ID: 968474786

View in Genome Browser
Species Human (GRCh38)
Location 4:799103-799125
Sequence ACAGGTGAAAAGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 16, 3: 63, 4: 502}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968474786_968474793 16 Left 968474786 4:799103-799125 CCTTCTGCCCTCTTTTCACCTGT 0: 1
1: 0
2: 16
3: 63
4: 502
Right 968474793 4:799142-799164 ATCTTCCCCTGACTTCCTGTTGG 0: 1
1: 0
2: 0
3: 23
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968474786 Original CRISPR ACAGGTGAAAAGAGGGCAGA AGG (reversed) Intronic
900352511 1:2242286-2242308 ACAGCCGAGAAGAGTGCAGAGGG + Intronic
900631313 1:3637197-3637219 AGAGGTGAAAAGAAGGGAAATGG + Intronic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
901644254 1:10708227-10708249 ACAGGAGGAAGGAGGTCAGAAGG - Intronic
901741179 1:11343009-11343031 ACAGGGGAGAAGAGGGGAGGTGG + Intergenic
901748484 1:11390515-11390537 AGAGGAGAAAGAAGGGCAGAGGG + Intergenic
901817727 1:11804506-11804528 ACAGGCCAACAGAGGGCATAGGG + Intronic
902391813 1:16111288-16111310 AGAGCTGAGAAGAGGGAAGATGG - Intergenic
903017814 1:20373095-20373117 ACAAGAGAAAGGAGGGAAGAGGG + Intergenic
903326067 1:22569259-22569281 ACAGGAGACAAGAGGGCATCAGG - Intronic
903410483 1:23139360-23139382 ACAGATGTACAAAGGGCAGAAGG + Intronic
903474115 1:23607629-23607651 AGATGGGGAAAGAGGGCAGAAGG - Intronic
903478649 1:23637675-23637697 ACAGTTGAGAAGAGGGCAGAAGG - Intronic
903967246 1:27098566-27098588 AGAGGTGAAAAAGAGGCAGAGGG - Intergenic
904046519 1:27612492-27612514 ACAAGAGAATAGAGGGTAGAAGG + Exonic
904302256 1:29561856-29561878 CCAGGTGGAATGAGGGCAGGTGG + Intergenic
904484994 1:30818821-30818843 AAAGGTTAGAAGAGGCCAGAGGG + Intergenic
905582990 1:39096242-39096264 ACAGGTGAAAGGAGGGCAGGAGG + Intronic
905888108 1:41502567-41502589 GCAGGTGAAGAGGGTGCAGATGG - Intergenic
906059503 1:42939228-42939250 ACATGTGAAGAGAGGACAGAAGG - Intronic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906319341 1:44806765-44806787 ACAGGTAAGAAGGGGGTAGAAGG - Intergenic
906588356 1:47000801-47000823 ACAGGTGGGAAGAAGGCAGGTGG + Intergenic
906668182 1:47636413-47636435 CCAGGGGAAATGAAGGCAGAGGG - Intergenic
907952813 1:59200142-59200164 ACAGGTGCAATGAAGGCAGCAGG + Intergenic
909023098 1:70453402-70453424 GCAGGTGAAAAGAGGGAAGAAGG + Intergenic
909023181 1:70454510-70454532 GCAGGTGAGAAGAGAGAAGAAGG + Intergenic
909140959 1:71864539-71864561 GTAGGTGAAAAGGTGGCAGATGG + Intronic
909565194 1:77045801-77045823 AGAGGTGAAAAGATGTCAGCTGG + Intronic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
911563413 1:99434071-99434093 ACAGGTGAAGAGAGGATGGAAGG - Intergenic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
912418612 1:109528782-109528804 AGAGGTGTACAAAGGGCAGAAGG - Intergenic
912709985 1:111943253-111943275 GCAGCTGCAAATAGGGCAGAGGG + Intronic
912752962 1:112300710-112300732 AGAGGAGAAAAGAGGGTTGAAGG + Intergenic
912903664 1:113680362-113680384 AGAGTTGATAAGAGGACAGATGG + Intronic
913502102 1:119480753-119480775 ACATTTCAAAAGAGGGCAGAAGG + Intergenic
913513727 1:119585032-119585054 ACATTTGGAAACAGGGCAGAGGG + Intergenic
914456703 1:147843275-147843297 ACATGTGCAAAGAGGTCACATGG + Intergenic
914716099 1:150256574-150256596 GCAGGAGCAAGGAGGGCAGAGGG + Intergenic
915083202 1:153366125-153366147 ACAGAGGACAGGAGGGCAGAAGG - Intergenic
916027683 1:160848823-160848845 ACAGATGAAGAGATGGCATAGGG - Intronic
916579553 1:166095363-166095385 ACAGGTTTAAAGATGGCAGAGGG + Intronic
917725075 1:177820570-177820592 AGAGGAGAGAGGAGGGCAGAAGG - Intergenic
917941892 1:179930554-179930576 ACAGGTGATATAAGGGCAAAGGG - Intergenic
919118657 1:193312740-193312762 ACAGGAGAAAAGAGACCTGAAGG + Intergenic
919946948 1:202326499-202326521 ATAGTTGAAAAGAGGTCAGTGGG - Intergenic
920121477 1:203661906-203661928 ACAGGTGAGAAGGGTGGAGAAGG - Intronic
920147947 1:203878945-203878967 ACAGGAGAAAAGAGGGCTGAAGG - Intergenic
920506996 1:206522282-206522304 AGATGTGGAAAGAGGGGAGACGG + Intronic
920555686 1:206902642-206902664 ACAGGTGAAATGAGCCCAGGTGG - Intronic
920920998 1:210297100-210297122 ACATCTGACAAGAGTGCAGAGGG - Intergenic
920998136 1:211014872-211014894 ACAGGTGAGAAGACAGCATATGG + Intronic
922066862 1:222152566-222152588 AGGGGTAAAAGGAGGGCAGATGG + Intergenic
922072080 1:222204519-222204541 ACTGGAGAAAAGAGGGCTGGAGG + Intergenic
922333320 1:224597228-224597250 GCAGGTGAAAGGAGAGAAGAAGG - Intronic
923302593 1:232655751-232655773 ACAGGTGAAAAGAAAGCTGAGGG + Intergenic
923985675 1:239379041-239379063 ACAAGTGAATAGATGGCAGAAGG - Intergenic
924316798 1:242806261-242806283 AAAGGAGAAAAGTAGGCAGAAGG + Intergenic
1062793712 10:326304-326326 ACAGGCGTGAAAAGGGCAGAGGG + Intronic
1062899192 10:1129259-1129281 ACAGGTGAACAGATTGCACACGG - Exonic
1063018277 10:2100321-2100343 AAAGGTGAAATAAGGGCTGATGG - Intergenic
1063069530 10:2647366-2647388 ACAGATGAAAGGATGACAGATGG - Intergenic
1063094096 10:2894021-2894043 AAAGGTGAAAAGAGGGGAAAAGG + Intergenic
1063774045 10:9239717-9239739 ACATATGAAATAAGGGCAGATGG + Intergenic
1063886545 10:10585375-10585397 AAAGGTGTACAGAGGACAGAAGG - Intergenic
1063956235 10:11270249-11270271 ACAGGTGGACAGAGGACAAAGGG - Intronic
1064709819 10:18111720-18111742 AGAGGTGAAGAGAGAGGAGAGGG + Intergenic
1064876916 10:20004868-20004890 ATCAGTAAAAAGAGGGCAGAAGG + Intronic
1065038732 10:21668298-21668320 ACAGGTAAAAGGAGACCAGAAGG - Intronic
1065053720 10:21821197-21821219 GCAGGTGAAAGGAGGGCAGGAGG + Intronic
1065402981 10:25327765-25327787 AAAGGTTAAAAGAGAGCAAAAGG + Intronic
1065932333 10:30490787-30490809 ACAAGTGAAAAAGGGGTAGAAGG + Intergenic
1067337774 10:45378771-45378793 AGAGGTGAACAAGGGGCAGAGGG - Intronic
1069807087 10:71132801-71132823 ACAGGGGAGAAGAGGGAGGATGG - Intergenic
1069836453 10:71311498-71311520 CCTGGTGAAAATAGGGCAAAGGG + Intergenic
1070219891 10:74430356-74430378 ATAGGTGAACAGAGGGAAGTGGG - Intronic
1071336493 10:84604671-84604693 ACAGCTGCCAAGAGAGCAGAGGG - Intergenic
1071890986 10:90006882-90006904 ACAAAAGAAAAGAGGACAGATGG + Intergenic
1072581178 10:96741271-96741293 ACAGGGGAAATGGGGGAAGAAGG - Intergenic
1072597643 10:96889609-96889631 AAAGATGAAATGAGGTCAGAAGG - Intronic
1072734992 10:97873242-97873264 ACAGTTGAAAGGAAGGGAGAGGG + Intronic
1072805705 10:98422995-98423017 GCAGGTGAAAGGATGCCAGAGGG - Intronic
1073045830 10:100637754-100637776 CCAGGGGAAAAGTGGGGAGAAGG - Intergenic
1073286845 10:102394636-102394658 ACAAGAGAAAAGAGGGAGGAGGG + Exonic
1073494534 10:103879471-103879493 AAGGCTGGAAAGAGGGCAGAGGG + Intergenic
1073626556 10:105103507-105103529 AGATGTGAAATGAGTGCAGAAGG + Intronic
1075702755 10:124479718-124479740 TCAGGTGAAATGAAGGCATAAGG - Intronic
1075955424 10:126519162-126519184 AAAGGTGAACAGAGTGGAGAGGG + Intronic
1076277754 10:129218790-129218812 ACAGGGGAAAAGAGGGCGCGGGG - Intergenic
1076434983 10:130434527-130434549 AGAGGTGAAAAGAAGGGACAAGG + Intergenic
1077061006 11:617874-617896 ACAGGAGAGGGGAGGGCAGAGGG - Intronic
1077086090 11:751974-751996 ACAGGTGAAAGGAGAGGAGAAGG - Intronic
1078257665 11:9673824-9673846 GCAGGCGAAAAAAGGGCAGAAGG + Intronic
1078495730 11:11814615-11814637 ACAAATGAAAACAGGGTAGACGG + Intergenic
1078507036 11:11959911-11959933 ACAGGTGGGGAGAGGGCAGGTGG - Intergenic
1078638662 11:13075717-13075739 GGAGGGGAAATGAGGGCAGAGGG - Intergenic
1079372177 11:19861014-19861036 GACGGTGGAAAGAGGGCAGAGGG + Intronic
1080642805 11:34167539-34167561 CCTGGGCAAAAGAGGGCAGATGG + Intronic
1081307786 11:41534751-41534773 ACAGGAGAAGAGATGGCACAAGG - Intergenic
1081871427 11:46384317-46384339 AGAGGTTTGAAGAGGGCAGATGG + Intergenic
1082087755 11:48064189-48064211 ACAGTTAAAATGAGGGTAGAGGG - Intronic
1083210710 11:61183678-61183700 GCAGGTGAAAAGAAGGCCGAAGG - Intergenic
1083793991 11:65003974-65003996 ACAGGTCCAGAGAGGGCACAAGG - Intergenic
1084068805 11:66720643-66720665 ACAGGTGGAGAGGGAGCAGAGGG + Intronic
1084150073 11:67284008-67284030 ACAGGTGATAAGAAGGGAGAGGG - Intronic
1084150931 11:67287686-67287708 AGAGATGAAAAGAGGCCAGACGG + Intergenic
1084276818 11:68056317-68056339 GCAGGTGAAAGGACGGCAGAAGG - Intronic
1084616684 11:70240995-70241017 ACAGGTGAAATGGGTGAAGAGGG - Intergenic
1084648988 11:70477285-70477307 ACAGATGAAATGAAGGCAGTGGG + Intronic
1085000002 11:73024479-73024501 ACATGTAAACAGATGGCAGAGGG + Intronic
1085331099 11:75651932-75651954 ACAGCTGAAAAACAGGCAGAGGG - Intronic
1085448628 11:76617430-76617452 CCAGGTGAAATGAGGGCACTGGG + Intergenic
1085593085 11:77782640-77782662 ACATTTGAAAATAGGGTAGAGGG + Intronic
1086139463 11:83479222-83479244 AAAAGTGGAAAGATGGCAGATGG - Intronic
1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG + Intronic
1087621927 11:100552944-100552966 ACAGGTAGCAAGAGAGCAGAAGG - Intergenic
1087628636 11:100624635-100624657 ACAGGTGATAATGGGGAAGAAGG - Intergenic
1087747847 11:101970382-101970404 ACAGGTGAAACTATGGCAGGTGG + Intronic
1088474073 11:110217047-110217069 ACAGATGAAAAGAGTGCACTGGG - Intronic
1089067103 11:115670356-115670378 ACAGGGGCAGAGAGTGCAGAAGG - Intergenic
1090310426 11:125731902-125731924 TCAGGTGAGAAGAGGGAACAAGG - Intergenic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1090626069 11:128610010-128610032 ATAGGTAAAAAAAAGGCAGAGGG + Intergenic
1090915482 11:131158971-131158993 ACAGGACAAAATAAGGCAGAAGG - Intergenic
1091004799 11:131943115-131943137 GGAGGTGAGAAGAGGCCAGAAGG - Intronic
1091104215 11:132903214-132903236 AAAGCTACAAAGAGGGCAGAAGG + Intronic
1091262049 11:134242367-134242389 ACAGGTGAAGAAAAGGCAGTTGG - Intronic
1091320206 11:134644123-134644145 ACAGGTGTAAAGAAAGCAGCCGG + Intergenic
1091832229 12:3557924-3557946 ACAGGTGAAACCTGTGCAGAGGG - Intronic
1091902432 12:4155133-4155155 AGAGATGAATAGAGGGCATAGGG + Intergenic
1092062211 12:5560671-5560693 AAAGGTAAAAAGTGGGCTGAGGG - Intronic
1092177178 12:6417962-6417984 ACAGGTAAAAAGAGGGCAGGAGG + Intergenic
1092380268 12:7990454-7990476 AGGGGTGAGAAGAGGCCAGAAGG + Intergenic
1092970533 12:13689950-13689972 AGAGGAGAGAAGAGGGGAGAAGG - Intronic
1093735900 12:22619955-22619977 ACACGTGAAAAGAAGCCAGTAGG + Intergenic
1094664396 12:32504268-32504290 ATAGGTGAAGAGTGGGCAGCAGG + Intronic
1094742233 12:33303172-33303194 GCAGGTGAAAGGAGGGCAGAAGG - Intergenic
1095882761 12:47155920-47155942 AAAAGTGAAAGGAGGGGAGAAGG + Intronic
1095956504 12:47809346-47809368 ACAGGTGAGAAGAGTGAGGAAGG - Intronic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1097373669 12:58815330-58815352 AGTGGGGAACAGAGGGCAGATGG + Intergenic
1099027516 12:77484164-77484186 ACAGAGAAAAAGAAGGCAGAGGG + Intergenic
1099462483 12:82940683-82940705 AGGGGTGGAAAGAGGTCAGAAGG - Intronic
1099970861 12:89499146-89499168 GAAGCTGAAAAGGGGGCAGATGG + Intronic
1100243265 12:92730896-92730918 ACTCCTGAGAAGAGGGCAGAGGG - Intronic
1100413328 12:94345529-94345551 GCAGGTAAAAGGAGGACAGAAGG - Intronic
1100447707 12:94676554-94676576 ATAGTTGAAGGGAGGGCAGAGGG + Intergenic
1101079906 12:101171990-101172012 ACAGGTGAAAATGGAACAGAAGG + Intronic
1101475419 12:105042222-105042244 ACAAATGTAAAAAGGGCAGAAGG - Intronic
1101736367 12:107466280-107466302 AGAGGTTAGAAGAGGGCAGAGGG + Intronic
1102104331 12:110307667-110307689 ACTGTTGAAAAGTGGGCAAAGGG - Intronic
1102163535 12:110788090-110788112 GCAGGTGAAAGAAGGGGAGAAGG + Intergenic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102486748 12:113263681-113263703 ACAGGTAAAATGTGGGAAGAGGG - Intronic
1102920060 12:116785092-116785114 ACAGGAGGGAGGAGGGCAGAGGG - Intronic
1103070845 12:117940476-117940498 ACAGATGAAAATAAGGCTGATGG - Intronic
1103288835 12:119827012-119827034 AGAGGTAAAAAGAGAGGAGAGGG - Intronic
1103834665 12:123809221-123809243 ACAGGAGAGAAGAGGACAGATGG - Intronic
1103920793 12:124398234-124398256 AAAGGAGAGAAAAGGGCAGAAGG - Intronic
1104461179 12:128957513-128957535 ACAGGAGAAAAGGGGGTGGAAGG - Intronic
1104967158 12:132513535-132513557 AGAGGTGACCAGAGGGCTGATGG - Intronic
1106427861 13:29650344-29650366 ACAGGCGAAAGGAAGGCAGAAGG - Intergenic
1106668420 13:31878233-31878255 ACAGATGAAATGATGGCACAAGG - Intergenic
1110355582 13:74562964-74562986 ACATATGAAAAGAGGGGACAGGG - Intergenic
1110534649 13:76637276-76637298 ATAGGTGAATAGGGAGCAGAGGG - Intergenic
1111086337 13:83380423-83380445 AAAGAAGAAAAGAAGGCAGAAGG - Intergenic
1111215281 13:85133181-85133203 ACAGGTTAAAAGGGAGCAAAAGG - Intergenic
1111596934 13:90423988-90424010 ACAGGCGAAATGAGGACACAGGG - Intergenic
1112289685 13:98134506-98134528 TCAGGTGATAATAGGGCTGAAGG + Intergenic
1113180311 13:107617692-107617714 ACAAGTGCAAAGAAGGCAGCTGG + Intronic
1113308728 13:109108669-109108691 CCAGGTGCAAAGAGAGCAAATGG + Intronic
1114605840 14:23995478-23995500 TCAGCTGAAAAGAGGACAGGTGG - Intronic
1115709881 14:36039278-36039300 ACAGGGGAAAAGTGGGGAAAGGG - Intergenic
1116711550 14:48374234-48374256 ACAAGGGAAAAGAGGACAGCGGG - Intergenic
1118387780 14:65270777-65270799 CCAGGTGACAAAAGGGAAGACGG + Intergenic
1118391892 14:65302904-65302926 ACAAGAATAAAGAGGGCAGAAGG + Intergenic
1118625131 14:67651882-67651904 AAAGGGAAAAATAGGGCAGAGGG - Intronic
1119424412 14:74526577-74526599 ACAGCAGAAGAGTGGGCAGAGGG + Intronic
1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG + Intergenic
1120788311 14:88556658-88556680 ACAAGTGGAAAGAGGGCAGGAGG - Intergenic
1122018727 14:98819202-98819224 ACAGGTTGAAAGAGGGAAGGAGG + Intergenic
1122406867 14:101505912-101505934 AATGGTGAAAAGGGGGCAGGAGG - Intergenic
1122610370 14:102978252-102978274 ACAGGTAAAAAGAGGAAAGATGG + Intronic
1122869724 14:104632721-104632743 CCAGCTGAAAAGTGAGCAGAGGG + Intergenic
1124798156 15:32803054-32803076 ACCTGTGAAAGCAGGGCAGATGG + Intronic
1127332614 15:57953857-57953879 ACAGCTGGAAAGATGGAAGAAGG + Exonic
1127533170 15:59865037-59865059 GCAGATGAAAGGAGGGCAGGAGG - Intergenic
1127768320 15:62209481-62209503 ACAGGTGAGAAGAAGCCATAGGG + Intergenic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1129348518 15:74939727-74939749 GCAAGAGACAAGAGGGCAGAAGG - Intergenic
1129882780 15:79018167-79018189 ATTGGTGTAATGAGGGCAGAGGG - Intronic
1130924167 15:88372766-88372788 ACAGGTCAAAAAAGTGAAGATGG + Intergenic
1131549174 15:93341940-93341962 ACAGCTGAAAAGAGGGTAGTGGG + Intergenic
1131712968 15:95075662-95075684 ACTAGTGAAAAGAGGGAAGCGGG - Intergenic
1132626472 16:894029-894051 ACAGGGGACGAGTGGGCAGACGG - Intronic
1133856006 16:9549799-9549821 AAAGGTTAAATGAGGTCAGAGGG + Intergenic
1133921359 16:10156104-10156126 GCAGGTGCAGAGTGGGCAGATGG - Intronic
1134028420 16:10972379-10972401 ACAGGAGAAAACAGAGCAGGAGG - Intronic
1134367023 16:13588838-13588860 ACAGGAGATAAAAGGGCAAATGG + Intergenic
1134487450 16:14669827-14669849 ACAGGTGAATAGATGGAGGATGG + Intergenic
1136230350 16:28882296-28882318 ACAGGTGAAAACAGGTGAGAGGG - Intronic
1137006868 16:35284655-35284677 AAAGGCATAAAGAGGGCAGAAGG - Intergenic
1137686286 16:50389198-50389220 ACAGGTTCAAGGAGGTCAGAAGG + Intergenic
1139423694 16:66865716-66865738 TCATGTGAAATGAGGGAAGATGG - Intronic
1139561307 16:67744126-67744148 TCAGGTGAATAGAGGGTAGCAGG - Intronic
1140153271 16:72394537-72394559 ACATGTGTAAAGATGGAAGAAGG + Intergenic
1140436541 16:74951499-74951521 ACAAGTGGAAAGACGGCAGTGGG - Exonic
1140559927 16:75967108-75967130 AGAGGTGAGAGGAGGACAGACGG + Intergenic
1140716686 16:77733004-77733026 ACAGGTGAAAAGAAGGCTGATGG - Intronic
1142229061 16:88891084-88891106 TCAGGTGAAAGCAGGTCAGATGG - Intronic
1142627615 17:1202587-1202609 AGATGTGAAAAGGGGGCAGCTGG - Intronic
1142803915 17:2361818-2361840 AGAGCTGAAAGGAGGGAAGAAGG - Intronic
1143360577 17:6365991-6366013 AGAGGTGAAAAGAGTGGCGAAGG - Intergenic
1145230671 17:21171245-21171267 TCAGGGGAAATAAGGGCAGATGG + Intronic
1145748255 17:27336512-27336534 ACAGGTGACAGGAGGGGAGGGGG - Intergenic
1146556214 17:33826570-33826592 ACAGGCCCAGAGAGGGCAGATGG + Intronic
1147305060 17:39557477-39557499 AAAGGTCAAGAGAGGACAGAAGG - Intronic
1147741935 17:42674905-42674927 AGAGGTGAATGAAGGGCAGAGGG + Intronic
1148087735 17:45004644-45004666 GCAGGCGCAAAGAGGACAGAAGG - Intergenic
1148229118 17:45920229-45920251 CCAGGTGACAGGAGGACAGAGGG - Intronic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1149128275 17:53262367-53262389 ACAGGTGCAAAAATGGCAAAGGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150466861 17:65400954-65400976 ACAGATGAAGAGAGGGAGGAAGG - Intergenic
1152157360 17:78643660-78643682 GCAAGGGAAATGAGGGCAGAAGG - Intergenic
1152189358 17:78879109-78879131 GCAGGTGAAGAGAGGGTACAGGG + Intronic
1152395356 17:80029687-80029709 AAAGGAGACAAGAGGGGAGACGG - Intronic
1152413304 17:80142383-80142405 GCAGGTGAAAGGAGAGCAGAAGG - Intronic
1152428844 17:80236294-80236316 ACAGGAGCAGAGAGGGCAGCCGG - Intronic
1153140481 18:1966901-1966923 ACATGTGGAAAGATGGTAGAAGG + Intergenic
1153455950 18:5282391-5282413 ACAGGTGAAAGAAGGACAGAAGG - Intergenic
1153503460 18:5771326-5771348 GCAGGTGAAAGGAGGGTAGGAGG + Intergenic
1153954709 18:10086493-10086515 ACAGGCGGGAAGAGGGCAGCTGG - Intergenic
1154228987 18:12536580-12536602 AGTGGAGGAAAGAGGGCAGAGGG + Intronic
1154275769 18:12958533-12958555 ACAGTTGAATAGGGGGTAGAGGG - Intronic
1154281479 18:13007024-13007046 ACAGTCAGAAAGAGGGCAGAAGG - Intronic
1155820239 18:30365651-30365673 ACAGGTGAAAGAGGGGAAGAGGG + Intergenic
1155987087 18:32241682-32241704 ACATGTGAAAAGAGAGGAGTGGG - Intronic
1156596811 18:38557079-38557101 ACACTGGAAAAGAGGGCAGTGGG - Intergenic
1156603901 18:38643230-38643252 AAAGGTTAAATGAGGGCATAAGG - Intergenic
1157150127 18:45208520-45208542 ACATGTGGAAAGAAGGGAGAAGG + Intergenic
1157190960 18:45581196-45581218 AGATGAGAACAGAGGGCAGAGGG + Intronic
1157420279 18:47541864-47541886 ACAGGAGGAAAGAGAGAAGATGG + Intergenic
1157514478 18:48301087-48301109 ACAGATGAGAAGATGGGAGAGGG + Intronic
1157943977 18:51958254-51958276 TCAAGTGAAAAGAAGGCAAAAGG + Intergenic
1159812297 18:73030237-73030259 AAAGGGGAAAAGTGGGCAGTGGG + Intergenic
1159855835 18:73586524-73586546 ACACTGGAAAAGAAGGCAGAAGG + Intergenic
1159955748 18:74517175-74517197 AAAGGTTAAATGAGGCCAGAAGG - Intronic
1160586537 18:79916396-79916418 GCAGGTGAACAGAGGGCAAAAGG - Intronic
1162299180 19:9834726-9834748 ACAGGTGGGAAGAGGGAGGATGG + Intergenic
1162857379 19:13479284-13479306 AAAGGGGAAAATAAGGCAGAAGG + Intronic
1163241858 19:16068856-16068878 TCAGCTGAAAAGAGTGCGGAGGG + Intronic
1163395806 19:17060399-17060421 AAAGGTGGAAAGAGAGTAGAGGG - Intronic
1163755078 19:19101748-19101770 ACATGTGATCAGAGGTCAGAGGG - Intronic
1164720312 19:30427114-30427136 ATAGGTAAACAGAGGCCAGATGG - Intronic
1165749616 19:38252054-38252076 AGAGGCAAAAACAGGGCAGATGG + Intronic
1166128632 19:40731862-40731884 GCAGGTGAAAGGAGGGCAGGAGG + Intronic
1166230750 19:41424819-41424841 ACAGGTGAAGAGGGGGCTGACGG - Exonic
1166337258 19:42115906-42115928 ACAGGTGCACAGAGAGAAGATGG + Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1168413828 19:56156612-56156634 GCAGGTGAAAGTAGGGCAGAAGG + Intronic
1168633624 19:57976627-57976649 ACAGGGGAAAAGGGGAAAGATGG - Intergenic
925382154 2:3436131-3436153 ACAGGTGATAAGACTGCAGCTGG + Intronic
926420145 2:12687805-12687827 AAAGGGGAAAAGAGGGCTGGAGG + Intergenic
927187388 2:20491766-20491788 ACCTGTGAAAAGAAGGCGGAGGG - Intergenic
927211176 2:20640136-20640158 ACGGATGTAAAGAGGGGAGAAGG + Intronic
927212141 2:20645509-20645531 CCAGGGGAAAAGAAGGCAGGTGG + Intronic
927250099 2:20989400-20989422 ATAGGAGGAAAGAGGGCAGTTGG + Intergenic
927521620 2:23702507-23702529 ACAGGTGAAGGGAGAGCAGTAGG - Intronic
928619338 2:33072607-33072629 GCAGGTGAAAGGAAGGCAGAAGG + Intronic
930199582 2:48540344-48540366 GTAAGTGAAAGGAGGGCAGAAGG - Intronic
930395565 2:50819511-50819533 ACAGGGGATAATAGGGCATAGGG + Intronic
930725272 2:54675679-54675701 ACAGGTGAAAAGAGAACATAAGG - Intergenic
931418353 2:62102582-62102604 ACAGGAGAGCAGGGGGCAGAAGG - Intronic
932731775 2:74226850-74226872 ACAGCTGACAGGAAGGCAGAAGG + Intronic
933099497 2:78234769-78234791 ACATGTGGGAAGAGGACAGAAGG + Intergenic
933691423 2:85182036-85182058 ACAGGGGAAAAGGGAGCAGCTGG + Intronic
934840610 2:97621941-97621963 ACAGGCTGAATGAGGGCAGAGGG + Intergenic
935950191 2:108321856-108321878 CCAGGTGAAGAGAAGGAAGAGGG + Intergenic
936403657 2:112184271-112184293 ACGGGAGAAGAGAGGGCAGAGGG + Intronic
937971272 2:127551211-127551233 AGAGATGACAAGAGGACAGATGG - Intronic
938122424 2:128643409-128643431 ACAGGTGAGAACAGTGCTGAAGG - Intergenic
938742456 2:134245668-134245690 ACAGGTATAAAGAAGACAGATGG - Intronic
939093248 2:137803062-137803084 AGAGGTGAAAAGAGAGTAGTGGG - Intergenic
939828794 2:147047959-147047981 ACAGGGCAAAAAAGGGGAGATGG - Intergenic
940202414 2:151166297-151166319 ACAGTTGAAAAGAGAGAACAGGG + Intergenic
940238901 2:151541876-151541898 GCAGGTGAAAAGAGGGGATTGGG - Intronic
940270011 2:151880310-151880332 ACAGCTAAGAAAAGGGCAGAGGG - Intronic
941591658 2:167427864-167427886 AGAGGGAAAAAGAAGGCAGAAGG - Intergenic
941799966 2:169648290-169648312 ACTGGAGAAAAGAGGGGATAGGG + Intronic
941880962 2:170480198-170480220 GCCCGTGAAAGGAGGGCAGAAGG - Intronic
942638807 2:178038615-178038637 ACATATGAAAAGAGGGTTGAGGG + Intronic
943357358 2:186873588-186873610 AAATGTGAAAAGAGGGTATAGGG - Intergenic
944325789 2:198401963-198401985 ACAGTGGAACAGAGGGCAGAAGG - Intronic
944595387 2:201256514-201256536 ACTGGTGCATAAAGGGCAGAAGG - Intronic
944764060 2:202846568-202846590 GCAGGTCAAAGGAGGGCAGAAGG + Intronic
945312092 2:208325713-208325735 ACAGGTGCAAAGAAAGCACAAGG - Exonic
945627513 2:212229266-212229288 AAAGGGGAAAAGAGGGCTCAGGG + Intronic
946032849 2:216718563-216718585 ACAGGTCACAGGAGAGCAGAGGG + Intergenic
946109436 2:217401356-217401378 ACAGGGTGAAAGAGGCCAGAAGG - Intronic
946226391 2:218266160-218266182 ACAGATGAAGAGAGGGCAGAGGG + Intronic
946231150 2:218292045-218292067 GCTGGTGAGAAGAGGGAAGAGGG - Intronic
946843316 2:223838147-223838169 AAAAGTGAAATGGGGGCAGAAGG - Intergenic
947085890 2:226452489-226452511 GAAGGAGAAAAGAAGGCAGAGGG + Intergenic
947387340 2:229604665-229604687 AAAGCTGAAAAGAGAGCAGAGGG - Intronic
947448484 2:230183140-230183162 AGAGATGCAAAGAGGGCCGAGGG + Intronic
947521609 2:230850067-230850089 AGAGGGGAGGAGAGGGCAGAGGG + Intergenic
1168857071 20:1016133-1016155 AAAGGAGAAAAGAGTGCAGGCGG - Intergenic
1169298102 20:4417317-4417339 ACAGATGCACAGAGGGCAGATGG + Intergenic
1169827937 20:9790374-9790396 AAAGAGGAAAAGAGGGGAGAGGG + Intronic
1169908805 20:10630362-10630384 ACTGGTGAGAAGAACGCAGAAGG + Intronic
1170205411 20:13792670-13792692 CCCGGAGAAAAGAGGGCTGAGGG + Intronic
1171480296 20:25450179-25450201 GCAGGTGAAAGGAGGGCAGAAGG + Intronic
1172231150 20:33337066-33337088 ACAGGAGAAAGGAAGGCTGAAGG + Intergenic
1172861519 20:38057434-38057456 ACATGTAAAAACAGGGCAGAAGG - Intronic
1172871234 20:38136700-38136722 GCAGGTGTGAGGAGGGCAGAGGG - Intronic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1173791451 20:45830430-45830452 ACAGATGAAGAGAGGAAAGATGG - Intronic
1174236034 20:49092663-49092685 GCAGGGGAAGGGAGGGCAGAGGG + Intronic
1175252281 20:57616790-57616812 AGAGGGGAGTAGAGGGCAGAAGG + Intronic
1175417347 20:58810697-58810719 ACCGGTGAAAAGAAAGAAGACGG + Intergenic
1176521196 21:7825784-7825806 CCAGGGGAGAAGAGGGCAGTGGG + Exonic
1177089058 21:16743398-16743420 CTATGAGAAAAGAGGGCAGATGG - Intergenic
1177259193 21:18706945-18706967 AAAGGGGAAAAGGGGGAAGAGGG - Intergenic
1177324001 21:19559942-19559964 AGAGGGGAAAAAAGGACAGAAGG - Intergenic
1177739944 21:25142048-25142070 AAAGGAGAAAAGAGGAGAGATGG - Intergenic
1178655216 21:34455796-34455818 CCAGGGGAGAAGAGGGCAGTGGG + Intergenic
1179178589 21:39026498-39026520 ACAGGAGGAAAGAGGCCAGAGGG + Intergenic
1181378546 22:22480550-22480572 GCAGGTAAAAGGATGGCAGAAGG - Intergenic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182044392 22:27262877-27262899 ACAGGTGAGCAGAGGGCCTAGGG - Intergenic
1183120965 22:35729733-35729755 ACAGATGACAGGAGGGAAGAGGG - Intergenic
1183486010 22:38088158-38088180 GCAGGGGAAAACGGGGCAGATGG - Intronic
1184153394 22:42651174-42651196 ACAGGTGAACAGAGGCCTGATGG + Intergenic
1184366373 22:44054166-44054188 GCAGGTGAAAGGAGGGCAGAAGG + Intronic
949126475 3:450975-450997 AGAGGTAAAAAGAGAGAAGATGG - Intergenic
949632805 3:5947179-5947201 ACCGTTGAAAAGTGAGCAGATGG - Intergenic
950021821 3:9792839-9792861 AAAGGTGACAAGAAGGCCGAAGG + Intronic
950883721 3:16344928-16344950 ACAGATGAAGAGAGGGCAAATGG - Intronic
951350932 3:21606054-21606076 TCAGGTGGAAAGAATGCAGATGG - Intronic
952132801 3:30384383-30384405 ACAGGTGAATAGAGAGCATCAGG - Intergenic
952315431 3:32228349-32228371 ACAAGTGAAAAGACTACAGAAGG + Intergenic
953797718 3:45997996-45998018 GCAGGTGAAAGGAGGGCAGAAGG + Intergenic
953837027 3:46355673-46355695 ACAGTTGAAAGCAGTGCAGAGGG + Intronic
954072235 3:48151409-48151431 AAAGGGGAAAAAAGGGAAGAGGG - Intergenic
954118278 3:48479117-48479139 AAAGGTGACAAGAGGGCTCAGGG - Intronic
954947568 3:54439835-54439857 GGAGGGGGAAAGAGGGCAGACGG - Intronic
955217426 3:56996173-56996195 ACAGTGGAAATGGGGGCAGATGG - Intronic
955426206 3:58793528-58793550 AAAGGTTGGAAGAGGGCAGATGG + Intronic
960661356 3:120063210-120063232 ATAGAGGAAAAGTGGGCAGATGG + Intronic
960714386 3:120560716-120560738 ACTCGTGAAAAGAGGAAAGAGGG - Intergenic
960769808 3:121181143-121181165 AGAGGAGAAAAGAGGGGAGGGGG + Intronic
960925519 3:122792277-122792299 GCAGGTACAAAGAGGGCAAAAGG + Intronic
961184991 3:124906950-124906972 ACAGATGGAAAGAAGGAAGATGG - Intronic
961519617 3:127459415-127459437 ACAGGTGAAGAGATGGGGGAGGG + Intergenic
961632195 3:128309274-128309296 GCAGGTGCAAAGAGGGCAGAGGG + Intronic
962043991 3:131736222-131736244 ATATATGAAAATAGGGCAGAAGG - Intronic
962203086 3:133415896-133415918 AGAGGTGAGTAGAGGGGAGAGGG - Intronic
962203330 3:133416903-133416925 ACGGGTGAGTAGAGGGGAGAGGG - Intronic
962203538 3:133417717-133417739 ACGGGTGAGTAGAGGGGAGATGG - Intronic
962203583 3:133417917-133417939 ACGGGTGAGTAGAGGGGAGATGG - Intronic
962236479 3:133711618-133711640 TCAGGGGAAATGAGGGCAGCTGG - Intergenic
962368205 3:134799701-134799723 ACAAGTCAATAGAAGGCAGAAGG - Intronic
962479270 3:135784764-135784786 ACATGAGACAAGAGGGCAAAAGG - Intergenic
962622337 3:137192237-137192259 ACAGGTGAAAAGAGGAATGTGGG + Intergenic
962677634 3:137768510-137768532 CCAGGTCTAAGGAGGGCAGATGG - Intergenic
962715323 3:138120868-138120890 ACTGGTGAAAAGTGGGAAAATGG + Intergenic
963056187 3:141188209-141188231 GCAAGTAATAAGAGGGCAGAAGG + Intergenic
963642206 3:147874780-147874802 ACAAGTGAAAAGAGATGAGAAGG - Intergenic
964455392 3:156860058-156860080 AAAAGTGGAAAGAAGGCAGATGG - Intronic
964684173 3:159376691-159376713 AGAGGTAAAAAGAAGGGAGAAGG - Intronic
964762664 3:160149012-160149034 CCAGGTGACAAGAGGGGAAAAGG - Intergenic
965666162 3:171095704-171095726 ACAGGTGAAAAAATGACAGGGGG + Intronic
965794973 3:172429883-172429905 ATAGGTAAAAAGAGAGGAGAGGG - Intergenic
966509060 3:180740922-180740944 ACAGGTGAAATATGGGCAGAGGG + Intronic
966526742 3:180927921-180927943 AAAGGAGAAAAGGGGGCAGAGGG - Intronic
966527879 3:180940429-180940451 ACATGTGAAATGAGGGAGGAGGG - Intronic
967149933 3:186639194-186639216 ACAGGTGAAAGGAAGAGAGAAGG + Intronic
967436608 3:189454980-189455002 AGAGGTGAAAAGAGGGAAGGAGG + Intergenic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
968647972 4:1749372-1749394 GCAGGTGAGGAGGGGGCAGATGG - Intergenic
968987005 4:3880910-3880932 AGAGGTGAGAAGAGGACAGGAGG + Intergenic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
972810854 4:42584271-42584293 GGAGGAGAAAAGAGGGGAGAAGG + Intronic
972966880 4:44521133-44521155 ACAGGTGTAAAGAAAGCAGATGG + Intergenic
973273773 4:48287847-48287869 ACAGGGGAAAGGAAGGCAGAAGG - Intergenic
973670306 4:53210812-53210834 GTAGGTGAAAGGAGGGCAGGAGG - Intronic
973828656 4:54735969-54735991 ACTAGAGAAGAGAGGGCAGAGGG + Intronic
974386693 4:61209607-61209629 AAAGGTTAAAAAAGGACAGAGGG - Intronic
974576633 4:63732858-63732880 AAAGATGAAAAGAGGAAAGATGG + Intergenic
974840102 4:67289454-67289476 ACAGATGGAAGGAGGGAAGAAGG + Intergenic
975263731 4:72336556-72336578 ACAGGCTACAACAGGGCAGAGGG + Intronic
976201248 4:82581085-82581107 ACAGCTGAAAAGAGGGTCAAAGG - Intergenic
977345735 4:95813860-95813882 GCAGCTGAAATGAGGGAAGATGG + Intergenic
977550132 4:98433116-98433138 CCATGAGAAATGAGGGCAGATGG + Intronic
978264197 4:106803091-106803113 ACATGAGGAAAGAGGGAAGAGGG - Intergenic
979566120 4:122155891-122155913 ATAGATGTAAAGAGGGTAGATGG + Intronic
979853009 4:125596376-125596398 AGAGGTGACATGAGTGCAGAAGG + Intergenic
980121868 4:128735648-128735670 GCAGGTGAAAGGAGAGCAGGAGG + Intergenic
980663245 4:135894966-135894988 AGAGAGGAAAAGAGGGCATAAGG - Intergenic
980684412 4:136207624-136207646 ACAGGGGAAAGAAGGACAGAAGG + Intergenic
980820979 4:138017153-138017175 ACAGGTTAACAGGGGCCAGAAGG - Intergenic
981842289 4:149126596-149126618 ATAAATGAAAAGAGGGCAGAAGG + Intergenic
982515701 4:156346373-156346395 ACAGGAGAAAAGAGAGAAAAAGG - Intergenic
982711951 4:158767118-158767140 ACAGGGAGAAAGAGGGGAGAAGG + Intergenic
986035585 5:3933923-3933945 AGAGGTGGAAGGTGGGCAGAAGG + Intergenic
986127186 5:4894005-4894027 ACAAGAGGAAAGAGGGGAGAGGG + Intergenic
986414049 5:7510681-7510703 ACTGGGGAGAAAAGGGCAGATGG + Intronic
986660757 5:10057722-10057744 GTATGTGAAAAGAGGGTAGAGGG - Intergenic
986693835 5:10334639-10334661 AGAGGAGAAGTGAGGGCAGAAGG + Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
987218440 5:15764447-15764469 ACAGGTGTAAAGAAGTAAGAAGG + Intronic
988707407 5:33739809-33739831 AAGGGTGTAAAGAAGGCAGAAGG + Intronic
988768790 5:34410149-34410171 ACAGGTGATATGGGTGCAGATGG - Intergenic
989196551 5:38722308-38722330 ACAGGTGAAAACAGGCCTCAGGG - Intergenic
989365497 5:40651383-40651405 TCAGGTGAAAAGAGGGCAGGAGG - Intergenic
989783997 5:45305112-45305134 AGAGGTGAAAAGAAGGCAGAAGG + Intronic
990991239 5:61686067-61686089 AGAGGTGAGAAGAAGGAAGAGGG - Intronic
992447950 5:76850726-76850748 ACAGAAGAAGAGAGGGAAGAGGG + Intronic
992857544 5:80878083-80878105 ACAGGTGAGAATAGGGCTGCTGG + Intergenic
993109057 5:83632973-83632995 ACAGGAGACAGGAGGGCAGGAGG - Intergenic
994919448 5:106024514-106024536 ACAGGAGAACCGAAGGCAGAAGG + Intergenic
995988183 5:118206286-118206308 ACATGTGAAAAGATGGAAGTGGG - Intergenic
997214043 5:132095697-132095719 AGAGGTGGGAAGAGGGCTGAAGG - Intergenic
997843152 5:137260841-137260863 ACAGAAGAAAAGATGGCAGTGGG + Intronic
998245294 5:140496566-140496588 ATGGGTGAAAAGATGGCAGTAGG - Exonic
998622722 5:143812407-143812429 ACAGGTGAAAACAGGGATGGCGG + Intronic
999356762 5:150942199-150942221 CCAGGTGAAAATGTGGCAGATGG - Intergenic
999438181 5:151580712-151580734 AGAGTTGAAGAGGGGGCAGAGGG + Intergenic
999577694 5:152998045-152998067 ACATGTGAAAAGAGGGGAGTGGG - Intergenic
1002041878 5:176520665-176520687 GCAGGTGATAAAAGGGCAAAAGG + Intergenic
1002661461 5:180793322-180793344 ACAGGTAGAAAGAGGGGAGTTGG - Intronic
1002812119 6:640574-640596 AAAGGTGAAACGAGGTCACATGG + Intronic
1002852679 6:1010529-1010551 AGAGGGGAAATGAGGGAAGAAGG - Intergenic
1003021258 6:2511481-2511503 AGAGGCGGAAAAAGGGCAGAAGG + Intergenic
1003148976 6:3532625-3532647 AGTGGTGACAAGAGGGCTGAGGG - Intergenic
1003614215 6:7640720-7640742 AGAGGTCAAATGAGAGCAGATGG - Intergenic
1003712285 6:8605416-8605438 ACAGGGCATCAGAGGGCAGAGGG - Intergenic
1004734991 6:18396708-18396730 ACAGGTGAGAAGACAACAGATGG + Intronic
1005257667 6:24021467-24021489 AAAGGGGAAGAGAGGCCAGAAGG - Intergenic
1005746818 6:28846227-28846249 GCAGGTGAAAGGAAGGCAGGAGG - Intergenic
1005786728 6:29251690-29251712 AAAGGGGAATGGAGGGCAGAAGG + Intergenic
1005886901 6:30103805-30103827 AAAGGAGAAAAGAGGTCAGCGGG + Intronic
1005933554 6:30501268-30501290 ACAAGTGAAAGCAGGGCTGAAGG - Intergenic
1005992195 6:30910264-30910286 AAGGGTGGAAAGATGGCAGAGGG + Intronic
1005996752 6:30936208-30936230 GCAGGTCCTAAGAGGGCAGAGGG - Intergenic
1006193704 6:32224219-32224241 GCAGGTGATAGGAGGGGAGAAGG + Intergenic
1006250609 6:32780292-32780314 TCATGTGACAAGAGGGCAAAGGG + Intergenic
1006561630 6:34917912-34917934 CCAGGTGAAAGGAGGGCAGCTGG - Intronic
1006595713 6:35191570-35191592 ACAGGTAGAAAGAAAGCAGAGGG + Intergenic
1006818994 6:36875457-36875479 ACAGGAGAAAACAGGACAAACGG + Intronic
1006855492 6:37130345-37130367 AGAAGGGAAAAGAGGGAAGATGG + Intergenic
1007673866 6:43579169-43579191 GCAGGTGAAAGGAGGGCAGAAGG - Intronic
1009398161 6:63226848-63226870 GCAGGTGGGAAGCGGGCAGAAGG + Intergenic
1009435796 6:63616982-63617004 ACAGGTGACAGAAGGGCAAAGGG + Intergenic
1010077902 6:71822297-71822319 CCAGGAGAAAACAGGGCAGAGGG + Intergenic
1010639751 6:78310120-78310142 ACAGGTGAAGAGTGGGGAGTGGG - Intergenic
1010949408 6:82017339-82017361 ACAGGAGGAAAGGGGGCAGCTGG + Intergenic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1011241525 6:85276609-85276631 GCAGGTGATAAGAGGAAAGAAGG - Intergenic
1011378843 6:86720680-86720702 ATAAGAGAAAGGAGGGCAGAAGG - Intergenic
1011419984 6:87161372-87161394 ACAGCTGAAAAGATGTCAAAAGG + Intronic
1011518604 6:88179909-88179931 GCAGGTGATCAGAGGGCAGGAGG - Intergenic
1013317301 6:108955078-108955100 AAAGGTTAAATGAGGTCAGAAGG - Intronic
1013510582 6:110840787-110840809 GCAAGTGAAAGGAGGGCAGGAGG + Intronic
1015469344 6:133586094-133586116 ACAGGAGAAAGGAAGTCAGAAGG + Intergenic
1015640593 6:135327641-135327663 GCAGGTAAAAGGAGAGCAGAAGG - Intronic
1017058680 6:150460373-150460395 GCAGGAGGAAACAGGGCAGAAGG + Intergenic
1017230229 6:152065661-152065683 ACGGTTGAAGAGAGGACAGAGGG - Intronic
1018234524 6:161710967-161710989 AAAGGGGAAAAGAGGGTAGGAGG - Intronic
1018847783 6:167567174-167567196 ACAGGGGACAGGAGGGAAGATGG + Intergenic
1019691496 7:2416842-2416864 ACATGTGAAAAGAAGGGAGTGGG + Intronic
1021611460 7:22461680-22461702 ACAGTGGAAAAGAGAGCACATGG - Intronic
1021689963 7:23222085-23222107 TGAGGTGAAATGAGGGCATATGG + Intergenic
1021762929 7:23918962-23918984 ACATGTGAAAAGAAGCCAGCAGG - Intergenic
1022183003 7:27940096-27940118 GCAGGTGAGAGGAGGGCAGCAGG - Intronic
1022591510 7:31668020-31668042 ACATGTGAAAAGAGGGACTAGGG + Intergenic
1023132929 7:37021161-37021183 AGAGGTGAAAAGAGGAGAGTGGG + Intronic
1023631273 7:42166586-42166608 ACAGAGGAGAAGGGGGCAGAGGG + Intronic
1024691874 7:51811490-51811512 ACAGGTGAAAAGAGAGAAAATGG - Intergenic
1026367629 7:69665137-69665159 ACATGTGGAAAGTGGGGAGAGGG - Intronic
1026919288 7:74143343-74143365 ACATGTGAAAGGAGGGAAAAAGG - Intergenic
1027163847 7:75821083-75821105 ACAGGTGATAAGTGTCCAGATGG + Intronic
1027913085 7:84278382-84278404 AGAGGTTGAAAGAGGGTAGAGGG - Intronic
1029480485 7:100809480-100809502 ACTGGTGAACAGAGGAGAGATGG - Intronic
1030048310 7:105516948-105516970 AGATGTGAAAAGGGGGGAGAGGG + Intronic
1031036581 7:116793972-116793994 GCAGGTAATATGAGGGCAGAGGG - Intronic
1031327056 7:120414881-120414903 AGAATTGAAAAGAAGGCAGAAGG - Intronic
1031379040 7:121062067-121062089 ACAGGAAAATAGAAGGCAGAAGG + Intronic
1032267852 7:130381176-130381198 GCAGGTCAGAAGAGGGGAGAAGG + Exonic
1032425069 7:131815969-131815991 CCTGGGGAATAGAGGGCAGAGGG - Intergenic
1032689138 7:134265354-134265376 AGAGGTGAAAAGAAGGCAGATGG + Intergenic
1033077048 7:138259366-138259388 AAAGTTGATAAGAGGGTAGAAGG + Intergenic
1033227102 7:139570997-139571019 AAAGGTGCAAAGAGGGCAAAGGG + Exonic
1034156370 7:148959149-148959171 GCAGGCGAAAGGAGGGCAGAAGG - Intergenic
1034251102 7:149691386-149691408 CTAGGGGAAATGAGGGCAGAAGG - Intergenic
1034466666 7:151233799-151233821 ACAGTTGAAGAGCAGGCAGAAGG + Exonic
1034878764 7:154748249-154748271 ACAGGTGGGAACATGGCAGAAGG - Intronic
1035982750 8:4391646-4391668 ACTGGTGAGAAGTGGGAAGACGG + Intronic
1036501975 8:9322365-9322387 ATCTGTGAAAAGAGTGCAGATGG - Intergenic
1037794285 8:21978841-21978863 GCAGGAGATTAGAGGGCAGAGGG - Intronic
1037817256 8:22118788-22118810 ACAGGTGCAGAGAAGGCAGAGGG - Intronic
1038022322 8:23561004-23561026 ACATGTGAAAAGAAGGGAGTTGG + Intronic
1038533709 8:28339007-28339029 ACGGGTGAGAGGAGGGGAGAAGG - Intronic
1038887391 8:31679161-31679183 ACAGGTGAAAAGAGAACTGAGGG - Intronic
1040287518 8:46108057-46108079 ACAGGTGAAAACAGGGCCTCAGG - Intergenic
1040288922 8:46114408-46114430 ACAGGGGAGAAGAGGCGAGATGG - Intergenic
1040293657 8:46138244-46138266 ACAGGTGAAAATGGGGCAGCAGG - Intergenic
1040302072 8:46193235-46193257 ACAAGTGAAAACAGGGCTGCAGG + Intergenic
1040303748 8:46201529-46201551 ACAGGCGAAAACAAGGCCGAAGG + Intergenic
1040306764 8:46216013-46216035 ACCAGTGAAAACAGGGCAGCAGG + Intergenic
1040315060 8:46256618-46256640 ACAAGTAAAAACAGGGCAGCAGG + Intergenic
1040329359 8:46378114-46378136 ACAAGTGAAAACAGGGCCGCTGG + Intergenic
1040331266 8:46386976-46386998 ACAAGTGAAAACAGGGCTGCAGG + Intergenic
1040331556 8:46388273-46388295 ACAAGTGAAAACGGGGCAGCAGG + Intergenic
1040335709 8:46414887-46414909 ACAAGTGAAAACGGGGCTGAAGG + Intergenic
1041789310 8:61674617-61674639 ACAGGTAAATGGTGGGCAGAGGG + Intronic
1042667587 8:71223236-71223258 GAAGCTGAAAAGAGGGCAGATGG + Intronic
1043059074 8:75477474-75477496 ACACATGTAAAGAGAGCAGAAGG + Intronic
1043349271 8:79340744-79340766 ACTGGTACAAAAAGGGCAGAAGG + Intergenic
1043573385 8:81630226-81630248 GCAGATGAAAGGAGGACAGAAGG + Intergenic
1044100616 8:88132560-88132582 ACATGTGAAAAGAGCCCACATGG - Intronic
1044467108 8:92520355-92520377 AAAGCTGAACAGAAGGCAGAAGG + Intergenic
1044711679 8:95064683-95064705 GCAGGTGAAGGGAGAGCAGAAGG - Intronic
1044760958 8:95517004-95517026 TCATGTGAAGAGAGGGCATAAGG - Intergenic
1044777519 8:95707084-95707106 ACTGTGGAAAAGAGGGTAGATGG - Intergenic
1045571049 8:103370166-103370188 ACAGGCCAAAGGAGGACAGAGGG + Intergenic
1045628667 8:104088339-104088361 AGAGGAAAGAAGAGGGCAGAGGG - Intronic
1046310541 8:112430839-112430861 ACAGGTCAACAGAGGGAAAAGGG + Intronic
1046680869 8:117168644-117168666 ACAAGTGAAAAAAGGGTAGTGGG + Intronic
1047204293 8:122791041-122791063 ACAGGTGCATGGAGGGCAGGAGG - Intronic
1047294058 8:123555561-123555583 ACAGCTGAAATCAGGGCAGAGGG - Intergenic
1047577959 8:126179147-126179169 ATTGGTGCAAAGAGGGCAAATGG + Intergenic
1048267582 8:133001041-133001063 ACACGTGCACAGAGGGAAGATGG - Intronic
1049001147 8:139826301-139826323 GCAGGTGAAAAGAGGAGGGACGG + Intronic
1049568371 8:143355481-143355503 GCAGGAGAGAAGAGAGCAGAGGG + Intronic
1049840845 8:144770669-144770691 ACAGGTTAAATGAGGCCATAGGG + Intergenic
1051040089 9:12798481-12798503 AAAGGTGAAAAGAATGAAGAAGG - Intronic
1051260093 9:15255392-15255414 AAAGGGGGAAAGAGGGAAGAAGG + Intronic
1051768807 9:20553481-20553503 ACAGATGAATTGAGGTCAGATGG - Intronic
1051875596 9:21790197-21790219 AGAGAGGAAAAGAGGGTAGAAGG + Intergenic
1055255147 9:74360604-74360626 ACAGGTGAAGAGAGGGCATGAGG - Intergenic
1055280741 9:74671213-74671235 ACAGATGAAGAGAGGGAAGAAGG + Intronic
1055453325 9:76450708-76450730 CCAGGTGAAAAATGGGCAAAGGG - Intronic
1055634122 9:78257612-78257634 AGAGGAGAAAAGAGGGAAGGAGG + Intronic
1055934123 9:81589201-81589223 AAAGGTCAAAAGAAGTCAGAGGG - Intronic
1057113856 9:92501657-92501679 TCAGGTGAAAAGAGGGCGTGGGG - Intronic
1057122936 9:92593465-92593487 TTAGGGGAAATGAGGGCAGAAGG - Intronic
1058031053 9:100197907-100197929 TCAGGTGAAAGGAAAGCAGAAGG + Intronic
1058073949 9:100631542-100631564 ACAGAGGCAAAGAGGGCAGATGG + Intergenic
1058539792 9:105999764-105999786 ACAGGTCAGCAGAGGGCTGAAGG + Intergenic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1060064166 9:120488474-120488496 AGAGGTGAGAAGAGAGGAGAGGG - Intronic
1060218799 9:121753803-121753825 TCAGGTGAAAGGAGGGAAGCAGG - Intronic
1060496688 9:124124697-124124719 CCAGGAGAAAGGAGGCCAGAGGG - Intergenic
1060838366 9:126775450-126775472 ACAGATGGAAAGAGAGGAGATGG - Intergenic
1060923459 9:127438736-127438758 GCAGGTGAAAGAAGGGCAGGGGG + Intronic
1062585828 9:137249531-137249553 GCAGGTGAAAGGAGGGCAGGAGG - Intergenic
1062616373 9:137398364-137398386 ACAGGGGACAAGAGGGAAGGGGG - Intronic
1185619053 X:1442323-1442345 ACAGTAGAAAAGGGGTCAGAAGG + Intronic
1185660404 X:1723627-1723649 ACAGGTGAATAGATGATAGATGG + Intergenic
1187373293 X:18728061-18728083 GCAGGTGAAAGGAGGACAGGAGG + Intronic
1188112909 X:26213365-26213387 ACAAGTAAAAAGAGGGGATAAGG + Intergenic
1188370004 X:29358187-29358209 ATAGGAGACAAGAGGGCAGGAGG + Intronic
1188623947 X:32261165-32261187 CCAGGAGAAAAGAGAGCTGAAGG - Intronic
1189319925 X:40081801-40081823 ACAGCTGAGAAGAGGTCAGATGG + Intronic
1189335155 X:40166623-40166645 TCAGGTGGAAAGTGGGCACAGGG + Intronic
1189855865 X:45224218-45224240 AAAAGTGAAAATAGGACAGATGG - Intergenic
1190008911 X:46766158-46766180 CCAGTTGAAAAATGGGCAGAAGG + Intergenic
1190592246 X:52015967-52015989 ACATGTGAAAAGAGAGGAGTGGG - Intergenic
1191157479 X:57289826-57289848 AGAGCTGAAGAGAGGGGAGAAGG + Intronic
1192534546 X:71916124-71916146 ACAGGTATAAAGATGGCAGAGGG - Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195355683 X:104037823-104037845 ACAGGTGAAATCAGGACACATGG + Intergenic
1196899938 X:120372825-120372847 ACCAGTGAAACGAGGGGAGACGG + Intronic
1196929124 X:120663552-120663574 AAAGGGGAAAAGAGAGGAGAGGG - Intergenic
1197339685 X:125251293-125251315 AAAGGTGAAAATAGTGTAGAAGG - Intergenic
1198057433 X:133008728-133008750 ACAGGAGAAAGGCTGGCAGATGG - Intergenic
1198202906 X:134439772-134439794 AAGGGTGAAAACAGTGCAGAAGG - Intergenic
1201220307 Y:11762804-11762826 AAAGGAGAAAAGTAGGCAGAAGG + Intergenic
1201488434 Y:14514994-14515016 ACAAGTGGAAACAGAGCAGATGG - Intergenic