ID: 968476852

View in Genome Browser
Species Human (GRCh38)
Location 4:814686-814708
Sequence CCGGACTCCTGGGGAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 24, 3: 15, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968476852_968476866 25 Left 968476852 4:814686-814708 CCAGGTTTTCCCCAGGAGTCCGG 0: 1
1: 0
2: 24
3: 15
4: 154
Right 968476866 4:814734-814756 TGCCAGAGTGATGGCCAGGCAGG 0: 2
1: 0
2: 8
3: 35
4: 663
968476852_968476860 -6 Left 968476852 4:814686-814708 CCAGGTTTTCCCCAGGAGTCCGG 0: 1
1: 0
2: 24
3: 15
4: 154
Right 968476860 4:814703-814725 GTCCGGGAGGAACACAAGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 106
968476852_968476865 21 Left 968476852 4:814686-814708 CCAGGTTTTCCCCAGGAGTCCGG 0: 1
1: 0
2: 24
3: 15
4: 154
Right 968476865 4:814730-814752 CCTGTGCCAGAGTGATGGCCAGG 0: 2
1: 1
2: 0
3: 21
4: 215
968476852_968476862 16 Left 968476852 4:814686-814708 CCAGGTTTTCCCCAGGAGTCCGG 0: 1
1: 0
2: 24
3: 15
4: 154
Right 968476862 4:814725-814747 GAGTCCCTGTGCCAGAGTGATGG 0: 1
1: 0
2: 3
3: 78
4: 357
968476852_968476859 -10 Left 968476852 4:814686-814708 CCAGGTTTTCCCCAGGAGTCCGG 0: 1
1: 0
2: 24
3: 15
4: 154
Right 968476859 4:814699-814721 AGGAGTCCGGGAGGAACACAAGG 0: 1
1: 0
2: 1
3: 24
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968476852 Original CRISPR CCGGACTCCTGGGGAAAACC TGG (reversed) Intronic
900543059 1:3213669-3213691 CTGGAATCCTGGGGAAATGCTGG - Intronic
903778938 1:25809626-25809648 CCGGGCTCCTGGGGAGAAGGTGG + Intronic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
905199294 1:36305764-36305786 CCTAACTCCCAGGGAAAACCTGG + Intergenic
905629275 1:39509941-39509963 CCGGACACCTGGGGAAATGTGGG + Intronic
905668483 1:39776252-39776274 CCGGACACCTGGGGAAATGTGGG - Intronic
906322795 1:44827302-44827324 CTGGATTCCTGGGGGAGACCAGG + Exonic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909189714 1:72537352-72537374 CCTGACTCCAGGGGAAATCATGG - Intergenic
909353692 1:74683084-74683106 CAGGACTACAGGGGACAACCTGG - Intergenic
914752619 1:150545827-150545849 AGGGACTCCTGGTGACAACCTGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
918069152 1:181122359-181122381 CCAGGCTCCTGGGAAAACCCGGG - Intergenic
920851033 1:209627884-209627906 CCGGACTCCTGGCAAAGGCCCGG + Intronic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
922316534 1:224447491-224447513 CCAGTCTCCTGTGGAAACCCTGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063583108 10:7327104-7327126 CCAGACCACTGGGGGAAACCAGG + Intronic
1067748586 10:48955512-48955534 CCAGATTCCTGGGGAATCCCTGG - Intronic
1069809049 10:71145009-71145031 CAGGACTCCTGGGGAAGAGTTGG - Intergenic
1074474163 10:113754482-113754504 CAAGACTCCTGAGGATAACCTGG - Intronic
1076296184 10:129386574-129386596 CTGGACTCCAGTGGGAAACCAGG + Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1082835112 11:57645873-57645895 CCCCACCCCTGGGGGAAACCTGG - Exonic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1085481131 11:76823853-76823875 CAGAACTCCTGTGGGAAACCCGG - Intergenic
1086077758 11:82872656-82872678 GGGGACTCCTGGGGAGAGCCTGG - Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1090225637 11:125070688-125070710 GAGGGCTCCTGGGGAGAACCTGG + Intronic
1090765630 11:129873833-129873855 CCCGACTGCTGGGGAACAGCAGG + Exonic
1092406182 12:8223589-8223611 CCCGTCTCCTGGGGAAAACCAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1096244167 12:49975155-49975177 CAGGACTCCTGGCTAAAACGGGG + Intronic
1096774156 12:53954200-53954222 CCCGGCTCCAGAGGAAAACCCGG + Intergenic
1097222178 12:57457396-57457418 CCTGTCCCCTGGGAAAAACCAGG - Exonic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1099848181 12:88056679-88056701 CCTGACTACTGGGACAAACCAGG - Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG + Intronic
1105895095 13:24710607-24710629 CCGGCCTCCTGGGGCAGCCCTGG + Intronic
1106047915 13:26162385-26162407 TCTGCCTCCTGAGGAAAACCTGG + Intronic
1110049900 13:70883730-70883752 CCTGACTCCTTGGTAAAAACAGG + Intergenic
1113239908 13:108326033-108326055 ACAGACTCCTGGGCAAGACCAGG - Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116671218 14:47845770-47845792 AAGGATCCCTGGGGAAAACCTGG - Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1121347137 14:93144457-93144479 CCGACCTCCTGGAGAAAACATGG - Intergenic
1125343879 15:38699492-38699514 CCAGACCCCTGGGGAAAGGCAGG - Exonic
1128650078 15:69404827-69404849 GCAGACTCCTAGGGAAAACCAGG + Exonic
1132719640 16:1309463-1309485 CCGGGCTCCTGGGGCGGACCCGG + Intronic
1133286513 16:4693302-4693324 TCGGCCTCCTGGGGAGAAACGGG + Intergenic
1136551156 16:30983314-30983336 CCGGACTGCTGGGGCAAGTCTGG - Intronic
1138492208 16:57383180-57383202 CTGGCCTCCTGGGGAATGCCTGG - Exonic
1139348423 16:66320101-66320123 CCAGAATCCTCGGGAAAAACTGG + Intergenic
1142250891 16:88991355-88991377 CCGGACTCCTCGGAACAGCCAGG - Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1148739411 17:49883978-49884000 TCTGGCTCCTGGTGAAAACCAGG - Intergenic
1149845451 17:60006813-60006835 CCGGACTCCTGGGAACCAGCAGG + Intergenic
1152377303 17:79925476-79925498 CCGGGCTCCTGAGAAAACCCTGG - Intergenic
1152610273 17:81311914-81311936 CCCCGCTCCTGGGGAAAAACAGG + Exonic
1152788045 17:82262049-82262071 CTGGACTGGTGGGCAAAACCTGG - Intronic
1152943826 17:83187269-83187291 CCAGACTGCTGGGGAGCACCTGG + Intergenic
1155251705 18:23959268-23959290 CTGCACTTCTGGGGAAAACATGG - Intergenic
1159909498 18:74131864-74131886 CAGGACCCCTGGGGATAACTGGG + Intronic
1160590315 18:79940957-79940979 CCGGGCTCCTGGGGTCAGCCTGG - Intronic
1160858388 19:1227466-1227488 CCGGACTCCTGGGGGGCAGCAGG - Intronic
1161649020 19:5472760-5472782 CCCGGCTCTTGGGGTAAACCTGG + Intergenic
1166328904 19:42067581-42067603 AGGGACTCCTGGGGCAAATCAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925159740 2:1675737-1675759 CCAGACTCCAGAGGCAAACCGGG - Intronic
926114689 2:10204946-10204968 CCGTGCTCCTGGGGACCACCAGG - Intronic
926136874 2:10342726-10342748 CCGGACTCCTGGGCAAAGAGAGG + Intronic
926190172 2:10722059-10722081 CCGGACGGCTGGGGGAAAGCAGG - Intronic
927047779 2:19297495-19297517 CCTGACTTCTGGGGAGAAACAGG + Intergenic
928418075 2:31113400-31113422 CCTGAATCCTGGGGAAAGCTTGG + Intronic
929452275 2:42046134-42046156 TCAGACCCCTGGGGAAAACGGGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
937877920 2:126839384-126839406 CCGGAGATCTGGGGAAAGCCAGG - Intergenic
939350153 2:141026544-141026566 CCATACTCCTGGAGATAACCAGG + Intronic
940466410 2:154033972-154033994 CCTGAGTGCTGGGGAGAACCTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943971387 2:194411946-194411968 CCAGATTCCTGGGGAGTACCTGG + Intergenic
946411467 2:219517277-219517299 CCGGAATCCTGGGGATGGCCTGG + Intronic
1171987779 20:31672564-31672586 CCAGACTGTTGGGGGAAACCAGG - Intronic
1172122316 20:32605760-32605782 CCGGACAGCTGGAGAAAAACGGG - Intronic
1172144917 20:32750226-32750248 CCTTTCTCCTAGGGAAAACCTGG - Intergenic
1179881787 21:44296122-44296144 GTGGCCTCCTGGGGAAAACGAGG - Intronic
1180791742 22:18578485-18578507 CTGGGCTCCTGGGGAAGCCCGGG + Intergenic
1180915381 22:19482465-19482487 GCGTGCTCCTGGGGAAAACTGGG + Intronic
1181229994 22:21416824-21416846 CTGGGCTCCTGGGGAAGCCCGGG - Intergenic
1181248655 22:21518042-21518064 CTGGGCTCCTGGGGAAGCCCGGG + Intergenic
1181536588 22:23549422-23549444 CTGGAGGCCAGGGGAAAACCAGG - Intergenic
1183543723 22:38444528-38444550 CCTGACACCTGGGGGACACCTGG - Intronic
1184839526 22:47044312-47044334 AAGGACTCCTGGGGAAAGGCAGG - Intronic
1184916264 22:47571114-47571136 CCTGCCTGCTGGGCAAAACCAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950124359 3:10502438-10502460 TCAAACACCTGGGGAAAACCAGG + Intronic
950544229 3:13629310-13629332 CAGGACCCCTGGGGAACACCTGG + Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962929090 3:140021130-140021152 ACGGAGACCTGGGGAAACCCTGG - Intronic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
968457733 4:707466-707488 CCGGCCCCCAGGGGAAAACAGGG - Intronic
968457906 4:707933-707955 CCGGCCCCCAGGGGAAAACAGGG - Intronic
968457937 4:708005-708027 CCGGCCCCCAGGGGAAAACAGGG - Intronic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
969759949 4:9174394-9174416 CCTATCTCCTGGGGAAAACCAGG + Intronic
969844256 4:9907653-9907675 CCGAACTCCTGGGGACAATATGG + Intronic
971332894 4:25697057-25697079 CCACCCTCCTGGGGAAGACCAGG + Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
974558635 4:63487730-63487752 CCAGCATCCTGGGGAAAAACTGG - Intergenic
976922212 4:90454708-90454730 CCTGACTACTGTGGAAAAGCAGG - Intronic
981893662 4:149770091-149770113 CCAGACTCATGGAGAAAAACTGG + Intergenic
986724760 5:10585939-10585961 CCAGTCTCCTGCGGAAAGCCTGG - Intronic
988689523 5:33558561-33558583 CCGGCCTCCTAAGGAAAGCCTGG - Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
991090494 5:62689688-62689710 CCTGTCTCCTGAGGAAATCCTGG - Intergenic
1000398402 5:160799681-160799703 CCTGACACTTGGGGAAAAACAGG + Intronic
1000856615 5:166405674-166405696 CAGAGCTCCTGGGAAAAACCAGG - Intergenic
1002863180 6:1097670-1097692 CCAGACTCATAGGTAAAACCGGG + Intergenic
1007401659 6:41606038-41606060 CAGGACACCTGGGGACAGCCAGG + Intergenic
1007652470 6:43432127-43432149 CTGGACTCCTGGGGACAAGGGGG - Exonic
1008711829 6:54236953-54236975 CATTTCTCCTGGGGAAAACCTGG - Intronic
1011215821 6:85004576-85004598 CTGGGCTGCTGGGGAAGACCAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015818887 6:137239068-137239090 GCAGACTCCTGGTGGAAACCAGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019648006 7:2141325-2141347 CCTGGCTCCAGGGGAAAGCCTGG - Intronic
1021474955 7:21050384-21050406 CCATGCTCCTGGGGAAAACAGGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026849113 7:73713961-73713983 CCTGCCTCCTGGCCAAAACCAGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1036263557 8:7258125-7258147 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036264858 8:7265747-7265769 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036266159 8:7273369-7273391 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036267460 8:7280991-7281013 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036268762 8:7288613-7288635 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036270066 8:7296235-7296257 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036297830 8:7550820-7550842 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036299134 8:7558468-7558490 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036300439 8:7566118-7566140 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036301742 8:7573762-7573784 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036303039 8:7581411-7581433 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036315598 8:7716664-7716686 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036316906 8:7724312-7724334 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036318213 8:7731960-7731982 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036319522 8:7739607-7739629 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036320829 8:7747255-7747277 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036322139 8:7754903-7754925 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036323448 8:7762551-7762573 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036324743 8:7770198-7770220 CCTGTCTCCTGGGGAAAACCAGG + Intergenic
1036351291 8:8014109-8014131 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036352596 8:8021755-8021777 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036353888 8:8029403-8029425 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036846558 8:12174528-12174550 CCTGTCTCCTGGGGAAAACCAGG - Intergenic
1036867920 8:12416847-12416869 CCTGTCTCCTGGGGAAAACGAGG - Intergenic
1038809059 8:30821584-30821606 CCAGACTTCAGGGGAAAAACTGG - Intergenic
1040301712 8:46191427-46191449 CAGCACTCCTGGGAAAATCCTGG - Intergenic
1040565089 8:48557783-48557805 CAGGACTGCTGGAGAGAACCAGG + Intergenic
1041049105 8:53915695-53915717 GAAGACTCCTGGGGAGAACCTGG - Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1047962528 8:130021309-130021331 ATGGACCCATGGGGAAAACCGGG + Intergenic
1049379441 8:142304755-142304777 CCGGACTCAGGTGGGAAACCAGG + Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049612683 8:143562723-143562745 CCGGGCTCCTGGGGAACAGCTGG + Exonic
1049618196 8:143585607-143585629 CCCAACTCCTCGGGAACACCAGG + Intronic
1049710153 8:144059783-144059805 CCGGCCTCCTGGGGACCACGTGG + Exonic
1049790474 8:144470034-144470056 CCAGACACCTGTGGAAAAGCAGG + Intronic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059364544 9:113775956-113775978 CCGTACTCATGTGGAGAACCAGG + Intergenic
1190330099 X:49230538-49230560 CCGCACACCGGGGGAAAGCCAGG - Exonic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191241380 X:58192660-58192682 AAAGACTCCTGGTGAAAACCAGG + Intergenic
1191243318 X:58206442-58206464 CCAGACTCCTGGGGTAGGCCAGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1198142183 X:133815335-133815357 CAGGACTCCTGGGGAAAGATAGG - Intronic
1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG + Intronic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1200070951 X:153529103-153529125 CAGGTCACCTGGGGAAAGCCTGG - Intronic
1200319962 X:155177576-155177598 CAGGCCTCCTGGCAAAAACCTGG + Intergenic
1201550773 Y:15214358-15214380 CTGGACTCCTAGGGCAATCCAGG - Intergenic