ID: 968475579

View in Genome Browser
Species Human (GRCh38)
Location 4:805194-805216
Sequence CCTTCCAAACATGGGCTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968475579_968475584 22 Left 968475579 4:805194-805216 CCGCAGAGCCCATGTTTGGAAGG 0: 1
1: 0
2: 4
3: 22
4: 197
Right 968475584 4:805239-805261 ATGAATATACCCCTGTTGTTAGG 0: 1
1: 0
2: 1
3: 13
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968475579 Original CRISPR CCTTCCAAACATGGGCTCTG CGG (reversed) Intronic
900175042 1:1287875-1287897 CCTGCCCAACCTGGGCTTTGGGG + Intronic
900714095 1:4133112-4133134 GCTGCCCAGCATGGGCTCTGCGG + Intergenic
901197429 1:7447959-7447981 GCTTCAGAGCATGGGCTCTGAGG - Intronic
901440037 1:9272243-9272265 CCTCCCATACATGTGTTCTGGGG + Intergenic
906067851 1:42995011-42995033 ACTTCCACACATGTCCTCTGAGG - Intergenic
909421700 1:75473892-75473914 TCTTCTAAATATGAGCTCTGTGG + Intronic
911278977 1:95899815-95899837 TTTTCCCAACATGGGGTCTGTGG + Intergenic
911401560 1:97381432-97381454 CATGCCAAGCATGGGCTCTGTGG + Intronic
912385057 1:109267342-109267364 CAGTCCACACATGGGCTCTAGGG - Intronic
913076211 1:115342551-115342573 CCTTTCAAGAATGGGATCTGTGG - Intergenic
913162311 1:116155367-116155389 CCTTCCACAAATGCACTCTGAGG - Intergenic
913460649 1:119082792-119082814 CCTTCAAAACATGGCACCTGGGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
920296888 1:204963330-204963352 CATTCCATACCAGGGCTCTGGGG - Intronic
921913593 1:220579619-220579641 ACTCCCAAACATGGGCTATAAGG - Intronic
922151275 1:223006820-223006842 CCTTCTAAACATGGCCCCTTAGG - Intergenic
922960795 1:229644257-229644279 CCCACCAACCATTGGCTCTGTGG - Intronic
924131559 1:240914675-240914697 CCTTGCAAACATCTGCTCTCTGG + Intronic
924774232 1:247104429-247104451 CCATCCAATCAGGGGCGCTGGGG - Intergenic
1066063403 10:31744293-31744315 CCTTGCAAACTTGAGCTCAGTGG + Intergenic
1067077917 10:43198533-43198555 CTTTGCAAAAATGGACTCTGTGG + Intronic
1067393856 10:45893085-45893107 CCTTTCAACCATGGCCACTGAGG + Intergenic
1067862179 10:49862223-49862245 CCTTTCAACCATGGCCACTGAGG + Intronic
1067937640 10:50624741-50624763 CCATCCTAACTTGGGCGCTGGGG - Intronic
1070523363 10:77274334-77274356 CCTTCCAAAGAAGGGCAGTGAGG + Intronic
1072802304 10:98400854-98400876 CCTACCACACATAGGCTGTGGGG + Intronic
1075688253 10:124378665-124378687 CCTTCCAAAATTGGGCACTGTGG - Intergenic
1076224685 10:128764692-128764714 TCTTCCAAAGATGTGCTCTGTGG - Intergenic
1076560381 10:131359196-131359218 CCTTCCTAAGTGGGGCTCTGAGG - Intergenic
1076586955 10:131555902-131555924 TCTGCAAAACAGGGGCTCTGTGG - Intergenic
1076887950 10:133271152-133271174 CCTGCCAGCCATGGGCTCTGGGG + Intronic
1079340475 11:19607376-19607398 CCTTGCCATCATGAGCTCTGGGG + Intronic
1085068639 11:73521431-73521453 CCTTCCACCCTTGGGCTCAGTGG - Intronic
1086395947 11:86415136-86415158 CTTACCAAAGATGGGCTCAGAGG - Exonic
1086968390 11:93053948-93053970 CATCAGAAACATGGGCTCTGGGG + Intergenic
1089191881 11:116659612-116659634 CCTTCCAAACATGCGAGATGTGG + Intergenic
1089821130 11:121227060-121227082 CCTTCCCATCATGGGCCCAGAGG - Intergenic
1090909071 11:131102698-131102720 TCTTCCTCACATGGGCTCAGTGG - Intergenic
1091287551 11:134416186-134416208 CTTTCCCAACCTGAGCTCTGTGG + Intergenic
1091684338 12:2550826-2550848 CCTCCCCAACATGGGCTCCCAGG - Intronic
1095885370 12:47183408-47183430 GTTTCCTAACATGTGCTCTGTGG + Intronic
1096805520 12:54138790-54138812 CCTTCCCAAGATGGGGTCTTTGG - Intergenic
1097035512 12:56121144-56121166 CCTTCCTGACAGGGGCTTTGAGG + Exonic
1101247447 12:102897894-102897916 CTTTCCAAGAATGGGCTGTGGGG + Intronic
1102728328 12:115085993-115086015 CCTTACAAACATGAGCTCACTGG + Intergenic
1104367021 12:128187290-128187312 CCTGCCAAACATGATCACTGAGG + Intergenic
1104560887 12:129843166-129843188 CCTTCAAAAAGTGGGCTCTATGG - Intronic
1105257712 13:18755321-18755343 CCTTGCTATCATAGGCTCTGGGG - Intergenic
1107251485 13:38368727-38368749 CCTTCCAAACATAGGGATTGAGG + Intergenic
1109503639 13:63270374-63270396 CCTTCCTATCACAGGCTCTGAGG - Intergenic
1110896063 13:80754105-80754127 CCTTCCAGACAGGGTCTCTTGGG - Intergenic
1112300052 13:98221818-98221840 TCTTCTCAATATGGGCTCTGTGG + Intronic
1115360845 14:32500479-32500501 CCTTCCAACCAGGGACTCTGGGG - Intronic
1116082359 14:40190857-40190879 TACTCCAAACCTGGGCTCTGTGG + Intergenic
1116082367 14:40190898-40190920 CATTTCAATCCTGGGCTCTGTGG + Intergenic
1118387878 14:65271756-65271778 CCTTGCAAATATGGGCACAGGGG - Intergenic
1119148536 14:72337538-72337560 CCATCCAAACATGAGCAGTGAGG + Intronic
1121225007 14:92315259-92315281 TCTTCCACACATGGCCTCTGGGG - Intergenic
1121317125 14:92968928-92968950 CCTTCCCAGCATGTGCTCTGTGG - Intronic
1122986543 14:105214220-105214242 CCTTCCAGATATGGGCGCTGGGG + Intronic
1127573328 15:60265400-60265422 TGTTCCCAACCTGGGCTCTGAGG + Intergenic
1127779323 15:62297549-62297571 CTTTCAGAACCTGGGCTCTGGGG + Intergenic
1128983205 15:72200929-72200951 TCTGCCAACCATGGGCTGTGTGG - Intronic
1129020877 15:72516847-72516869 CCTTCCAAAAAAGATCTCTGTGG - Intronic
1130884296 15:88080691-88080713 CCTTCCAATCTGGGGCTCTTTGG - Intronic
1131117191 15:89802748-89802770 CCCTACAAACAGGGGCTGTGCGG + Intronic
1134260566 16:12647876-12647898 CCTCCCTAACATGTCCTCTGAGG + Intergenic
1137432774 16:48432032-48432054 CCTTCCAAGGATGGGCTTTAGGG - Intronic
1139243731 16:65420264-65420286 CCCTCCCAACATGGTGTCTGTGG + Intergenic
1139273249 16:65703196-65703218 CATTCCAAACAGGAGCTCTGGGG - Intergenic
1139558499 16:67727578-67727600 CCCTCCACACCTAGGCTCTGGGG - Intronic
1139586990 16:67910338-67910360 CCTTCCCAGCATCTGCTCTGTGG + Intronic
1140018966 16:71218293-71218315 ACTTCCAAACATGGGTTTTATGG - Intronic
1143671053 17:8396520-8396542 CCTTCCAACAATGGCCTCTCTGG + Intronic
1143671070 17:8396590-8396612 CCTTCCAATGATGGCCTCTCTGG + Intronic
1144996287 17:19271470-19271492 CATCCCAAAGGTGGGCTCTGGGG - Intronic
1147998125 17:44372472-44372494 ACTTCCTCACATGTGCTCTGGGG - Intronic
1151512749 17:74571199-74571221 TCTTCCCAACATGGGGGCTGGGG + Intergenic
1152497906 17:80687355-80687377 CCTGACAAACATGGGCTGAGTGG - Intronic
1153815492 18:8786641-8786663 ACTTCCAACCATGGTCTCTGTGG - Intronic
1157621428 18:49019245-49019267 CCCTCCAGGCCTGGGCTCTGGGG + Intergenic
1157975302 18:52320123-52320145 ACTGCCAAAGATGGGCCCTGTGG + Intergenic
1158323513 18:56289756-56289778 CCATCGGAACATGGGCTCTGAGG + Intergenic
1163677259 19:18661296-18661318 TGTTCCAAACATGGGATCTGTGG - Intronic
1167898678 19:52601868-52601890 CCTTCCCAACGCGGGCTCAGGGG - Intronic
1168003648 19:53468293-53468315 CCTCCCCAACGTGGGCTCAGGGG - Intronic
925694868 2:6566139-6566161 CCTTCCTCAGATGGCCTCTGAGG + Intergenic
926898651 2:17724254-17724276 CCTTTCAAACCTGGGTTATGTGG - Intronic
927460096 2:23291525-23291547 CCTTCCAAAGACTGGCTGTGGGG - Intergenic
927694402 2:25230451-25230473 CCTTAGAAACAAGGGTTCTGGGG - Exonic
928106241 2:28472296-28472318 CCACCCACACATGGGCCCTGTGG + Intronic
929557002 2:42931831-42931853 ACTTCTAAACCAGGGCTCTGTGG + Intergenic
929592067 2:43153911-43153933 CCACCCACCCATGGGCTCTGCGG - Intergenic
930060849 2:47287180-47287202 CCTTCCAGCCCTGTGCTCTGTGG + Intergenic
931605130 2:64044981-64045003 TCTTAAAAACATGGGCTCTTGGG - Intergenic
931778094 2:65556983-65557005 GCTTCCACCCATGGGCTCTGGGG - Intergenic
931791088 2:65664964-65664986 CCTTCTAAGCCTGGGCTGTGGGG + Intergenic
933290396 2:80431970-80431992 CCTGCCAACCCTGGGCACTGTGG - Intronic
934474920 2:94587449-94587471 CCTTCCAGATCTGGGCACTGAGG - Intergenic
937425957 2:121798571-121798593 CATTGCAACCATGAGCTCTGGGG - Intergenic
937951210 2:127389006-127389028 GCTACCCAACTTGGGCTCTGAGG + Intergenic
943013306 2:182478775-182478797 GCCTCCAAATATGGGATCTGGGG - Intronic
946739846 2:222790554-222790576 CCTCTCCAACATGGCCTCTGGGG - Intergenic
948441777 2:237996346-237996368 CATCCCAAGCATGGGCTTTGTGG + Intronic
948515871 2:238503649-238503671 CCTTCCGAGCATGGGAACTGCGG + Intergenic
948659152 2:239496402-239496424 CCTCACATACATGGTCTCTGCGG - Intergenic
1170359505 20:15529244-15529266 TCTTCTAAATATGTGCTCTGTGG + Intronic
1170645197 20:18191536-18191558 CCTTCCAGACCTATGCTCTGAGG - Intergenic
1173472456 20:43334357-43334379 CATTTCAAACAGGGGCTTTGGGG + Intergenic
1175286487 20:57840253-57840275 CTTTCCTCCCATGGGCTCTGTGG + Intergenic
1175817747 20:61892399-61892421 CCTTGCCAACCTGAGCTCTGGGG - Intronic
1180115920 21:45704957-45704979 CCTCCCCAAGATGGGCTCTGTGG - Intronic
1180242777 21:46522799-46522821 TCTTCCCAAAATGGGGTCTGTGG + Intronic
1181483228 22:23214429-23214451 CCCACCCAACCTGGGCTCTGAGG + Intronic
1183238935 22:36641246-36641268 CCTTCCCCTCGTGGGCTCTGCGG - Intronic
1183431470 22:37768475-37768497 CATTCCAAAACTGTGCTCTGGGG - Intronic
1183746909 22:39697405-39697427 ACTCCCAGAGATGGGCTCTGAGG - Intergenic
1184914285 22:47558703-47558725 CCTTTCAAGCAGGGGCCCTGGGG - Intergenic
950436596 3:12983953-12983975 CCTTTCATACGTGGGTTCTGGGG + Intronic
951132845 3:19068917-19068939 CCTTCCCATCATAGGCCCTGAGG + Intergenic
952105583 3:30065798-30065820 CCCTCCCATCATGGGCTCGGAGG - Intergenic
952145711 3:30529852-30529874 TCTTCCAAACATTGGCTGGGTGG + Intergenic
952231113 3:31432066-31432088 CCTTCCCAAGCTGGGCTCTTAGG + Intergenic
953044605 3:39283268-39283290 CCTACCACACATGAGCTGTGTGG - Intergenic
953255822 3:41289630-41289652 CCTGTCTACCATGGGCTCTGTGG - Intronic
954223442 3:49168103-49168125 CCTTCCAGACATGAGAACTGGGG + Intergenic
954537226 3:51369953-51369975 CCTCCCTAGCATGGACTCTGAGG + Intronic
954922350 3:54202860-54202882 CTCTCCAAACATGGACTCTTTGG - Intronic
956672987 3:71708723-71708745 CCTTCAAATCAAGTGCTCTGAGG + Intronic
957408825 3:79809657-79809679 CCAACAAAACATGGGCTTTGGGG - Intergenic
958650114 3:96927297-96927319 CCTTCCCATCATAGGCTCTAAGG - Intronic
960050398 3:113233811-113233833 CCTTCCAAGCATGGGGTGGGTGG - Intronic
961000478 3:123370848-123370870 CCTTCCCACCACGTGCTCTGGGG + Intronic
961133030 3:124486498-124486520 CCTCTCAAACATGTGCTCTAGGG + Intronic
962159423 3:132983284-132983306 CCTTCAACACATGGCCTCTAAGG + Intergenic
962376020 3:134859288-134859310 CCTTGCAAACATGATCTCAGGGG + Intronic
964426682 3:156561568-156561590 CCCTCCCATCATAGGCTCTGAGG + Intergenic
964554310 3:157918667-157918689 CCTTCGTAAGATGGGGTCTGTGG + Intergenic
965617670 3:170611534-170611556 CATTCCAGACAGAGGCTCTGAGG - Intronic
968475579 4:805194-805216 CCTTCCAAACATGGGCTCTGCGG - Intronic
968912992 4:3485262-3485284 CCCTTCAAACTTGGGCGCTGGGG - Intronic
970116695 4:12705128-12705150 CAATCTGAACATGGGCTCTGGGG + Intergenic
975650021 4:76583597-76583619 GGTTCAGAACATGGGCTCTGTGG + Intronic
978073425 4:104498860-104498882 ACTTACATTCATGGGCTCTGAGG + Intergenic
981058367 4:140391221-140391243 CCTACCAAGAATGGGCTTTGGGG + Intronic
983289771 4:165787008-165787030 GCTTCAAAACATGGGTTTTGGGG + Intergenic
984579747 4:181498365-181498387 CCTGCCAAACCAGGGTTCTGAGG - Intergenic
984846811 4:184115323-184115345 ACTTCCCAATATGGGCTTTGTGG - Intronic
990132644 5:52606276-52606298 CCATCCAATAATGAGCTCTGCGG + Intergenic
991239658 5:64442896-64442918 TTTTCCAAGAATGGGCTCTGTGG - Intergenic
991612614 5:68464879-68464901 CCTTCCTAACATGAACTCTATGG - Intergenic
996466010 5:123803462-123803484 CCTGGCAGTCATGGGCTCTGTGG - Intergenic
997213113 5:132089278-132089300 CCCTGCAAATCTGGGCTCTGTGG - Intergenic
997347744 5:133204255-133204277 CCTTCCAAACCTGGGTGCTGAGG + Intronic
1002492208 5:179586587-179586609 CATTACAGAGATGGGCTCTGAGG - Intronic
1002863529 6:1101131-1101153 CCTTCTACACATGTTCTCTGTGG - Intergenic
1003423992 6:5984345-5984367 CCTTCCACACAAAGACTCTGGGG + Intergenic
1003479631 6:6519190-6519212 GCTTCCAAAAGTGGCCTCTGTGG + Intergenic
1004169489 6:13284885-13284907 TCTTCCACACATGGTGTCTGTGG - Intronic
1004794531 6:19066620-19066642 CTTTCCAACTCTGGGCTCTGTGG - Intergenic
1004805747 6:19201908-19201930 CCTTCCCATCATGGGCCCAGAGG - Intergenic
1006436979 6:34030866-34030888 CCCTCCCAGCATGGGCCCTGGGG + Intronic
1007215519 6:40234582-40234604 CCTTAGAAACTTGGGCTCTCTGG + Intergenic
1007416296 6:41693477-41693499 CCTCCCCAGCATGGGCTCAGAGG - Intronic
1009287342 6:61837014-61837036 CCTTCCAAACCAGGGATCTAGGG + Intronic
1009320918 6:62286883-62286905 CCTTCCACAGATAGGGTCTGGGG - Intergenic
1009533154 6:64846176-64846198 CCTACCAATAATGGGCTTTGTGG + Intronic
1010841798 6:80655072-80655094 ACTGCCAAACATGTGTTCTGAGG + Intergenic
1011816568 6:91198254-91198276 CCCTCCATAGAGGGGCTCTGGGG - Intergenic
1014915028 6:127136165-127136187 CCTTCCAGAGAAGGGCTCTATGG + Intronic
1015373382 6:132481311-132481333 CCCTCCAAAGATTGGCTCTGTGG - Intronic
1018753994 6:166832417-166832439 GGTTCCAAGCCTGGGCTCTGGGG - Intronic
1018757417 6:166862414-166862436 CCTGCCAAGCCAGGGCTCTGGGG + Exonic
1019446978 7:1076421-1076443 CCTCCCAGGCATGGGCTCTGGGG + Intronic
1020539655 7:9444456-9444478 GCTTCCAAGCATAGGCACTGGGG + Intergenic
1022932836 7:35138939-35138961 TCTTCCAAATGTGGGCTCTTTGG - Intergenic
1026914651 7:74112525-74112547 CCTGGCTAACATGGGCACTGTGG + Intronic
1029828755 7:103231703-103231725 TCTTCCAAATGTGGGCTCTTTGG - Intergenic
1030109660 7:106016070-106016092 CCATCCAAACGTGTGTTCTGTGG + Intronic
1031877268 7:127155991-127156013 TCTTACAACAATGGGCTCTGGGG - Intronic
1032507640 7:132447654-132447676 CCTTCCTAAGATGTGCTGTGTGG - Intronic
1032517953 7:132520848-132520870 CCCACCAAACATTGGCACTGTGG + Intronic
1034431400 7:151043106-151043128 GCACCCAAACATGGGCTCTGGGG - Intronic
1034540573 7:151755459-151755481 CCCACCACACATGGCCTCTGAGG - Intronic
1035227835 7:157443329-157443351 CCATCCGCACATGGGCTGTGGGG + Intergenic
1037419434 8:18686759-18686781 CCTTCCATGCATGGGCTGAGTGG - Intronic
1037681287 8:21099743-21099765 CCTTCCTCACCTGGTCTCTGGGG + Intergenic
1038348932 8:26758704-26758726 CCTTCCTAGCATGGGCATTGGGG + Intronic
1043288749 8:78569150-78569172 CCTTCAAAACCTGGGGTCAGGGG + Intronic
1043849058 8:85195040-85195062 GCTTAGGAACATGGGCTCTGAGG - Intronic
1048214424 8:132481388-132481410 CCCACCAAACATTGGCTCTGTGG + Intergenic
1048279618 8:133095388-133095410 CAGTCCAAACATGGGCACTGAGG + Intronic
1048474865 8:134733953-134733975 CCTAACAAACATGAGGTCTGTGG + Intergenic
1049755415 8:144309313-144309335 CCACCCAGGCATGGGCTCTGAGG + Intronic
1052855134 9:33402311-33402333 CCTTCCAGATCTGGGCGCTGAGG + Intronic
1053002408 9:34584583-34584605 CCTTCCAAGGCTGGGCTCTGAGG - Intronic
1053495039 9:38543574-38543596 GCTTCCAGTCTTGGGCTCTGTGG + Intronic
1053683153 9:40498652-40498674 CCTTCCAGATCTGGGCACTGAGG + Intergenic
1053933131 9:43126968-43126990 CCTTCCAGATCTGGGCACTGAGG + Intergenic
1054280561 9:63126276-63126298 CCTTCCAGATCTGGGCACTGAGG - Intergenic
1054296254 9:63334150-63334172 CCTTCCAGATCTGGGCACTGAGG + Intergenic
1054394270 9:64638655-64638677 CCTTCCAGATCTGGGCACTGAGG + Intergenic
1054428920 9:65143854-65143876 CCTTCCAGATCTGGGCACTGAGG + Intergenic
1054501460 9:65877681-65877703 CCTTCCAGATCTGGGCACTGAGG - Intronic
1056292154 9:85154480-85154502 ATTTCCAAACATGCGTTCTGGGG + Intergenic
1057304102 9:93902576-93902598 CCCTCCCACCTTGGGCTCTGGGG - Intergenic
1058266267 9:102902475-102902497 CCTTCCAATTATGTGCTATGTGG - Intergenic
1058619780 9:106870809-106870831 CCTTCCCCAGCTGGGCTCTGTGG - Intronic
1060102839 9:120855916-120855938 CCTTCCCTACCTGGGCTCTGGGG - Exonic
1060330634 9:122666066-122666088 CATTCCAGACCTTGGCTCTGTGG + Intergenic
1062543664 9:137052505-137052527 CCTTCCAACCACGGCCTCAGAGG - Intronic
1192915073 X:75643353-75643375 CCTTTCAAACATGGCCCCAGGGG + Intergenic
1194168862 X:90557106-90557128 CCTTCCAAACACAGGCTCTGAGG + Intergenic
1195175045 X:102306465-102306487 CCTTCTAAACATGGGCTCAGGGG + Intergenic
1195177328 X:102323486-102323508 CCCTCCAAAGGTGGACTCTGTGG + Intronic
1195181536 X:102363607-102363629 CCCTCCAAAGGTGGACTCTGTGG - Intronic
1195183820 X:102380628-102380650 CCTTCTAAACATGGGCTCAGGGG - Intronic
1195254262 X:103077898-103077920 CTCTCCAAAGGTGGGCTCTGTGG - Intronic
1196915066 X:120525623-120525645 ATTCCCAAACAGGGGCTCTGTGG + Intronic
1199508176 X:148589891-148589913 CCTTCAAAACATGGCCTTTCCGG - Intronic
1199990957 X:152987607-152987629 CATTCCCAGCATTGGCTCTGAGG + Intergenic
1200034044 X:153317081-153317103 CATTCCCAGCATTGGCTCTGAGG + Intergenic
1200492603 Y:3846088-3846110 CTTTTCATACATGGTCTCTGAGG - Intergenic
1200515106 Y:4134891-4134913 CCTTCCAAACACAGGCTCTGAGG + Intergenic