ID: 968472001

View in Genome Browser
Species Human (GRCh38)
Location 4:786677-786699
Sequence GTACGGCATCAAGAAGAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 107}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968472001_968472021 22 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472021 4:786722-786744 GCGGGGGTCCCGGCGGCTCCCGG 0: 1
1: 3
2: 8
3: 44
4: 373
968472001_968472015 3 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472015 4:786703-786725 GGGGGAGGCGGGGGTCAGGGCGG 0: 1
1: 3
2: 21
3: 259
4: 2358
968472001_968472013 -1 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472013 4:786699-786721 CTGCGGGGGAGGCGGGGGTCAGG 0: 1
1: 0
2: 6
3: 64
4: 843
968472001_968472009 -8 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472009 4:786692-786714 TGCCGTACTGCGGGGGAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 90
968472001_968472019 12 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472019 4:786712-786734 GGGGGTCAGGGCGGGGGTCCCGG 0: 1
1: 0
2: 8
3: 132
4: 1059
968472001_968472018 6 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472018 4:786706-786728 GGAGGCGGGGGTCAGGGCGGGGG 0: 1
1: 0
2: 14
3: 172
4: 1614
968472001_968472017 5 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472017 4:786705-786727 GGGAGGCGGGGGTCAGGGCGGGG 0: 1
1: 1
2: 14
3: 155
4: 1711
968472001_968472016 4 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472016 4:786704-786726 GGGGAGGCGGGGGTCAGGGCGGG 0: 1
1: 2
2: 16
3: 202
4: 1830
968472001_968472023 26 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472023 4:786726-786748 GGGTCCCGGCGGCTCCCGGGCGG 0: 1
1: 0
2: 3
3: 34
4: 290
968472001_968472010 -7 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472010 4:786693-786715 GCCGTACTGCGGGGGAGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 114
968472001_968472020 15 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472020 4:786715-786737 GGTCAGGGCGGGGGTCCCGGCGG 0: 1
1: 0
2: 1
3: 49
4: 518
968472001_968472012 -6 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472012 4:786694-786716 CCGTACTGCGGGGGAGGCGGGGG 0: 1
1: 0
2: 1
3: 7
4: 213
968472001_968472014 0 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472014 4:786700-786722 TGCGGGGGAGGCGGGGGTCAGGG 0: 1
1: 0
2: 4
3: 54
4: 729
968472001_968472022 23 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472022 4:786723-786745 CGGGGGTCCCGGCGGCTCCCGGG 0: 1
1: 2
2: 4
3: 35
4: 303
968472001_968472024 27 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472024 4:786727-786749 GGTCCCGGCGGCTCCCGGGCGGG 0: 1
1: 0
2: 5
3: 38
4: 290
968472001_968472008 -9 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472008 4:786691-786713 ATGCCGTACTGCGGGGGAGGCGG 0: 1
1: 1
2: 1
3: 10
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968472001 Original CRISPR GTACGGCATCAAGAAGAAGG AGG (reversed) Exonic