCCTCAATAAAATAGG - Intergenic
1149812079 17:59685483-59685505 TTGCAAAACCAGATTTATATTGG + Intronic
1157826443 18:50816623-50816645 TTCCAAACCATGATCTAAATGGG + Intronic
1159227677 18:65561195-65561217 TTGCAAACCGTATATTAAATAGG + Intergenic
1164470553 19:28527141-28527163 TTACAAACCATCTTTTAAAGGGG - Intergenic
1167789558 19:51665041-51665063 TTGCACAACCCAATTTAAATGGG - Intergenic
925248587 2:2409104-2409126 TTGCAACCCCTCAGTCAAGTAGG + Intergenic
927584605 2:24290197-24290219 CTGCAAACCCTCATCTATATTGG + Intronic
928011188 2:27609344-27609366 TGCAAAACCCACATTTAAATTGG - Intronic
928506243 2:31955956-31955978 TTTGAAGCCTTCATTTAAATTGG - Intronic
928704659 2:33935248-33935270 TTGCAAACTCTCCATCAAATAGG - Intergenic
933563774 2:83923818-83923840 TTGGAAACCTTCATGAAAATCGG - Intergenic
936761029 2:115783397-115783419 TTGCATACTCTTATTTAAGTAGG + Intronic
936866729 2:117083187-117083209 TTTCAATACCTCATATAAATGGG + Intergenic
936936826 2:117846954-117846976 TTGCAAAACCACAATTAATTTGG + Intergenic
938635364 2:133219588-133219610 TTGGAAACCCACTTTTAAAAGGG - Intronic
938960344 2:136335144-136335166 CTGCAAACCCACATGTCAATGGG - Intergenic
940482825 2:154256588-154256610 TTGCTATCCTTCATTTAATTTGG - Intronic
944656662 2:201882485-201882507 TTGACAAACCTCATTTAATTGGG - Intronic
945125388 2:206503974-206503996 TTGTAAAGCCTCATTTATACAGG + Intronic
946735278 2:222747864-222747886 TTTCCCACCCTCTTTTAAATAGG + Intergenic
947122619 2:226833503-226833525 TTAAAAACACTCATTTAAGTCGG + Intergenic
947352802 2:229264036-229264058 TAGCAGACTCTCATTTAATTGGG - Intronic
1169982977 20:11407486-11407508 TTATAGACCCTCACTTAAATAGG + Intergenic
1172208344 20:33180543-33180565 CTGCAAACCCTCATCTGAAGAGG + Exonic
1173856936 20:46256342-46256364 TTACAAATACTCATTTAAACAGG + Intronic
1174849509 20:53979081-53979103 ATGAAGACCCTCATTTACATGGG + Intronic
1177408004 21:20695132-20695154 TGGCAAACTCTGATTTTAATTGG - Intergenic
1178329283 21:31673150-31673172 GAGCAAACCCTCATGTAGATAGG - Intronic
1179077945 21:38141655-38141677 TTACAAACCCTAATACAAATGGG - Intronic
1179459373 21:41523375-41523397 TTGCACACCCTCTTCAAAATGGG - Intronic
1179616389 21:42586217-42586239 TTGAAAACTCTCATTTTAAATGG - Intergenic
1180148736 21:45936734-45936756 ATCCAAACACTCATTTAAAATGG + Intronic
1182248122 22:28976898-28976920 TTACAAACCCTCACTTAGAATGG - Intronic
953785220 3:45906337-45906359 TTGCTAACCCTGATTTACAGAGG + Intronic
955115145 3:55990787-55990809 TTGCAAAGCATCATTTGAATAGG + Intronic
955139898 3:56258736-56258758 TTGCCAACCCTGATATAAACTGG + Intronic
955358601 3:58252667-58252689 TTGCAAACTCTCAGTTGTATGGG + Intronic
955563701 3:60221935-60221957 GTGCATACCCACATTTATATAGG - Intronic
956639240 3:71399807-71399829 TTACAAACCTTCATTTTACTGGG + Intronic
957806953 3:85160164-85160186 CTGAAAACCCTCATTTAGAAAGG - Intronic
959930115 3:111971391-111971413 TTGCAAAGACACATTTACATGGG - Intronic
961060697 3:123825891-123825913 TTGCATGCCCTCCTCTAAATAGG + Intronic
963490775 3:145997682-145997704 TTAAATACACTCATTTAAATTGG + Intergenic
964489728 3:157223197-157223219 TTGTAAAATGTCATTTAAATTGG + Intergenic
965462211 3:168979955-168979977 TTGAAATCTCTCATTTAATTGGG - Intergenic
968469161 4:770375-770397 TTGCAAACCCTCATTTAAATTGG + Exonic
969827278 4:9767482-9767504 TTGAAAACTCTCATTTCAGTAGG + Intergenic
969895823 4:10303556-10303578 TTGGAAACCCTCATCTACCTGGG + Intergenic
972874547 4:43342636-43342658 TTACAATCCCTCAATAAAATGGG + Intergenic
973724525 4:53761967-53761989 TTACAAAGCCTCAGTTAAATAGG + Intronic
974643381 4:64662908-64662930 ATGCAAGCCCTCATTTATTTGGG + Intergenic
975919524 4:79368276-79368298 ATGCAAACCCGCATGCAAATTGG - Intergenic
975971992 4:80050600-80050622 TTTAAAACCCTCAGTCAAATGGG - Intronic
978679606 4:111363752-111363774 TTTCAAAACCTCATACAAATGGG - Intergenic
980453774 4:133012333-133012355 TTTAAATTCCTCATTTAAATAGG - Intergenic
980559719 4:134457598-134457620 TTGCAAACCACCAGTGAAATAGG + Intergenic
982278581 4:153661489-153661511 ATGCATAACCTCATTTAAACAGG + Intergenic
983829588 4:172308512-172308534 ATGAAAACCCTCAGTAAAATTGG - Intronic
984636337 4:182114093-182114115 TTTCAATGCCTCATTTCAATAGG + Intergenic
985874137 5:2582471-2582493 TTGGAAACCTTTATTTATATTGG + Intergenic
987885639 5:23807988-23808010 TTAAAAACCCTCAATAAAATAGG - Intergenic
987956120 5:24742859-24742881 TTGCAAACTTCCATTTAAAGTGG + Intergenic
990005687 5:50941879-50941901 ATGAAAACCCTCAATAAAATTGG + Intergenic
991239739 5:64443954-64443976 TTTAAAACCATCATTTAAAGAGG - Intergenic
992402862 5:76427582-76427604 TAGGGAACCCTCATTTAAAATGG - Intronic
993884742 5:93402511-93402533 TTGCAAAGCATCACTTATATAGG + Intergenic
995767475 5:115634665-115634687 TTTTAAATCCTCATTTAAAATGG + Intergenic
998165607 5:139841225-139841247 TTGCAAACTCTGACATAAATGGG - Intronic
998648547 5:144091444-144091466 TTTCCAACCCTGATTCAAATTGG + Intergenic
999881656 5:155871340-155871362 TTGCAGACCCTCAATTTATTGGG - Intronic
1000937301 5:167318063-167318085 TTGCAAACCCACAGTTCAGTAGG + Intronic
1001324316 5:170710255-170710277 TGTCAAACCCACTTTTAAATTGG + Intronic
1001631091 5:173175941-173175963 ATGCAATCCTTTATTTAAATGGG + Intergenic
1002153593 5:177257181-177257203 TTGTAAAACCTCAGTTTAATTGG + Intronic
1003887650 6:10535701-10535723 TTTCAAACTCACATTAAAATAGG + Intronic
1004926145 6:20416892-20416914 TGGCCACCCCTCCTTTAAATGGG + Intronic
1007443721 6:41887546-41887568 TTCCCTACCCTCATTCAAATAGG - Intronic
1008300971 6:49838891-49838913 TGGTAAACCATCATTTAAAAGGG + Intronic
1009228380 6:61037567-61037589 TTGCACACCCTCAGTGATATTGG + Intergenic
1014133384 6:117860659-117860681 TTTCAAACCCTCAATAAACTAGG + Intergenic
1014895732 6:126897220-126897242 TGGAAAACCCTCTTTTAAATGGG + Intergenic
1016738093 6:147501986-147502008 TAGCAAGACCTCATTTATATTGG - Intergenic
1017196695 6:151709071-151709093 ATGCAAAACTTCAGTTAAATCGG - Intronic
1017904492 6:158747839-158747861 TTGTTAAACCTAATTTAAATAGG + Intronic
1018334342 6:162769745-162769767 TTGCTAACCTTCTTTTAAGTAGG - Intronic
1021442754 7:20697193-20697215 TGGCTAACCCACATTTATATTGG - Intronic
1022247936 7:28578995-28579017 TTGCACTGCCTCATTGAAATAGG - Intronic
1023476985 7:40591202-40591224 TTCCAAACCCTGATTAATATTGG - Intronic
1025148844 7:56529321-56529343 GTGAAAACCCTCAATAAAATAGG + Intergenic
1028449275 7:90962690-90962712 TTGCAAACATTGATTTAAAATGG - Intronic
1029838905 7:103342103-103342125 TTGCTAACCCTCATGTAAACTGG - Intronic
1030778109 7:113561943-113561965 TTGCAAACACTCATAGGAATAGG + Intergenic
1030838509 7:114318996-114319018 TTGGGAACCCCCAGTTAAATTGG + Intronic
1031211929 7:118840306-118840328 TTACAAAACTTCATTTAGATAGG - Intergenic
1031885761 7:127244599-127244621 TTTCAAACCCATATATAAATAGG - Intronic
1032436096 7:131901382-131901404 TTGCAATACATCATTTAAAATGG - Intergenic
1035130132 7:156643978-156644000 TTGCAAACCCTGCTTGAACTAGG + Intronic
1035823796 8:2623261-2623283 TTGTAAACCTTCATATAAATGGG + Intergenic
1036972595 8:13371329-13371351 TTGGAAAACCTCTTTTGAATGGG - Intronic
1039655656 8:39402552-39402574 TTGTAAACCCACATTTATATAGG - Intergenic
1040132860 8:43817714-43817736 TTGGAAACACTCTTTCAAATTGG + Intergenic
1040348158 8:46531769-46531791 TTGGAAACCCTCTTTTTAAAGGG + Intergenic
1042998781 8:74731924-74731946 TTGCAAACACTCATATTACTTGG + Intronic
1043501112 8:80857653-80857675 TTGCAAACTTTCATGTACATAGG - Intronic
1047162040 8:122391425-122391447 TTGCCAACCCGGATTTAAAATGG + Intergenic
1049907198 9:229145-229167 TTGCAGCCCCTCCTTTCAATAGG - Intronic
1050136932 9:2475602-2475624 TTTCACACCTTCTTTTAAATTGG - Intergenic
1051551038 9:18329600-18329622 TTAAAACCCCTCATTCAAATAGG + Intergenic
1052128269 9:24807060-24807082 TAGCAAAATCTCAGTTAAATGGG - Intergenic
1058783116 9:108359228-108359250 TTGCTAACCCTGTTTTATATGGG - Intergenic
1060823062 9:126672536-126672558 CTGGGACCCCTCATTTAAATTGG + Intronic
1203652984 Un_KI270751v1:146142-146164 TTGCAAACACACATATAAAAGGG - Intergenic
1185913228 X:4005452-4005474 CTGCACACTCTCATTTTAATGGG - Intergenic
1185987067 X:4846811-4846833 TTCCATTCCCTCATTTAAAAAGG - Intergenic
1187666227 X:21613312-21613334 TTTCAAAACCTCATCTGAATTGG - Intronic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1191591918 X:62895283-62895305 ATCAAAAACCTCATTTAAATTGG - Intergenic
1194115546 X:89892323-89892345 TTGCAAAGCCTCATTTTTACTGG + Intergenic
1196423792 X:115549326-115549348 TTGCAAAGCCACATTTAAAAAGG + Intergenic
1198014247 X:132592568-132592590 TTGCAAAGCTTAATGTAAATTGG - Intergenic
1200468340 Y:3549458-3549480 TTGCAAAGCCTCATTTTTACTGG + Intergenic
1200922027 Y:8621801-8621823 TTTCAAACCCTCAGCCAAATAGG + Intergenic