ID: 968471025

View in Genome Browser
Species Human (GRCh38)
Location 4:782324-782346
Sequence GGGCCACGCTGGTGGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968471017_968471025 -2 Left 968471017 4:782303-782325 CCCAGCCAGTGCATGGGGCCAGG No data
Right 968471025 4:782324-782346 GGGCCACGCTGGTGGCACCCAGG No data
968471013_968471025 15 Left 968471013 4:782286-782308 CCGGGGGCAGGGTGGTGCCCAGC No data
Right 968471025 4:782324-782346 GGGCCACGCTGGTGGCACCCAGG No data
968471021_968471025 -7 Left 968471021 4:782308-782330 CCAGTGCATGGGGCCAGGGCCAC No data
Right 968471025 4:782324-782346 GGGCCACGCTGGTGGCACCCAGG No data
968471019_968471025 -3 Left 968471019 4:782304-782326 CCAGCCAGTGCATGGGGCCAGGG No data
Right 968471025 4:782324-782346 GGGCCACGCTGGTGGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968471025 Original CRISPR GGGCCACGCTGGTGGCACCC AGG Intergenic
No off target data available for this crispr