ID: 968472011

View in Genome Browser
Species Human (GRCh38)
Location 4:786694-786716
Sequence CCCCCGCCTCCCCCGCAGTA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 302}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968472011_968472019 -5 Left 968472011 4:786694-786716 CCGTACTGCGGGGGAGGCGGGGG 0: 1
1: 0
2: 1
3: 19
4: 302
Right 968472019 4:786712-786734 GGGGGTCAGGGCGGGGGTCCCGG 0: 1
1: 0
2: 8
3: 132
4: 1059
968472011_968472023 9 Left 968472011 4:786694-786716 CCGTACTGCGGGGGAGGCGGGGG 0: 1
1: 0
2: 1
3: 19
4: 302
Right 968472023 4:786726-786748 GGGTCCCGGCGGCTCCCGGGCGG 0: 1
1: 0
2: 3
3: 34
4: 290
968472011_968472021 5 Left 968472011 4:786694-786716 CCGTACTGCGGGGGAGGCGGGGG 0: 1
1: 0
2: 1
3: 19
4: 302
Right 968472021 4:786722-786744 GCGGGGGTCCCGGCGGCTCCCGG 0: 1
1: 3
2: 8
3: 44
4: 373
968472011_968472020 -2 Left 968472011 4:786694-786716 CCGTACTGCGGGGGAGGCGGGGG 0: 1
1: 0
2: 1
3: 19
4: 302
Right 968472020 4:786715-786737 GGTCAGGGCGGGGGTCCCGGCGG 0: 1
1: 0
2: 1
3: 49
4: 518
968472011_968472022 6 Left 968472011 4:786694-786716 CCGTACTGCGGGGGAGGCGGGGG 0: 1
1: 0
2: 1
3: 19
4: 302
Right 968472022 4:786723-786745 CGGGGGTCCCGGCGGCTCCCGGG 0: 1
1: 2
2: 4
3: 35
4: 303
968472011_968472024 10 Left 968472011 4:786694-786716 CCGTACTGCGGGGGAGGCGGGGG 0: 1
1: 0
2: 1
3: 19
4: 302
Right 968472024 4:786727-786749 GGTCCCGGCGGCTCCCGGGCGGG 0: 1
1: 0
2: 5
3: 38
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968472011 Original CRISPR CCCCCGCCTCCCCCGCAGTA CGG (reversed) Exonic