ID: 968472431

View in Genome Browser
Species Human (GRCh38)
Location 4:788233-788255
Sequence CCCTCCTTCCTCCCAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 269}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968472424_968472431 -2 Left 968472424 4:788212-788234 CCCCTGGATCTCCAAGGAGGCCC 0: 1
1: 0
2: 1
3: 15
4: 163
Right 968472431 4:788233-788255 CCCTCCTTCCTCCCAAATGGAGG 0: 1
1: 0
2: 2
3: 19
4: 269
968472425_968472431 -3 Left 968472425 4:788213-788235 CCCTGGATCTCCAAGGAGGCCCC 0: 1
1: 0
2: 0
3: 21
4: 166
Right 968472431 4:788233-788255 CCCTCCTTCCTCCCAAATGGAGG 0: 1
1: 0
2: 2
3: 19
4: 269
968472426_968472431 -4 Left 968472426 4:788214-788236 CCTGGATCTCCAAGGAGGCCCCT 0: 1
1: 0
2: 3
3: 27
4: 224
Right 968472431 4:788233-788255 CCCTCCTTCCTCCCAAATGGAGG 0: 1
1: 0
2: 2
3: 19
4: 269
968472420_968472431 13 Left 968472420 4:788197-788219 CCTGGTGCTGGGCACCCCCTGGA 0: 1
1: 0
2: 6
3: 26
4: 284
Right 968472431 4:788233-788255 CCCTCCTTCCTCCCAAATGGAGG 0: 1
1: 0
2: 2
3: 19
4: 269
968472423_968472431 -1 Left 968472423 4:788211-788233 CCCCCTGGATCTCCAAGGAGGCC 0: 1
1: 0
2: 1
3: 23
4: 267
Right 968472431 4:788233-788255 CCCTCCTTCCTCCCAAATGGAGG 0: 1
1: 0
2: 2
3: 19
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968472431 Original CRISPR CCCTCCTTCCTCCCAAATGG AGG Intronic
900300167 1:1973177-1973199 CCCTCGCTCCTCCCCAAGGGAGG - Intronic
900509002 1:3049361-3049383 CCCTCCTTGCTCCCAACCTGAGG + Intergenic
902139595 1:14341680-14341702 CCCTCCTAGCACCCATATGGGGG + Intergenic
902380276 1:16049378-16049400 CCCTCCATCCTCCCAGAAGGAGG - Intronic
903298517 1:22361459-22361481 CCCTTCGTCATCCCAAATGGTGG - Intergenic
903298719 1:22363002-22363024 CCCTCCTGCCTCCCACATCTAGG + Intergenic
904674408 1:32189944-32189966 CCCTCCCTGCTCCCAAAGCGTGG - Intronic
906166083 1:43687393-43687415 CCCTCCTTCTTCCCAAACAGAGG - Intronic
907247603 1:53117946-53117968 CCCTCCCTTCCCACAAATGGCGG + Intronic
907275002 1:53312032-53312054 GCCTCACTCCTCCCAAGTGGAGG - Intronic
909072048 1:71006225-71006247 CCCTGGTTCCTCCCATGTGGGGG - Intronic
911325837 1:96469779-96469801 CCCACCTCCCTCCCGGATGGGGG + Intergenic
911732385 1:101304629-101304651 CCACCCTTACTCCCAACTGGAGG + Intergenic
912649625 1:111426310-111426332 CCTACCTTCCTCTCAAATAGGGG - Intronic
913361841 1:117989543-117989565 CCCTCCTCCCTCCAACATTGGGG + Intronic
916149671 1:161774653-161774675 TCCTCCTGCCTCCCAAAAGAAGG + Intronic
918516623 1:185370473-185370495 TCCTCCTTCCCCCCAACTGCTGG + Intergenic
919802631 1:201362729-201362751 CCCTCCTCCCTCGAGAATGGAGG + Intronic
919985311 1:202670049-202670071 CCCTCCTTCCTCACGAGTGCTGG - Intronic
920513202 1:206565828-206565850 CCCTCCATCCTCCTCAGTGGTGG - Intronic
921159599 1:212463690-212463712 ACCTCCTTCCTCCCCAGTGCAGG - Intergenic
921174545 1:212582764-212582786 CCCTCCTTTCTCCTAAGTGCAGG - Intronic
921285710 1:213607506-213607528 CCATCCTTCCTCCTTAAAGGTGG + Intergenic
921990587 1:221361710-221361732 CCTTTCTTTTTCCCAAATGGGGG + Intergenic
922102536 1:222487970-222487992 CCCACCTCCCTCCCGGATGGGGG - Intergenic
923462962 1:234223038-234223060 CTCTGCTTCCTCCCAAGAGGAGG + Intronic
923792938 1:237127422-237127444 CCCACCTCCCTCCCAGAAGGGGG + Intronic
924011476 1:239669906-239669928 CCCTCCTTTCCCACAAATGCTGG + Intronic
1065924289 10:30422032-30422054 TCCTCCTGCCTCCCAAAGTGTGG - Intergenic
1065979897 10:30883339-30883361 CCTTCCTTCCTTCCACATGCAGG + Intronic
1066070980 10:31811901-31811923 TCCTCCTGCCTCCCAAAGTGGGG + Intronic
1067692462 10:48510614-48510636 CCTTCCTTCCTTTGAAATGGTGG - Intronic
1069090968 10:64197840-64197862 CCCTCCCTTTTCACAAATGGTGG + Intergenic
1070577365 10:77689297-77689319 CCCTCCTTTCTTCCAAGTGGTGG + Intergenic
1071463917 10:85922706-85922728 CACCCCTTCCTTGCAAATGGAGG - Intronic
1072513197 10:96149572-96149594 TCCTCCTTCCTCCCACAAGCTGG + Intronic
1073478751 10:103772341-103772363 GCCTTCTTCCTCCCAGAGGGCGG - Intronic
1073601140 10:104847190-104847212 ACATCCTTCCTCCCTAATTGAGG - Intronic
1075600399 10:123763420-123763442 CCCTCCTGCCTCCCACTCGGAGG + Intronic
1075712586 10:124538520-124538542 GCCTCCCTCCCCCCAAGTGGTGG + Intronic
1076171949 10:128326940-128326962 CCCTCCTTCCTTCCAAGCTGGGG + Intergenic
1076728898 10:132428665-132428687 CCCTCCTACCTCTCCAAAGGCGG - Intergenic
1081248195 11:40795884-40795906 CCTGCCTTCCTCCTACATGGAGG - Intronic
1081662111 11:44894571-44894593 CCCTCCTGTCGCCCAGATGGCGG - Intronic
1081699302 11:45142739-45142761 CCCTCCTTCCTTCCAAGAGACGG + Intronic
1081732963 11:45384572-45384594 CCTTCCCTCCTCCCAGCTGGGGG + Intergenic
1082773733 11:57229878-57229900 CCCTCCTACTTCCCAGTTGGTGG + Intergenic
1083073641 11:60014254-60014276 CCCTCCTTCCACCCAACTCCTGG + Intergenic
1085125692 11:74000731-74000753 CCCACTTTCCTACAAAATGGAGG - Exonic
1086493151 11:87375916-87375938 CCCTTCCTCCTCCCAGATGATGG - Intergenic
1086571566 11:88291020-88291042 CCCTTCATCATTCCAAATGGAGG - Intergenic
1088678894 11:112222287-112222309 CCCTCCTTCCTATCTAAGGGAGG - Intronic
1089677251 11:120098280-120098302 CCAAGCTTCCTCCCAAATCGAGG - Intergenic
1090420739 11:126573260-126573282 CCCTCCTTCCACCCCAGTGAAGG - Intronic
1091468353 12:705115-705137 CCCTCCTTCCTTCCTTATTGTGG + Intergenic
1091788472 12:3257337-3257359 CCCCATTTCCTCCCAAGTGGAGG + Intronic
1093137667 12:15471688-15471710 TCCTCTTTGCTCCCAAATAGAGG + Intronic
1093637590 12:21489865-21489887 CCCTCCTCTCTCCCTAAAGGAGG - Intronic
1094255857 12:28425308-28425330 CCCTCCTTCTTCCAATAAGGAGG - Intronic
1095464434 12:42475842-42475864 CCCCCCAGCCTCCCAAATGCTGG - Intronic
1095807276 12:46333452-46333474 CCCTGCTTCCTGCCACATGTTGG + Intergenic
1096581445 12:52588066-52588088 CCCTCCTCCCTCCCAGGTGAAGG - Intronic
1096732516 12:53625983-53626005 CCCGCCTTCCCCCCAAAGGAAGG + Intronic
1097037027 12:56130775-56130797 CTCTCTTTCCTCCCAGATTGTGG + Exonic
1099686264 12:85893128-85893150 CCCTCCTTCTTCCCTGAGGGAGG - Intergenic
1100389285 12:94133581-94133603 CCCTCCTTCCAACAATATGGGGG - Intergenic
1102189507 12:110976224-110976246 CCCTCCTTCCTCCCAGCTTCTGG - Intergenic
1102492570 12:113297940-113297962 CCCTTCTTCCTCCCCAGGGGTGG + Exonic
1103835444 12:123816330-123816352 CCCTCTTCCCTCCCCAAGGGTGG - Intronic
1104292278 12:127481587-127481609 CCATGCTTCCACTCAAATGGAGG - Intergenic
1105631693 13:22175940-22175962 CCCTCCTTCCTCCACTCTGGAGG + Intergenic
1106361191 13:29032010-29032032 CCCTCCCTCCATCCCAATGGAGG - Intronic
1108261015 13:48656598-48656620 TCATCTTTCCTCCAAAATGGAGG - Intronic
1109913861 13:68953953-68953975 ACCTCCCTCCTTCCACATGGGGG - Intergenic
1111269204 13:85858366-85858388 CCCTCCCACCCCACAAATGGAGG + Intergenic
1114424656 14:22611814-22611836 CCCATCTTCCTCCCAACTGGAGG + Exonic
1114954154 14:27796679-27796701 CCTTCCTTCCTCTCAAAGGCCGG + Intergenic
1115742138 14:36399581-36399603 TCCTTCTTCCTCCTAAATGCAGG + Intergenic
1115752688 14:36507131-36507153 CCCTCCTGCCTCCCCAGTGTAGG - Intronic
1119713308 14:76839083-76839105 ATCTCCTTTCTCCCAAATAGGGG - Intronic
1121719427 14:96098816-96098838 CCCTTCCTCCTCCCACATGGTGG + Intergenic
1121905304 14:97735938-97735960 CCTTCCTTGCTTCCAACTGGAGG + Intergenic
1124340049 15:28885050-28885072 GCCTCCCTCCCCCCAAATCGTGG - Intronic
1127363692 15:58267392-58267414 CTCTCTTTCCTCCCAAGTAGGGG + Intronic
1128707802 15:69850524-69850546 ACCTCCTGCCTCCCCCATGGAGG + Intergenic
1129826831 15:78640169-78640191 ACCTCCTGCCTCCCCTATGGTGG + Intronic
1130650523 15:85759837-85759859 CACCCCTCCCTCTCAAATGGTGG + Exonic
1131756105 15:95564225-95564247 CACTCCCTCCTCCCCAAGGGTGG + Intergenic
1132205589 15:99984118-99984140 CCCTCCTTCCTCTGAATTCGCGG + Intronic
1132389530 15:101428240-101428262 GGCACCTTCCTCCCACATGGGGG - Intronic
1134309744 16:13065015-13065037 CCCACCATCCTCCCAAGAGGTGG - Intronic
1134768144 16:16780565-16780587 CACACCTCCCTCCCAAATGTGGG - Intergenic
1135402013 16:22172427-22172449 CCCACCTTCCTTCCAAAGGACGG + Intronic
1135408806 16:22217818-22217840 CCCTACTGCCCCCCAAAAGGCGG + Intronic
1135498060 16:22969848-22969870 CCCTCCTTCCACCCACTTGATGG - Intergenic
1136109250 16:28054282-28054304 CCGTCCTTCTTCCCCGATGGTGG - Intronic
1138979211 16:62245766-62245788 ACCTCCTACCTCCCAAATTACGG - Intergenic
1139264386 16:65625417-65625439 CCCTCCTTCCTCCTACAGAGGGG + Intergenic
1141379804 16:83566253-83566275 CCTTCCTTCCCAGCAAATGGTGG - Intronic
1141434210 16:83990001-83990023 CCCTCCTTCCTCCTGCAAGGAGG - Intronic
1141683764 16:85558563-85558585 CCCTCCTGCCTACCCACTGGGGG - Intergenic
1142849374 17:2696853-2696875 CCCTCCTCCCTGGAAAATGGTGG - Exonic
1143175128 17:4950874-4950896 CCCTTGCTCCTCCCAAAGGGTGG + Intronic
1143513040 17:7406274-7406296 CCCTCCTTCCCTCCCACTGGAGG - Intronic
1145217171 17:21061175-21061197 CCCCCCTTCCTCCCACATGCTGG - Intergenic
1145905649 17:28514748-28514770 CCCTGCTGCCTCCCACCTGGCGG - Intronic
1147195518 17:38763915-38763937 CCCTCCTTCCTCACCACAGGCGG + Intronic
1147469013 17:40639562-40639584 CCCTCCTTTCTCCCAAAGAAAGG + Intronic
1147610794 17:41800930-41800952 CACTCCTTCCTCCCATAGGTGGG - Intergenic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1148049123 17:44760482-44760504 CCCTCCTGCCTCCCAGAGGAAGG + Intronic
1148106531 17:45121610-45121632 CCCTCCTTCCTTCCAAGCAGCGG + Intronic
1148970961 17:51481154-51481176 TCCTCCCACCTCCCAAATGTTGG + Intergenic
1150539967 17:66087820-66087842 TCTTCCCTCCTCCCAAGTGGAGG - Intronic
1150620101 17:66801731-66801753 CCGTCCTGCCTCCCACATGTGGG - Intronic
1152685453 17:81691584-81691606 CCCACCTGCAGCCCAAATGGGGG - Intronic
1153348319 18:4052135-4052157 TCCTCCAGACTCCCAAATGGTGG - Intronic
1157440862 18:47710727-47710749 CCCCCATACTTCCCAAATGGTGG + Intergenic
1157461831 18:47904218-47904240 AGCTCCTTCCTCCCATTTGGTGG + Intronic
1158768400 18:60484614-60484636 CCCTCCATCATCCCCTATGGAGG + Intergenic
1160571103 18:79818236-79818258 CCCACCCTCCTCCCAGAAGGAGG + Intergenic
1160681207 19:412425-412447 CCCTCCATCCCCCCAGGTGGGGG + Intergenic
1160792506 19:929190-929212 CCCTCCTTCCTTCCCCATGAAGG - Intronic
1161590314 19:5126503-5126525 CCGTCCTGCCTCCCAGAGGGTGG + Intronic
1162790656 19:13061085-13061107 CCCCCCTCCCCCCCAAATCGAGG + Intronic
1165097229 19:33416298-33416320 CCCTCCTGCCTCGCACTTGGAGG - Intronic
1166101155 19:40572199-40572221 CCCTCCCTCCTGCCCATTGGGGG - Intronic
1166568928 19:43781087-43781109 CCCTCCTTATTCTCAAAAGGGGG - Exonic
1166915884 19:46195986-46196008 CCCTCTCTCCTCCAGAATGGAGG - Intergenic
1166925159 19:46261803-46261825 CCCTCTCTCCTCCAGAATGGAGG + Intergenic
1167303837 19:48695871-48695893 CCCTCCTCCCTCCCCATTGCCGG - Intergenic
1167393583 19:49212419-49212441 ACATCCTTCCTCCAAATTGGAGG + Intergenic
1167503799 19:49861175-49861197 CCCTCCTTCCAGCAAAATGCCGG + Intergenic
1168317415 19:55490236-55490258 TCATCCTTCCTCCCACCTGGGGG - Intronic
925286481 2:2719406-2719428 CCTTCCTTCCTCACAGAGGGAGG - Intergenic
925927437 2:8680360-8680382 ACCTCCTTCCTCCAAACTGAGGG + Intronic
926226491 2:10970841-10970863 CCCTCATTCCTCCCAGATGCTGG + Intergenic
927142952 2:20142062-20142084 CCCTCCCTCTACCCAAATCGGGG + Intergenic
927334001 2:21899459-21899481 CTCTCCTTCCCCCCAAATGTTGG + Intergenic
929614752 2:43297930-43297952 CCCACCTCCCTCCCGGATGGCGG - Intronic
930474214 2:51859306-51859328 TCCACCTTCCTCCCAACTGCTGG + Intergenic
931508878 2:62965891-62965913 CCCTATTTCCTCCAAAATGAGGG + Intronic
932382576 2:71298847-71298869 CCCTCCTCCCTCCCTAAGGAGGG + Intronic
932431693 2:71679399-71679421 CCCTCTTTCCTCCCAATTCCCGG + Intronic
933533261 2:83537589-83537611 CCTTCCTTTATCACAAATGGAGG - Intergenic
935404728 2:102697185-102697207 CTCCTCTGCCTCCCAAATGGGGG + Intronic
936672091 2:114668423-114668445 AAATCCTTCCTCCCAAATGTAGG - Intronic
937209266 2:120257791-120257813 CCCTCCTTCCTCCCACAGGAAGG + Intronic
937273418 2:120669697-120669719 CTCCCCTTCCTGCCACATGGGGG + Intergenic
938956530 2:136303943-136303965 CAGCCCATCCTCCCAAATGGTGG - Intergenic
940121154 2:150267795-150267817 CCCCCCTTCCTCCCAGGAGGTGG - Intergenic
945846275 2:214948784-214948806 CCCTCCTGGTTCCCAAATGCTGG + Intronic
946652516 2:221908827-221908849 CCCACCGTCCTACCAACTGGAGG - Intergenic
948209550 2:236182573-236182595 TCCTCCTGCCTCCCAAAAGGCGG + Intergenic
1168830182 20:841454-841476 CCCTCCTGGCTCTCAAATGAGGG - Intronic
1170262555 20:14426759-14426781 CCATTTTTCCTCCCTAATGGGGG - Intronic
1170538888 20:17368662-17368684 CCCTGCTTTCTCCTGAATGGTGG - Intronic
1171279405 20:23883356-23883378 CCCTCCCTGCTCCCAACTGTGGG + Intergenic
1172073763 20:32278024-32278046 CCCGCCCTCCTCCCAAACTGGGG - Intronic
1172207688 20:33176101-33176123 CCCCTCTCCCTCCCAACTGGAGG - Intronic
1172230093 20:33330644-33330666 CCCTCCTTCCTTCCCACTGTGGG + Intergenic
1172728942 20:37069777-37069799 CCCACCTCCCTCCCGGATGGGGG - Intronic
1173444227 20:43103272-43103294 CCCACCTTCCTCCAAAATCATGG + Intronic
1173923226 20:46761608-46761630 CCCTCCTTCCCGACAGATGGCGG + Intergenic
1174513926 20:51076742-51076764 CCATCCTTCCTCCCAATTCCTGG + Intergenic
1175689272 20:61054034-61054056 CCCTCCCTCCACCCACAAGGAGG + Intergenic
1181134984 22:20758853-20758875 CCCTCCTTACTGCCAGAAGGGGG + Intronic
1183120021 22:35723057-35723079 CCCTCCCTCCTCCCTCCTGGAGG - Intronic
1184255592 22:43285137-43285159 GCCTCATTTCTCCCAAATGGGGG + Intronic
1184404520 22:44292499-44292521 CCCTCCTTCCTCCCATGGTGAGG + Intronic
1184799041 22:46748920-46748942 CTCTCCTTCCTCCCCACCGGGGG + Intergenic
1185189990 22:49429243-49429265 CTCTCCTTCCCTCCAACTGGGGG + Intronic
1185197701 22:49482750-49482772 CCCTCCTTCCTCTCACACTGGGG - Intronic
949985073 3:9534107-9534129 TTCTCCTGCCTCCCAAATAGCGG - Intronic
950021995 3:9793597-9793619 CCCTGCTTCCACCCCATTGGAGG + Intronic
951790105 3:26472002-26472024 TCCTCCATCCTCCAAAAAGGGGG - Intergenic
953873250 3:46646119-46646141 CCCTCCCTCCCCCCAGATTGTGG + Intergenic
954229255 3:49203727-49203749 CCCTCCTTTCTGGCAACTGGAGG - Intronic
954937245 3:54337762-54337784 CCCTCCTTTCTTCCAATAGGTGG + Intronic
955073060 3:55588109-55588131 GCCTCCTTCCTCCCAACTTGTGG + Intronic
955297917 3:57750169-57750191 CGCTTCTGCCTCCCGAATGGTGG - Intergenic
955566891 3:60257032-60257054 CCTTCCTTCCTGCCACCTGGAGG + Intronic
956882498 3:73525431-73525453 CTCTCCCTTCTCCCAAATGTGGG - Intronic
960332472 3:116378770-116378792 TCCACCTTCCTCCCAATTAGTGG + Intronic
961682035 3:128605821-128605843 ACCTCCTTGCTCCTAATTGGAGG - Intergenic
962316779 3:134364151-134364173 CCCTCCCTCCTCCCAAAGCCGGG + Intronic
966015276 3:175132271-175132293 CCCACCTCCCTCCCAGACGGGGG + Intronic
966197333 3:177326394-177326416 CCCCCTTCCCTACCAAATGGTGG + Intergenic
966723310 3:183086002-183086024 CTCTCCTTCAGCCCAAAGGGTGG + Intronic
968093918 3:195914821-195914843 CCCTCCTGACTCAGAAATGGTGG - Intergenic
968472431 4:788233-788255 CCCTCCTTCCTCCCAAATGGAGG + Intronic
968767547 4:2481336-2481358 CCATTTTTCCTCACAAATGGTGG + Intronic
972840368 4:42923148-42923170 CACTCCTCCCTCCCTTATGGAGG - Intronic
974282253 4:59812431-59812453 CCTTCCTTCCTTCAATATGGTGG - Intergenic
978499579 4:109394363-109394385 CCATGCTTCCTGCCACATGGAGG + Intergenic
978856744 4:113402268-113402290 CCCTTCTGCCTCCCAAAGAGTGG - Intergenic
979698861 4:123644348-123644370 CCCTCCTCCCTCCCATCTAGTGG - Intergenic
985189208 4:187353485-187353507 GCCCCCTTCCTGCCAACTGGAGG + Intergenic
985264759 4:188147301-188147323 TCCCCCTGCCTCCCAAATGAGGG + Exonic
985419074 4:189765211-189765233 CTCTCCTTCCTCCCACGTGTCGG + Intergenic
985481464 5:113575-113597 CCCACCCTCATCCCAAATGAAGG + Intergenic
986249501 5:6043770-6043792 CCCTCCTGCCACCCACAGGGCGG + Intergenic
990281996 5:54261048-54261070 CCCTCATTCCTCACAAATGAGGG - Intronic
992133705 5:73721181-73721203 CCATCCTTCCTCATACATGGTGG - Intronic
992950861 5:81856960-81856982 CCATCCTTCCTCCTAGCTGGTGG + Intergenic
997860925 5:137415183-137415205 CTCACCTTCCTCCCTAATTGAGG - Intronic
998071127 5:139198522-139198544 CCCTCCCTCCCCCCAAGGGGAGG - Intronic
998167385 5:139851992-139852014 CCCTCCTTCTTCCAATATTGGGG - Intronic
1000056361 5:157610347-157610369 CCCCCCTTCCCCACAAATAGTGG + Intergenic
1001013014 5:168115510-168115532 TCCTCCTTCCTCCCAAAAGGTGG - Intronic
1001694387 5:173659207-173659229 CCCACCTTCCTCCCAAAACTGGG - Intergenic
1002661474 5:180793359-180793381 CCCTCCTCCTTCCCACCTGGAGG - Intronic
1005032228 6:21521384-21521406 CCTACCTTCCTCCCAGATGGTGG + Intergenic
1006400591 6:33814943-33814965 CCACCCTTCCTCCCATCTGGGGG + Intergenic
1006754440 6:36403106-36403128 CACTTCGGCCTCCCAAATGGTGG + Intronic
1006852039 6:37105514-37105536 GCCTCCTTCCTTTCAAATGCTGG + Intergenic
1007075611 6:39064401-39064423 CCCTCCTTCCTCCCACAGCTGGG + Intronic
1007180020 6:39923122-39923144 ACCTCCTGCCTCCCAGGTGGTGG - Intronic
1012998034 6:105992962-105992984 GCCTCCTTCCTCCAAAAGGATGG + Intergenic
1013180372 6:107712299-107712321 CCCCCCTTCCTGTCAAATGCAGG - Intronic
1013184456 6:107745745-107745767 TCCACCTGCCTCCCAAATGCTGG - Intronic
1016586238 6:145689884-145689906 ACCTCGTTACTGCCAAATGGAGG - Intronic
1017170446 6:151450462-151450484 CCCACCTTCCTCCCGGACGGGGG - Intronic
1017926487 6:158915440-158915462 GCCTCCTTCCTTCCCACTGGCGG - Intergenic
1018590671 6:165418252-165418274 CCCTACTTCTTCCCAACCGGTGG - Intronic
1019513463 7:1429704-1429726 CCCTGCCTCCTCCCAGATGGAGG + Intronic
1019567991 7:1694178-1694200 CCCTGCCTCCTTCCAGATGGAGG - Exonic
1019701118 7:2475461-2475483 CCCTCCTTTCTCCCAAGATGGGG + Intronic
1019917775 7:4144529-4144551 TCCTCCCACCTCCCAGATGGCGG + Intronic
1022864347 7:34401549-34401571 CACTGCTGCCTCCCAAAAGGGGG + Intergenic
1022937524 7:35194329-35194351 CCCTCTTTCCCCCCAAACCGTGG + Intergenic
1023501721 7:40857825-40857847 TCCTCATTCCTCCCAAATCCAGG - Intronic
1025740169 7:64188437-64188459 CCCACCTTGCTCCCAAAGTGCGG + Intronic
1028372606 7:90111272-90111294 CCCTCTTTCCCCCCAAACCGTGG - Intergenic
1028751091 7:94383740-94383762 CCCTCCTTCCTTGCAACTGTGGG - Intergenic
1028770160 7:94610190-94610212 CCCTCCTTCCCCCCAACTTCTGG - Intronic
1029111124 7:98213508-98213530 TCCTCCCTCCTCCCAAGTTGGGG + Intergenic
1029484274 7:100829594-100829616 CCCTCCTCCCTCCCCGATGCAGG + Intronic
1029833684 7:103286972-103286994 CCCTCTTTCCCCCCAAACCGTGG + Intergenic
1030741436 7:113114195-113114217 TCCTCCTTCCTGCCAGATGCAGG - Intergenic
1032206472 7:129870195-129870217 CCCTCCTTCCTTCTCGATGGTGG + Intronic
1032989265 7:137373490-137373512 CCCTCCCTTCTCTCAAGTGGTGG - Intergenic
1033278890 7:139991994-139992016 CCATCCTTCTTCCCATATGAGGG - Intronic
1034281908 7:149860491-149860513 ATCTCCTTCCTCACAAATGCTGG - Exonic
1035727714 8:1834958-1834980 TCCTCCATCCTCCCACCTGGGGG - Intronic
1036938242 8:13026107-13026129 TCCTCCTTCCTCCAAAACTGGGG - Exonic
1037752567 8:21692438-21692460 CCCTCCCTCTCCCCAAAGGGAGG + Exonic
1039106403 8:33994596-33994618 CTCTCCTCCCTCCTAACTGGTGG - Intergenic
1039455286 8:37701879-37701901 CCTTCCTTCCTCCCAACAAGAGG - Intergenic
1040621383 8:49096342-49096364 CCCTCCCGCTTCCCAAGTGGTGG + Intergenic
1044493322 8:92846782-92846804 CCTTCCTTCCTCCCTTGTGGAGG - Intergenic
1044493400 8:92847348-92847370 CCCTCCTTCCTCCCTTATGGAGG + Intergenic
1045508533 8:102795423-102795445 CCCTCCTCCCTCACAAAAAGGGG + Intergenic
1045568375 8:103344384-103344406 CCCACCTACCTCCAAAATAGGGG + Intergenic
1046755109 8:117964553-117964575 TTCACATTCCTCCCAAATGGAGG - Intronic
1047411747 8:124629798-124629820 CCCTGGTTCTTCCCAGATGGAGG - Intronic
1049661821 8:143823005-143823027 CCCTCCTGCCTGCCAAGTGCTGG + Intronic
1049957196 9:704526-704548 CCCTCCTTCCACACTAATAGGGG - Intronic
1049957691 9:708596-708618 CCCGCTTTCTTCCCAAATGTTGG - Intronic
1050400468 9:5248149-5248171 CCATCCTTGCTCCCACCTGGTGG + Intergenic
1052359591 9:27539766-27539788 CCCTCCTTGTTCCCATATGAAGG + Intergenic
1053527771 9:38847148-38847170 CCTCGCTTCCTCCCAAATGCAGG + Intergenic
1054199993 9:62071576-62071598 CCTCGCTTCCTCCCAAATGCAGG + Intergenic
1054638362 9:67516781-67516803 CCTCGCTTCCTCCCAAATGCAGG - Intergenic
1055091765 9:72370476-72370498 TCCTCCTGCCTCCCAAAGTGCGG - Intergenic
1056626819 9:88260598-88260620 CCTTGCTTTCTCCCAAATGCTGG + Intergenic
1058071652 9:100607424-100607446 CCCCCCTGCCTCCTAAATGCTGG - Intergenic
1059627422 9:116081977-116081999 CCATCCTTCCTGCCAAAATGTGG - Intergenic
1060026376 9:120175593-120175615 CCCTCCTTCATTCCAAGTGTGGG - Intergenic
1060222268 9:121770876-121770898 CCCTGATTTTTCCCAAATGGAGG - Intronic
1060660328 9:125401635-125401657 GCCTCCTTCCCCCAAAATGCTGG - Intergenic
1061405837 9:130392593-130392615 ACCTCCTGCCTCCCAAATTCGGG - Intronic
1061485815 9:130920021-130920043 CCCTCCTTCCGCCCACCTGCAGG + Intronic
1061600931 9:131669576-131669598 GGCTCCTTCCTCCGAACTGGAGG + Intronic
1061746044 9:132741028-132741050 CCAGCCTTCCTGCCACATGGTGG + Intronic
1062212586 9:135372842-135372864 CCCGCCTTCCTCCCAGCTGCAGG + Intergenic
1186189850 X:7057583-7057605 CCTTCCTGCCACCAAAATGGCGG - Intronic
1187134215 X:16530934-16530956 GCATCCTTCCTCCAAACTGGGGG - Intergenic
1190098218 X:47499840-47499862 CCCTTTTTCCTCCCAATTGGAGG - Intergenic
1190642763 X:52496079-52496101 CCCTCCTTCCTCCCTAGTTATGG - Intronic
1190644910 X:52516788-52516810 CCCTCCTTCCTCCCTAGTTATGG + Intronic
1190681392 X:52829963-52829985 CCCTCCTTCCTCCCCAGTTGTGG + Intergenic
1190998484 X:55636003-55636025 CCCTCCTTCCTTCCTAGTTGTGG + Intergenic
1192055674 X:67770375-67770397 CTCTGCTTCCTCCAAATTGGAGG + Intergenic
1194413640 X:93583765-93583787 CCCATCTCCCTCCCAAATAGAGG + Intergenic
1195914645 X:109924273-109924295 CCCTTCGGCCTCCCAAATGCTGG + Intergenic
1196761306 X:119203087-119203109 TCTTCCTTCCTCCCAAATTATGG + Intergenic
1198662620 X:138986510-138986532 CCCTCCTTCCTCCCATGTTGGGG - Intronic
1198795527 X:140390457-140390479 CCCCCCTGCCCCCAAAATGGTGG + Intergenic
1199635123 X:149806556-149806578 CTCTCCTTTCTGCCATATGGCGG + Intergenic