ID: 968470445

View in Genome Browser
Species Human (GRCh38)
Location 4:779617-779639
Sequence CTACCTAAAAGGAGGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968470440_968470445 -9 Left 968470440 4:779603-779625 CCTCTTTTTCCCTGCTACCTAAA No data
Right 968470445 4:779617-779639 CTACCTAAAAGGAGGTCCCCAGG No data
968470438_968470445 -5 Left 968470438 4:779599-779621 CCCTCCTCTTTTTCCCTGCTACC No data
Right 968470445 4:779617-779639 CTACCTAAAAGGAGGTCCCCAGG No data
968470437_968470445 10 Left 968470437 4:779584-779606 CCTGGGTGTGGCTCACCCTCCTC No data
Right 968470445 4:779617-779639 CTACCTAAAAGGAGGTCCCCAGG No data
968470439_968470445 -6 Left 968470439 4:779600-779622 CCTCCTCTTTTTCCCTGCTACCT No data
Right 968470445 4:779617-779639 CTACCTAAAAGGAGGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968470445 Original CRISPR CTACCTAAAAGGAGGTCCCC AGG Intergenic
No off target data available for this crispr