ID: 968477581

View in Genome Browser
Species Human (GRCh38)
Location 4:819611-819633
Sequence GAAACCAAGTCTCCCCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968477579_968477581 -4 Left 968477579 4:819592-819614 CCTAGCGGTTCTGCACCTAGAAA 0: 1
1: 0
2: 0
3: 9
4: 93
Right 968477581 4:819611-819633 GAAACCAAGTCTCCCCAAGTTGG 0: 1
1: 0
2: 0
3: 20
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968477581 Original CRISPR GAAACCAAGTCTCCCCAAGT TGG Intronic
901489679 1:9590183-9590205 CAACCCAAGTCTCTCCATGTCGG + Intronic
901647839 1:10726308-10726330 GAAACCGGGTCTCCCCAGCTTGG + Intronic
903609252 1:24598102-24598124 GAACTAAAGTCTCCCCAAGAAGG + Intronic
906222794 1:44095399-44095421 GAAACGAAGTTTCTCCATGTTGG + Intergenic
907017759 1:51033794-51033816 AAAACCCAGTCTCCCCAATGTGG - Intergenic
907164453 1:52398148-52398170 GAAACGAGGTCTCACCACGTTGG + Intronic
908357008 1:63331574-63331596 GAACCCAAGGCTCTCCAAGTGGG - Intergenic
908668602 1:66520555-66520577 GAAACCAAGTCTCCATAGGTAGG - Intergenic
908726600 1:67183346-67183368 GAAACCAGGTTTCACCATGTTGG - Intronic
911416907 1:97586226-97586248 AAAGCCAAATCTCACCAAGTGGG + Intronic
913720519 1:121588110-121588132 GCAGCAAAGCCTCCCCAAGTAGG + Intergenic
914377595 1:147085917-147085939 GAAACAAAGTCACCCAAATTTGG + Intergenic
914995489 1:152539818-152539840 GAAGCCAAGTCTCCTCAGGATGG - Intronic
915249405 1:154577708-154577730 GAAACCAAGTCTCCCTTATCAGG + Exonic
915329144 1:155098798-155098820 GAAACCAGGTTTCGCCATGTTGG - Intergenic
916547513 1:165819716-165819738 AAAGCCAAATCTCGCCAAGTAGG + Intronic
918187578 1:182141899-182141921 GAGACCAGGTTTCCCCATGTTGG + Intergenic
919726403 1:200887617-200887639 GGGTCCAAGTCTCCCCAAGTGGG + Intergenic
920655531 1:207871585-207871607 GAAACAAAGTCTCAAAAAGTCGG - Intergenic
921186812 1:212677632-212677654 GAAACTCAGTCCTCCCAAGTGGG + Intergenic
921221158 1:212974878-212974900 GAAACCAAGGCTCCCCGAGGAGG - Intronic
922951824 1:229564324-229564346 GAGACCAAGTTTCACCATGTTGG + Intergenic
1063031123 10:2236335-2236357 GAAGCCATTTCACCCCAAGTTGG + Intergenic
1063345115 10:5304480-5304502 AAAGCCAAATCTCACCAAGTAGG - Intergenic
1064946782 10:20799340-20799362 GATACCAGGTCTCACCATGTTGG + Intronic
1065203503 10:23336698-23336720 GAGATGAAGTCTCCCCATGTTGG + Intronic
1068186612 10:53593790-53593812 GAAACCACTTCTGCCCCAGTTGG + Intergenic
1069310800 10:67033956-67033978 GAGACCAGGTTTCCCCATGTTGG + Intronic
1069448863 10:68499894-68499916 AAAGCCAAATCTCGCCAAGTAGG + Intronic
1070104891 10:73422311-73422333 AAAGCCAAATCTCGCCAAGTAGG - Intergenic
1070202038 10:74216536-74216558 GAAACGAAGTTTCACCACGTTGG - Intronic
1070255204 10:74808029-74808051 GAAACAAGGTTTCTCCAAGTTGG - Intergenic
1070325775 10:75387992-75388014 GAAACCAAGCCTGCTCATGTGGG - Intergenic
1074600148 10:114905773-114905795 GAAACCAAGCCTCCCAGAGAAGG - Intergenic
1077341127 11:2026839-2026861 GAAACCAAGTCTCACTGAGCGGG + Intergenic
1077397957 11:2335364-2335386 AAAGCCAAGTCTCAACAAGTTGG - Intergenic
1078350032 11:10585452-10585474 GAAACCAAGGCTCAAAAAGTAGG + Intronic
1078574393 11:12486345-12486367 GAAACAAAGTTTCTCCATGTTGG - Intronic
1080468934 11:32526285-32526307 GAGACCAAGTTTTGCCAAGTTGG - Intergenic
1081450251 11:43164266-43164288 GATACCAAGTGTCCCAAAGGAGG + Intergenic
1083278833 11:61613023-61613045 GAGACCAGGTTTCCCCATGTTGG + Intergenic
1083739915 11:64703404-64703426 GAAACCAAGACTCAGAAAGTAGG + Intronic
1085062927 11:73464626-73464648 GAACCCATGTCTCCCCATCTGGG - Intronic
1085573798 11:77584480-77584502 GAGACCAAGTTTCACCATGTTGG + Intronic
1086957218 11:92945921-92945943 GATACCAAGTGTCCCAAAGGAGG + Intergenic
1089155257 11:116397098-116397120 GAAACCAGGTCTGGCCAAATGGG + Intergenic
1089555089 11:119311764-119311786 GAGACCAGGTCACCCCAAGTGGG - Intronic
1202824112 11_KI270721v1_random:82028-82050 GAAACCAAGTCTCACTGAGCGGG + Intergenic
1091437906 12:487524-487546 GAAACCAGGTTTCACCATGTTGG - Intronic
1092665112 12:10787791-10787813 GAGACCAAGTTTCACCATGTTGG + Intergenic
1096293822 12:50366015-50366037 AAAGCCAAATCTCGCCAAGTAGG + Intronic
1096591143 12:52659928-52659950 GAAAGCAGGTGTCCCCAAGAAGG - Intergenic
1097013775 12:55971163-55971185 CAAGCCAAGTTTCCCCAAGTGGG + Exonic
1097109582 12:56648259-56648281 GAAACCGAGTTTCTCCATGTTGG - Intergenic
1098234749 12:68407704-68407726 GAAACCAGGTTTCACCATGTTGG + Intergenic
1099237813 12:80102948-80102970 AAAGCCAAATCTCGCCAAGTAGG - Intergenic
1102667498 12:114587978-114588000 GAAGCCAAGTGTTCCCCAGTGGG + Intergenic
1103347163 12:120258880-120258902 GAAACCAGGTTTCTCCATGTTGG - Intronic
1103905339 12:124324854-124324876 GAAACCAAGTCAGGCCAGGTGGG - Exonic
1104713652 12:131003084-131003106 AAAATCAAGTTTCCCCACGTTGG - Intronic
1108376900 13:49822425-49822447 GCAACCAAGCCTGCCCAAGCCGG + Intergenic
1109874367 13:68380346-68380368 GAAACCAAATATGCCAAAGTAGG + Intergenic
1110811141 13:79811671-79811693 GAAACCAGTTCTCCCCACGTTGG - Intergenic
1111013702 13:82348082-82348104 GAGACCAAGTCTCCCTCTGTTGG - Intergenic
1111355824 13:87101755-87101777 GAAATCAAGTATATCCAAGTTGG - Intergenic
1112974019 13:105294639-105294661 GAGACAAAGTCTCGCCATGTTGG - Intergenic
1113108747 13:106799241-106799263 GAAACAGAGTCTCACCAACTGGG - Intergenic
1113706924 13:112441109-112441131 GAGACCAGGTTTCCCCATGTTGG + Intergenic
1115355949 14:32447849-32447871 GAAACCAAGACTCCCACTGTAGG - Intronic
1116328498 14:43565695-43565717 GAAGCCAATTCTCCCTAAATTGG + Intergenic
1117356438 14:54928268-54928290 GAAATCAGGTCTCACCAGGTGGG - Intergenic
1118174372 14:63423281-63423303 GAAACCAGGTTTCACCATGTTGG + Intronic
1118313714 14:64711115-64711137 GAAACCAAGTCCCCACGAGTTGG + Intronic
1119557271 14:75563096-75563118 GAAACAGGGTCTCCCCATGTTGG + Intergenic
1120497531 14:85255537-85255559 GAAACGAAGTTTCACCATGTTGG - Intergenic
1120766006 14:88326816-88326838 GCAACGAAGTTTCCCCGAGTTGG + Intronic
1121263362 14:92582637-92582659 GAAACCAGGTTTCACCATGTTGG + Intronic
1121726816 14:96158365-96158387 GAAACCAATTCTCCCCAAACTGG - Intergenic
1125115274 15:36083669-36083691 GAGACAAAGTCTCCCTATGTTGG - Intergenic
1125385879 15:39135984-39136006 GAAACCATGTTTCTCCATGTTGG + Intergenic
1126033768 15:44528020-44528042 GAATCCAAGTCTCACTAACTAGG + Exonic
1127213896 15:56803907-56803929 GAAACCACCTCTCCCCAAGGTGG + Intronic
1128054018 15:64686463-64686485 GAAATCAAGTGTCCCCCACTGGG - Intergenic
1133063702 16:3191561-3191583 GAAAACAAGTCGCCCAACGTGGG - Intergenic
1133292680 16:4733476-4733498 GAGACGAAGTGTCCCCATGTTGG + Intronic
1133450215 16:5897617-5897639 GAAACCAAGGCCCCTCAAGGTGG + Intergenic
1134351603 16:13442765-13442787 GAGACCAAGTCTCACTATGTTGG - Intergenic
1135002781 16:18790732-18790754 GAGACGAGGTTTCCCCAAGTTGG + Intronic
1136923053 16:34346933-34346955 GGAACCAAGTCTCTCCCAGGGGG + Intergenic
1136981520 16:35064873-35064895 GGAACCAAGTCTCTCCCAGGGGG - Intergenic
1138391527 16:56673970-56673992 GAGACCAGGTTTCACCAAGTTGG - Intronic
1139911685 16:70401166-70401188 GAAACCAGGTCTCCCCAGGCAGG - Intronic
1140729666 16:77844593-77844615 GAAACGAGGTTTCCCCATGTTGG + Intronic
1143526350 17:7475153-7475175 GAGACCAAGTTTCACCATGTTGG - Intronic
1143668278 17:8377616-8377638 AAAGCCAAATCTCGCCAAGTAGG - Exonic
1145302008 17:21647442-21647464 GAACCCAGGTCTCCCAAAGCAGG - Intergenic
1145328354 17:21850198-21850220 GAACCCAGGTCTCCCAAAGCAGG - Intergenic
1145415279 17:22709488-22709510 GAACCCAGGTCTCCCAAAGCAGG - Intergenic
1145695136 17:26781542-26781564 GAACCCAGGTCTCCCAAAGCAGG - Intergenic
1146945332 17:36869635-36869657 GGAACAAAGACTCGCCAAGTAGG + Intergenic
1147677002 17:42213953-42213975 GAGACCAGGTCTCACCATGTTGG - Intronic
1147737231 17:42647379-42647401 GAAACCAGGTTTCACCATGTTGG - Intergenic
1148594545 17:48842825-48842847 GAAACCAGGTTTCACCATGTTGG + Intronic
1149444967 17:56706230-56706252 GAAACGAGGTTTCCCCACGTTGG + Intergenic
1151592891 17:75058135-75058157 GAGACGAAGTCTCACCATGTTGG - Intronic
1151867529 17:76814072-76814094 GAAACGAAGTTTCACCATGTTGG - Intergenic
1152527993 17:80900500-80900522 GAGACAAAGTTTCTCCAAGTTGG + Intronic
1154315795 18:13302220-13302242 TAAACCCAGTCTCCCAAACTGGG - Intronic
1155287792 18:24308955-24308977 GAGACCAAGTTTCACCATGTTGG + Intronic
1155445513 18:25908281-25908303 GAAACCAAATATGACCAAGTGGG - Intergenic
1157354326 18:46918606-46918628 GAAACGAGGTTTCTCCAAGTTGG + Intronic
1158663935 18:59415360-59415382 GAAATCAGGTCTCACCATGTTGG + Intergenic
1158764166 18:60428445-60428467 AAAACCAAGTCTCCATAAGAAGG + Intergenic
1159181716 18:64915328-64915350 GAAACGAAGTTTCACCATGTTGG + Intergenic
1161008742 19:1949768-1949790 GAAACCAAGTCACCGGAAGAGGG - Intronic
1161339909 19:3735732-3735754 GAAACCATGTCTCACCACTTAGG - Intronic
1163211497 19:15844251-15844273 GAAACGGAGTCTCACCATGTTGG + Intergenic
1163893298 19:20035920-20035942 GAAACGAAGTCTCACTATGTTGG + Intronic
1167283736 19:48586922-48586944 GAGACGAGGTCTCCCCATGTTGG - Intronic
1167461541 19:49627118-49627140 GAAACCAGGTTTCACCATGTCGG + Intergenic
1167688983 19:50974013-50974035 GAGACCAAGTTTCACCACGTTGG - Intergenic
925283318 2:2700030-2700052 GAGACAAAGTCTCACCATGTTGG - Intergenic
927568500 2:24136699-24136721 AAAGCCAAGACTCCCAAAGTGGG - Intronic
927675996 2:25106617-25106639 GAAACCCTGTCTCCCTTAGTTGG - Intronic
928370298 2:30735658-30735680 GAAACCAAGTGACCCCTAGTCGG + Intronic
928559719 2:32467587-32467609 GAGGCCAAGTCTCCACAAGTGGG - Exonic
929688640 2:44056424-44056446 GAAGCCAAGTCTTCCAAGGTTGG - Intergenic
930157768 2:48123330-48123352 GAAACAAGGTTTCCCCATGTTGG - Intergenic
930668797 2:54125892-54125914 GAAACCAGGTTTCTCCATGTTGG - Intronic
931272025 2:60711846-60711868 AAAGCCAAATCTCGCCAAGTAGG + Intergenic
931438315 2:62268210-62268232 GAAGCCAAGGGTCCCCAAGAAGG - Intergenic
932220115 2:69992772-69992794 GAAACCATTTCTCCCAAAGGGGG - Intergenic
935412096 2:102775051-102775073 GATACCAATTCTCCCCAGGTGGG - Intronic
937264954 2:120609632-120609654 AAAACCAAGTCTCACCAGGGAGG + Intergenic
938374213 2:130794989-130795011 CAAACCAAGTCTCACTATGTGGG + Intergenic
940127896 2:150347527-150347549 GCAACCAATTCTCCTAAAGTGGG - Intergenic
940220104 2:151342790-151342812 GAGACGAAGTTTCACCAAGTTGG - Intergenic
942710730 2:178832295-178832317 GAAACCAGGTTTCACCATGTTGG - Exonic
943986004 2:194619643-194619665 GTAAGCAAATCTCCCCAAGGAGG - Intergenic
944064242 2:195602328-195602350 GAAACCAGGTTTCACCATGTTGG + Intronic
944090287 2:195901605-195901627 GAAGCCAGGTCTCCCAACGTGGG - Intronic
944252343 2:197590914-197590936 AAAAACAAAACTCCCCAAGTGGG + Intronic
944658580 2:201901119-201901141 GAGACCAAGTTTCACCATGTTGG - Intergenic
1169488778 20:6054305-6054327 GAAGCCAATTCTCCCAAAGGAGG + Intergenic
1171518592 20:25758844-25758866 GAACCCAGGTCTCCCAAAGCAGG - Intergenic
1171558264 20:26097365-26097387 GAACCCAGGTCTCCCAAAGCAGG + Intergenic
1172140905 20:32722535-32722557 GAGACCAAGTTTCACCATGTTGG - Intronic
1172616135 20:36286049-36286071 GATGCCAAGTTTCCTCAAGTAGG - Intergenic
1174436225 20:50509302-50509324 GAAACCGAGTTTCACCATGTTGG + Intergenic
1174629233 20:51941784-51941806 GAGACAAGGTCTCCCCAAGTTGG - Intergenic
1174883756 20:54308893-54308915 GAAGCCAAGTCTCCAGATGTTGG - Intergenic
1176095224 20:63338947-63338969 GAGACGAAGTCTCACCATGTTGG - Intergenic
1179147829 21:38784133-38784155 GAGACAAAGTTTCCCCATGTTGG + Intergenic
1179197106 21:39174530-39174552 GAAACCAAGTTTACTCAAGAAGG + Intergenic
1181789881 22:25256855-25256877 GAAACGAGGTTTCACCAAGTTGG + Intergenic
1182091903 22:27601710-27601732 GAAACGAGGTCTCACCATGTTGG + Intergenic
1183501891 22:38185237-38185259 GAAACGAGGTTTCACCAAGTTGG + Intronic
1183631947 22:39038838-39038860 GAGACCAGGTCTCACCATGTTGG + Intergenic
949350484 3:3120678-3120700 GAAACAGAGTTTCACCAAGTTGG + Intronic
950218247 3:11174973-11174995 GAAACCAAGCCACACCAAGTGGG - Intronic
950294016 3:11812513-11812535 GAAGCAAAGTGTTCCCAAGTGGG - Intronic
950475995 3:13215182-13215204 CAAACCAAGCCTCCGCCAGTGGG + Intergenic
952184269 3:30951907-30951929 GAACTCAAGTTTCCCCATGTAGG - Intergenic
953207260 3:40842268-40842290 GAAACCAGGTTTCACCATGTTGG - Intergenic
953986191 3:47444956-47444978 GAGACCAAGTTTCACCATGTTGG + Intronic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
955077215 3:55625022-55625044 GAAACCAAGTCTTTCCAAAAAGG + Intronic
955589436 3:60518820-60518842 GAGACGAAGTTTCCCCATGTTGG - Intronic
956809602 3:72851867-72851889 GAAACAAAGTTTTCCCATGTTGG - Intronic
958158779 3:89789740-89789762 GAAACCAGGTTTCGCCATGTTGG + Intergenic
959232022 3:103666767-103666789 GAGACGAAGTCTCACCATGTTGG + Intergenic
959348647 3:105232287-105232309 GAAGCCAAGGCTCGCCATGTGGG - Intergenic
959639132 3:108611776-108611798 GAGACCAAGTTTCACCATGTTGG - Intronic
960423726 3:117480750-117480772 GAACACAAGTCTCCCTAAATGGG - Intergenic
961334097 3:126159881-126159903 GAAAGCCAGTCTCCCTCAGTGGG - Intronic
964101026 3:152988962-152988984 GAAATCCAGTATCCACAAGTAGG + Intergenic
964124524 3:153222431-153222453 GAAACCAGGTTTCACCATGTTGG - Intergenic
968190909 3:196666460-196666482 GAAAGCAAATCTCCCGAAGATGG + Intronic
968477581 4:819611-819633 GAAACCAAGTCTCCCCAAGTTGG + Intronic
970879943 4:20917222-20917244 GAAAGGAAGTTTCCCCATGTTGG + Intronic
973280932 4:48360402-48360424 GAGACCAGGTTTTCCCAAGTTGG - Intronic
975125892 4:70781640-70781662 GAAACCAATTCTGGGCAAGTAGG - Intronic
977231538 4:94456382-94456404 GAGACCAAGTTTCCCTATGTTGG + Intronic
977596875 4:98892490-98892512 GAAACCAGGTTTCACCATGTTGG - Intronic
977985086 4:103373606-103373628 GAATCCAAGTCTTTCCTAGTTGG + Intergenic
978203004 4:106045243-106045265 GAGACAAAGTTTCCCCATGTTGG + Exonic
978278879 4:106985620-106985642 GAAACGAGGTCTCACCATGTTGG - Intronic
979081139 4:116344044-116344066 GAGACCAAGTTTCCTCATGTTGG + Intergenic
979222633 4:118246700-118246722 GAAACCAACTCTTCACAAGGAGG + Intronic
979361841 4:119774496-119774518 GAATCCAAGTCTCCAGAAGGAGG - Intergenic
980709235 4:136542435-136542457 GAGACCAGGTTTCACCAAGTTGG - Intergenic
981664189 4:147202996-147203018 GAAACCAAGTCTTAGAAAGTTGG + Intergenic
983206983 4:164920670-164920692 GAAGCCAAATCTCGCCAAGTAGG - Intergenic
984510023 4:180668487-180668509 GAAACGAAGTTTCACCATGTTGG + Intergenic
985971349 5:3381016-3381038 GAAAACAAGTCTTGCCCAGTAGG + Intergenic
986249026 5:6039070-6039092 GAAACCCACTCTACCCAAGAAGG - Intergenic
986326216 5:6676732-6676754 GAAACTAATTCTCACCAAGGTGG + Intergenic
988774296 5:34463460-34463482 GATACCAAGTGTCCCAAAGGAGG + Intergenic
991483588 5:67110835-67110857 GAGACCAAGTGTCACCATGTTGG - Intronic
992701767 5:79348145-79348167 GAAACCAGGTTTCACCATGTTGG + Intergenic
993388442 5:87288387-87288409 GAAAACAATTCTTTCCAAGTTGG - Intronic
993720272 5:91315176-91315198 GAAACGAAGTTTCGCCATGTTGG + Intergenic
993933612 5:93973135-93973157 GAAACCAGGTCTCACTATGTTGG + Intronic
995141965 5:108745022-108745044 GAGACAAAGTTTCACCAAGTTGG - Intergenic
998004523 5:138648253-138648275 GCAGCCACGTCTCCCCAAGCCGG - Intronic
999838336 5:155398645-155398667 GAAACCAAATCACCCGAAGAAGG + Intergenic
1001607142 5:172969467-172969489 AAAGCCAAGTCTCGACAAGTTGG + Exonic
1004633494 6:17444448-17444470 GAAACCAAGTTTCACCATGTTGG - Intronic
1006556843 6:34874338-34874360 GAAACAAAGTTTCACCATGTTGG - Exonic
1006674651 6:35753739-35753761 GAGACCAAGTTTCGCCATGTTGG + Intergenic
1007593824 6:43039325-43039347 GAAACAATGTCTCCCCTATTAGG + Intronic
1007611957 6:43155452-43155474 GAAACGAAGTTTCACCATGTTGG - Intronic
1008039666 6:46783809-46783831 GAAACCAGGTTTCACCATGTTGG + Intergenic
1011119578 6:83937086-83937108 GAAACAGAGTTTCCCCATGTTGG - Intronic
1011465729 6:87655055-87655077 GAAACTAAAACTCCCCACGTTGG + Intronic
1013476561 6:110512290-110512312 GAGACCAAGTTTCACCATGTTGG - Intergenic
1014405606 6:121046803-121046825 GATACCAAGTGTCCCAAAGGAGG - Intergenic
1014653955 6:124075780-124075802 CAGACCAAGTTTCCCCATGTTGG + Intronic
1016445782 6:144130860-144130882 GAAAACAAGTCTTCCCCAGGTGG + Intergenic
1017664890 6:156710016-156710038 GAGACAAAGTTTCACCAAGTTGG - Intergenic
1018447399 6:163870170-163870192 GAAACCAGGTGTCCCCAGGTTGG + Intergenic
1018483406 6:164214741-164214763 GAACCCAAGTTTGGCCAAGTGGG + Intergenic
1019937420 7:4265519-4265541 GAAATCTAGTGTCCACAAGTAGG - Exonic
1020890552 7:13872445-13872467 AAAGCCAAATCTCACCAAGTAGG + Intergenic
1021435333 7:20606976-20606998 GATACCAGGTTTCGCCAAGTTGG + Intergenic
1022004280 7:26252807-26252829 GAAACCAGGTTTCTCCATGTTGG - Intergenic
1022259417 7:28690127-28690149 GTCACCAAGACTCCCCAACTGGG - Intronic
1022279361 7:28890430-28890452 GAAAACAAGTCTACCCAATATGG - Intergenic
1022788017 7:33658656-33658678 GAGACGAAGTTTCCCCATGTTGG + Intergenic
1023891313 7:44393881-44393903 GACACCACGTCCCCCCAAGAGGG + Intronic
1024588977 7:50864652-50864674 GCAACAAAGTCCCCCTAAGTGGG + Intergenic
1024699224 7:51889074-51889096 GAAACCAGGTCTCCCCCTATGGG - Intergenic
1024799943 7:53065170-53065192 GAGACCCAGTTTCCCCATGTTGG + Intergenic
1026263767 7:68778379-68778401 GAGACCAGGTCTCACCATGTTGG - Intergenic
1026745677 7:73009940-73009962 GAGACGAGGTCTCCCCATGTTGG - Intergenic
1026749331 7:73037882-73037904 GAGACGAGGTCTCCCCATGTTGG - Intergenic
1026752979 7:73066027-73066049 GAGACGAGGTCTCCCCATGTTGG - Intergenic
1026756629 7:73094153-73094175 GAGACGAGGTCTCCCCATGTTGG - Intergenic
1027024613 7:74841935-74841957 GAGACAAAGTTTCACCAAGTTGG - Intronic
1027031783 7:74894614-74894636 GAGACGAGGTCTCCCCATGTTGG - Intergenic
1027063152 7:75102187-75102209 GAGACAAAGTTTCACCAAGTTGG + Intronic
1027090776 7:75299275-75299297 GAGACGAGGTCTCCCCATGTTGG + Intergenic
1027094421 7:75327245-75327267 GAGACGAGGTCTCCCCATGTTGG + Intergenic
1027098064 7:75355170-75355192 GAGACGAGGTCTCCCCATGTTGG + Intergenic
1027324917 7:77040441-77040463 GAGACGAGGTCTCCCCATGTTGG - Intergenic
1027427836 7:78080156-78080178 GAAAACAAGACCCCCAAAGTCGG + Intronic
1031061850 7:117060817-117060839 GAGACCAAGTTTCACCATGTTGG - Intronic
1031116469 7:117674049-117674071 AAAACCAAATCTCCACAAGGTGG - Intronic
1031225618 7:119034255-119034277 GAAACCAGGTTTGCCTAAGTAGG + Intergenic
1031657291 7:124373668-124373690 GAAACAGATTCTTCCCAAGTTGG - Intergenic
1032729027 7:134619143-134619165 TAAGCCAGGACTCCCCAAGTGGG - Intergenic
1035128955 7:156633718-156633740 AAAGCCAAATCTCGCCAAGTAGG + Intergenic
1037965619 8:23131680-23131702 GACACCAAGTTTCTCCATGTTGG + Intergenic
1039034767 8:33347989-33348011 GAGACCAAGTTTCACCATGTTGG - Intergenic
1042891168 8:73611866-73611888 GAGACCAAGTTTCGCCATGTTGG + Intronic
1043730833 8:83678373-83678395 GAGACAAAGACTCCCTAAGTTGG - Intergenic
1044694033 8:94905173-94905195 GAGACATAGTCTCCCCTAGTTGG - Intronic
1045438635 8:102188736-102188758 GATACCAACTCCCCTCAAGTTGG - Intergenic
1048908610 8:139112734-139112756 AAAACCAAGTTTCACCATGTTGG + Intergenic
1051878461 9:21815528-21815550 AAAAACATGTCTCCACAAGTTGG - Intronic
1053836522 9:42142264-42142286 CAAACCAAGGCCCCCCAAATTGG + Intergenic
1054840738 9:69736368-69736390 GAAACAAAGTTTCACCATGTTGG - Intronic
1055025742 9:71718761-71718783 GAGACAAGGTCTCCCCATGTTGG + Intronic
1055187404 9:73473315-73473337 GAAACAAAGTCTTCCCTTGTGGG - Intergenic
1057383459 9:94588763-94588785 AAATCCAAGTCCCCGCAAGTGGG + Intronic
1057967110 9:99514927-99514949 GAAACGAAGTTTCACCATGTTGG - Intergenic
1059767426 9:117396750-117396772 GAAACAGAGTTTCCCCATGTTGG + Intronic
1059876469 9:118640971-118640993 GAATCCAGCTCTCCCCAAGTTGG - Intergenic
1061068112 9:128291646-128291668 GAAACCAAGTTTAACCAGGTTGG - Intergenic
1061513154 9:131072931-131072953 GAAATTAAGCCTCCCAAAGTGGG - Intronic
1062079180 9:134611438-134611460 GAAATCCAGTCCCCCCAAGGTGG + Intergenic
1185604238 X:1358469-1358491 GAAACAAAGTTTCACCATGTTGG - Intronic
1189183145 X:39022953-39022975 GATATCAATTCTCCCCAAATTGG - Intergenic
1190101268 X:47524361-47524383 GTTATCAAGTCACCCCAAGTGGG + Intergenic
1190200636 X:48357740-48357762 GAAACCATGTTTCCCTATGTTGG + Intergenic
1195066192 X:101240420-101240442 GAGACCAGGTCTCGCCATGTTGG + Intronic
1195777352 X:108422174-108422196 GAAACAAGGTCTGCCCAAGCTGG - Intronic
1196824010 X:119726567-119726589 GACACGAAGTCTCACCATGTTGG - Intergenic
1199538881 X:148935597-148935619 GAAACCAAGGATCACGAAGTTGG - Intronic
1199775383 X:151006443-151006465 GAAACAGAGTTTCCCCATGTTGG - Intergenic
1200109775 X:153734386-153734408 GAGACGAAGTCTCACCATGTTGG - Intronic
1200122065 X:153795770-153795792 GAAACAAAGGCTCCCCAAAGTGG - Intronic
1202045327 Y:20731660-20731682 GAGACAAGGTTTCCCCAAGTTGG + Intergenic