ID: 968472024

View in Genome Browser
Species Human (GRCh38)
Location 4:786727-786749
Sequence GGTCCCGGCGGCTCCCGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968472002_968472024 24 Left 968472002 4:786680-786702 CCTTCTTCTTGATGCCGTACTGC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 968472024 4:786727-786749 GGTCCCGGCGGCTCCCGGGCGGG 0: 1
1: 0
2: 5
3: 38
4: 290
968472011_968472024 10 Left 968472011 4:786694-786716 CCGTACTGCGGGGGAGGCGGGGG 0: 1
1: 0
2: 1
3: 19
4: 302
Right 968472024 4:786727-786749 GGTCCCGGCGGCTCCCGGGCGGG 0: 1
1: 0
2: 5
3: 38
4: 290
968472001_968472024 27 Left 968472001 4:786677-786699 CCTCCTTCTTCTTGATGCCGTAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 968472024 4:786727-786749 GGTCCCGGCGGCTCCCGGGCGGG 0: 1
1: 0
2: 5
3: 38
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968472024 Original CRISPR GGTCCCGGCGGCTCCCGGGC GGG Intronic