ID: 968476438

View in Genome Browser
Species Human (GRCh38)
Location 4:811849-811871
Sequence CTGTCTTTGCTGACGTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968476435_968476438 -9 Left 968476435 4:811835-811857 CCTGTGACCTCCTTCTGTCTTTG 0: 1
1: 0
2: 0
3: 28
4: 308
Right 968476438 4:811849-811871 CTGTCTTTGCTGACGTATGTTGG No data
968476434_968476438 21 Left 968476434 4:811805-811827 CCAGCTCAAACAGTGGGTTTGTA 0: 1
1: 0
2: 1
3: 9
4: 80
Right 968476438 4:811849-811871 CTGTCTTTGCTGACGTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968476438 Original CRISPR CTGTCTTTGCTGACGTATGT TGG Intronic
No off target data available for this crispr