ID: 968472864

View in Genome Browser
Species Human (GRCh38)
Location 4:789996-790018
Sequence GGCGTGGCCACCTGTTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 3, 1: 0, 2: 0, 3: 12, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968472864_968472881 19 Left 968472864 4:789996-790018 CCACCCCAACAGGTGGCCACGCC 0: 3
1: 0
2: 0
3: 12
4: 147
Right 968472881 4:790038-790060 CCCCCCAAAGGCCACGCCTGAGG No data
968472864_968472883 20 Left 968472864 4:789996-790018 CCACCCCAACAGGTGGCCACGCC 0: 3
1: 0
2: 0
3: 12
4: 147
Right 968472883 4:790039-790061 CCCCCAAAGGCCACGCCTGAGGG 0: 1
1: 0
2: 1
3: 9
4: 107
968472864_968472875 7 Left 968472864 4:789996-790018 CCACCCCAACAGGTGGCCACGCC 0: 3
1: 0
2: 0
3: 12
4: 147
Right 968472875 4:790026-790048 GGGGTTCCCCCACCCCCCAAAGG 0: 1
1: 0
2: 0
3: 16
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968472864 Original CRISPR GGCGTGGCCACCTGTTGGGG TGG (reversed) Intronic
900314474 1:2050221-2050243 GGCGGGGCTACCTGTTGGGCGGG - Intergenic
900314480 1:2050238-2050260 GGCGGGGCTACCTGTCGGGCGGG - Intergenic
901018915 1:6246123-6246145 GGCGGGGCGTCCGGTTGGGGCGG - Intergenic
903318450 1:22526952-22526974 GGCGTGGCCACTGGGTGGAGGGG - Exonic
903739705 1:25551751-25551773 GACCTGGCCTCATGTTGGGGTGG + Intronic
904364131 1:29999750-29999772 GGAGTGGCCAGCTGTTTTGGGGG - Intergenic
904612044 1:31731212-31731234 GGGTTGGCCTCCTGTGGGGGCGG + Exonic
912799537 1:112712413-112712435 GGCGTGGCCACCAAGTGGAGGGG - Exonic
919743754 1:200995890-200995912 GGTGCTGCCTCCTGTTGGGGAGG - Intronic
920286292 1:204882218-204882240 GGCATGGCCAGGGGTTGGGGTGG - Intronic
920502789 1:206496067-206496089 GCAGTGCCCACCTGTTGGAGAGG - Intronic
920609548 1:207423619-207423641 GGGGTGGCTACCGGTGGGGGCGG + Intergenic
922817013 1:228457159-228457181 GGGGTGGCCACCTGTGGACGAGG + Exonic
1064294277 10:14064427-14064449 GCCGTGGCCACCTGAGGGGAAGG + Intronic
1066665074 10:37774900-37774922 GGCGTGGCCAGCTACTTGGGAGG - Intergenic
1066722241 10:38352358-38352380 GGTGTGGACACCTGTTTGTGGGG + Intergenic
1076371015 10:129953696-129953718 GGGGAGGCCAACTGTAGGGGTGG - Intronic
1076529460 10:131134922-131134944 GGCATGGCCACATGTGGGGTAGG - Intronic
1076636552 10:131885103-131885125 GGGATGGACACCTGCTGGGGAGG + Intergenic
1076698318 10:132257599-132257621 GGGGTGGGCACCAGATGGGGTGG - Intronic
1076749917 10:132537536-132537558 GGCGGGGCCTCCTTTCGGGGCGG - Intergenic
1077306675 11:1871716-1871738 GGCGTGGGCACCTTTGGGAGGGG + Intronic
1077306921 11:1872656-1872678 GGCGTGGGCACCTTTGGGAGGGG + Intronic
1077324218 11:1956776-1956798 GACGTGGCCCCATGCTGGGGAGG + Intronic
1077431393 11:2517580-2517602 GGCGTGGCAACCAGGTGGGATGG + Intronic
1080475174 11:32583760-32583782 TGAGCGGCGACCTGTTGGGGCGG - Intergenic
1081874075 11:46397026-46397048 GCCCTGTCCACCTGTTGGGTGGG - Exonic
1084483240 11:69434053-69434075 GGAGTGGCCTCCTGCAGGGGAGG + Intergenic
1086327586 11:85719623-85719645 GGGTTGGCCGCCTGTTGAGGAGG + Intronic
1086955313 11:92929512-92929534 GGAGTGGCTAGCTGATGGGGAGG + Intergenic
1202807204 11_KI270721v1_random:11971-11993 GACGTGGCCCCATGCTGGGGAGG + Intergenic
1102022927 12:109696386-109696408 TGAGTGGCCATCTGGTGGGGTGG - Intergenic
1103547663 12:121713262-121713284 GGCGTGTTCATCTGTGGGGGTGG + Intronic
1105015483 12:132784137-132784159 GGCCTGGCCATCTGCTGTGGCGG - Intronic
1108267986 13:48731212-48731234 GGCTTGGGCACCTGCTGGGGAGG + Intergenic
1112577636 13:100650549-100650571 GTCGCGGCCACCTGTCGGGGTGG - Intronic
1118809258 14:69261352-69261374 GGCAGGGGCACCTGTTGAGGCGG + Intronic
1121021000 14:90580061-90580083 GGCCTGGCTGCCTGTTGGGCAGG - Intronic
1121053837 14:90836967-90836989 GGGGTGCCCACCTGTGAGGGCGG + Intergenic
1122875756 14:104664172-104664194 GGCGTGGACACCTGTAGGAAGGG - Intergenic
1124364999 15:29064858-29064880 GCGGTGGCCACCTGTTGGCGGGG + Intronic
1125604759 15:40933655-40933677 GGCAAGGCCACATGTCGGGGAGG - Intronic
1127961717 15:63895287-63895309 CGCGGGGCACCCTGTTGGGGTGG - Intergenic
1128082485 15:64864887-64864909 GCACTGGCCACCTGGTGGGGGGG - Exonic
1129888469 15:79055253-79055275 GGAGTGGCCACCAGGTGGGCAGG - Intronic
1130063415 15:80585693-80585715 TTCTTGGCCACCTGGTGGGGTGG - Intronic
1130581114 15:85137442-85137464 GGCCAGGCCATCGGTTGGGGCGG + Intronic
1130990915 15:88875162-88875184 CGAGTTGCCACCTGTTAGGGTGG - Exonic
1132205371 15:99982819-99982841 GCTGTGGGCACCTGCTGGGGAGG - Intronic
1132599235 16:766656-766678 AGGGTGGCCACCTGTGGGAGGGG - Exonic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1134457463 16:14405643-14405665 GACGGGGCGATCTGTTGGGGAGG - Intergenic
1138298524 16:55907704-55907726 GGCCTTGCCACCTGCTGTGGGGG - Intronic
1142960333 17:3548498-3548520 GGCATGGCCACTTCCTGGGGTGG + Intronic
1144029219 17:11304583-11304605 GGAGTGGGCACAGGTTGGGGAGG + Intronic
1145905861 17:28515939-28515961 GGGGTGTACACCTGTTGAGGAGG - Intronic
1146266700 17:31457699-31457721 GGTGTGGCCACCTGCGGGGCTGG - Intronic
1146759859 17:35467687-35467709 GCTGTGGCCTCCTGATGGGGGGG - Intronic
1151574287 17:74943911-74943933 GGCGTCAGCACCTGATGGGGTGG - Intronic
1151964106 17:77422409-77422431 GGCGTGGCCAGCGAATGGGGAGG + Intronic
1152658333 17:81530289-81530311 GGCCTGGGCTCCTGGTGGGGAGG + Intronic
1152902158 17:82948471-82948493 GGCGTGGCCTCTGGGTGGGGTGG + Intronic
1155954138 18:31943006-31943028 GGCGTCTCCACCTATCGGGGTGG - Exonic
1160922715 19:1528451-1528473 GGCGTGGGCAGGTGTTGGGCAGG - Intronic
1161252779 19:3290069-3290091 GGCCTGGCCACGGGCTGGGGAGG - Intronic
1161447662 19:4327501-4327523 GGCGGGGCCTTCTGTGGGGGCGG - Intronic
1161793322 19:6373415-6373437 GGCGTGGCCACGCTTGGGGGCGG + Intronic
1161964643 19:7541316-7541338 GGCGTGGCCATAAGATGGGGCGG - Intronic
1162421308 19:10567602-10567624 GGAGTGACCAGCTTTTGGGGGGG - Intronic
1162528699 19:11222895-11222917 CGCGTGGCCACCTGCAGGAGAGG + Exonic
1168109742 19:54185481-54185503 GGAGTGGCCACCAATTGGGCAGG - Intronic
1168164150 19:54535168-54535190 GACGTGACTACTTGTTGGGGAGG - Intronic
1168164286 19:54536071-54536093 GACGTGACTACTTGTTGGGGAGG - Intronic
1168255147 19:55160979-55161001 GGCGGGGCCTGCTGTGGGGGCGG + Intronic
1168713379 19:58513992-58514014 GGCGTGGCCGACTGTGCGGGAGG + Exonic
925931197 2:8709481-8709503 GGCATGGCCACCTGCTGTGCAGG + Intergenic
929518185 2:42623512-42623534 GCTGTGGCCACCTGTTGTGCTGG - Intronic
930510302 2:52336020-52336042 GGCAAGGACACCTGGTGGGGTGG - Intergenic
932201080 2:69829279-69829301 GGCGTGGCCTCCTGTGAGAGGGG - Intergenic
932796088 2:74697618-74697640 GGGGTTGCCTCCTGCTGGGGAGG + Intergenic
934648517 2:96073247-96073269 GGGGTGGCCTCCTATTGGGGAGG + Intergenic
934653946 2:96107777-96107799 GGAGTGGCCACCTGCCTGGGCGG - Intergenic
936146987 2:109986797-109986819 GGCGTGGCCGCCTGTGCGGGAGG + Intergenic
936197705 2:110384686-110384708 GGCGTGGCCGCCTGTGCGGGAGG - Intergenic
937340400 2:121087297-121087319 GGCGTGGGCACGTGTGGGTGAGG + Intergenic
937880004 2:126857814-126857836 GGATGGGCCACCTGTTGGTGGGG - Intergenic
946849880 2:223895480-223895502 TGCGTGACCACTTGTGGGGGTGG - Intronic
949048198 2:241881873-241881895 GGTGTGGCCACGTGTGAGGGGGG + Intergenic
1172447521 20:35000976-35000998 ATCATGGCCGCCTGTTGGGGAGG - Exonic
1172603205 20:36197664-36197686 GGGATGTGCACCTGTTGGGGTGG + Intronic
1179887364 21:44319880-44319902 GGCGTGGCCTCGTGTTGTGTTGG + Intronic
1180049706 21:45325554-45325576 GGTATTGCCACCTGTTGTGGGGG - Intergenic
1180127046 21:45799978-45800000 GGCTTGGACAGCTGTCGGGGAGG + Intronic
1180995621 22:19963833-19963855 GGTGTGAACACCTGGTGGGGAGG - Intronic
1180998199 22:19975872-19975894 GGCCTGGGCACCTGTGGGAGTGG + Intronic
1181037826 22:20178388-20178410 GGTGTGGCAGCTTGTTGGGGAGG + Intergenic
1183665088 22:39242442-39242464 GCCGCGGCCAGCTGTTGGGGAGG - Intronic
1184415130 22:44347752-44347774 AGCCTGGGCAGCTGTTGGGGAGG + Intergenic
952356955 3:32593259-32593281 GGAGGGGCGACCTGGTGGGGAGG - Intergenic
961381108 3:126497102-126497124 GACGTGGTCACCTGTGGAGGAGG - Intronic
968472837 4:789918-789940 GGCGTGGCCACCTGTTGGGGTGG - Intronic
968472864 4:789996-790018 GGCGTGGCCACCTGTTGGGGTGG - Intronic
968472894 4:790072-790094 GGCGTGGCCACCTGTTGGGGTGG - Intronic
969531464 4:7733205-7733227 GGGGTCTCCACGTGTTGGGGGGG - Intronic
969569775 4:8001595-8001617 GGCCTGGCCTCCTGCTGGGCAGG - Intronic
973853538 4:54986732-54986754 GGCATGGCCACCAGTCGTGGTGG - Intergenic
973942998 4:55929094-55929116 GGGATGGCCATCTGTTGGAGAGG + Intergenic
985629818 5:1008655-1008677 GGCCCGGCCACCTGTGGGGGCGG - Intergenic
987795882 5:22626140-22626162 AGAGTGCCCACATGTTGGGGGGG - Intronic
988035532 5:25823364-25823386 GGGGGCGGCACCTGTTGGGGAGG + Intergenic
991975422 5:72179619-72179641 GGCTTGGCCAGATGCTGGGGCGG + Intronic
1000084790 5:157879591-157879613 GGGGGTGGCACCTGTTGGGGAGG - Intergenic
1001084000 5:168687185-168687207 GGAGAGGCCACCTGCTGAGGGGG - Intronic
1001773268 5:174311481-174311503 GGCATGGCCCCCTTTTGAGGGGG - Intergenic
1003362825 6:5444920-5444942 GGCCTGGCCACCAGCTGGGCTGG + Intronic
1004426315 6:15509594-15509616 GGCCAGGCCACCAGCTGGGGAGG + Intronic
1004620367 6:17325967-17325989 GCTGTGGCCACCTCTTGGAGGGG + Intergenic
1006506092 6:34489732-34489754 ATCGTGGCCCCCTGTTAGGGCGG - Intronic
1006694905 6:35922677-35922699 GACGTGGACACCTGTAGGTGGGG + Intergenic
1007659851 6:43477484-43477506 GGCGGGGCCTCGGGTTGGGGAGG - Intergenic
1008962372 6:57278777-57278799 AGCGTGTCCAGCAGTTGGGGAGG + Intergenic
1018060528 6:160086403-160086425 GGAATGGACCCCTGTTGGGGTGG + Intronic
1019303676 7:322349-322371 GGCGTGGCCGGGGGTTGGGGCGG - Intergenic
1019448129 7:1081926-1081948 GGCCTGGCCACCTGGTGGGTGGG - Intronic
1019612210 7:1942268-1942290 GGCGTGGCCTCCTTCTGGAGGGG - Intronic
1019697140 7:2452206-2452228 TGCTCGGCCACCTGTGGGGGAGG - Intergenic
1021101141 7:16586720-16586742 GGCTTGGACAGCTGTTGTGGCGG + Intergenic
1021717338 7:23471393-23471415 GGCTTGGCCACTGGTGGGGGAGG + Intergenic
1027671369 7:81103959-81103981 AATATGGCCACCTGTTGGGGGGG + Intergenic
1028599832 7:92589929-92589951 GGCGGGGCCAGGTGTGGGGGGGG + Intronic
1033660557 7:143399218-143399240 GGCGTGGCCATCTGGAGGGAGGG - Intronic
1034694753 7:153043626-153043648 GACGTGGCCACCTGCAGGAGGGG + Intergenic
1035222688 7:157415518-157415540 GGTGTGCCCACCTGTGGGGAGGG - Intronic
1035641146 8:1186093-1186115 GGCGAGGCCACCGAGTGGGGAGG - Intergenic
1035772209 8:2156580-2156602 GGCGTGGCCCTCTGTTGGGTGGG + Intronic
1038644863 8:29352676-29352698 GGCGTGGCCTCCCTGTGGGGAGG + Intergenic
1041044745 8:53879537-53879559 GGCTTGGCTACCGGATGGGGGGG - Exonic
1043725951 8:83611211-83611233 GGGGGTGGCACCTGTTGGGGAGG + Intergenic
1047258553 8:123235598-123235620 GTCCTGGCAACCTGTTGGGCAGG - Intronic
1048009233 8:130443218-130443240 GGCGAGGCCGCCCGGTGGGGGGG - Intronic
1048373406 8:133800221-133800243 GGCGTGGCCAGCTGAGAGGGAGG + Intergenic
1048976850 8:139677984-139678006 GCCGTGGGGACCTGTTGGGCTGG - Intronic
1049205541 8:141361868-141361890 GGTGTGCCCACCTGGAGGGGTGG - Intronic
1049729164 8:144167175-144167197 GGAGTGGCCGGTTGTTGGGGTGG + Intronic
1049729184 8:144167236-144167258 GGAGTGGCCGGTTGTTGGGGTGG + Intronic
1049729236 8:144167396-144167418 GGAGTGGCCGGTTGTTGGGGTGG + Intronic
1056548354 9:87631400-87631422 GTCGTGGCCAACTTTTAGGGAGG + Intronic
1061165946 9:128922271-128922293 AGCGCGGCCTCCTGGTGGGGAGG - Exonic
1062410072 9:136419173-136419195 GGAGTGGCCACCTGTGGGCCTGG + Intronic
1062446937 9:136599057-136599079 GGCCTGCCCTCATGTTGGGGTGG + Intergenic
1062461866 9:136665704-136665726 GGCGGGGCCGCCAGGTGGGGCGG + Intronic
1062526035 9:136978482-136978504 GGCGTGGTCATCTCCTGGGGCGG + Intronic
1062526048 9:136978514-136978536 GGCGGGGCCACCTCCCGGGGCGG + Intronic
1062526066 9:136978552-136978574 GGCGTGGTCAGCTCCTGGGGCGG + Intronic
1062526101 9:136978655-136978677 GGCGGGGCCAGCTCTTGGGGCGG + Intronic
1062526112 9:136978688-136978710 GGCGTGGTCAGCTCCTGGGGCGG + Intronic
1062526136 9:136978754-136978776 GGCGTGGTCAGCTCCTGGGGCGG + Intronic
1203490760 Un_GL000224v1:102678-102700 GGCGTGGGCACATATTGAGGGGG + Intergenic
1203503384 Un_KI270741v1:44556-44578 GGCGTGGGCACATATTGAGGGGG + Intergenic
1195412833 X:104587306-104587328 GGCCTGGCCATCTGTGGTGGTGG - Intronic
1196388959 X:115189919-115189941 GGCGTGGCCCTCTTGTGGGGTGG - Exonic
1197186084 X:123588941-123588963 GGCTTGGCCTCTTGTTGGGTTGG - Intergenic