ID: 968479506

View in Genome Browser
Species Human (GRCh38)
Location 4:826999-827021
Sequence TGCAGCGGACGCGGCACTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968479496_968479506 -1 Left 968479496 4:826977-826999 CCCTGGCCCCCGGGATTTCCTCT No data
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data
968479494_968479506 3 Left 968479494 4:826973-826995 CCTCCCCTGGCCCCCGGGATTTC No data
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data
968479502_968479506 -10 Left 968479502 4:826986-827008 CCGGGATTTCCTCTGCAGCGGAC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data
968479497_968479506 -2 Left 968479497 4:826978-827000 CCTGGCCCCCGGGATTTCCTCTG No data
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data
968479485_968479506 21 Left 968479485 4:826955-826977 CCAGAGACCCCACCGCTCCCTCC No data
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data
968479490_968479506 9 Left 968479490 4:826967-826989 CCGCTCCCTCCCCTGGCCCCCGG No data
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data
968479501_968479506 -9 Left 968479501 4:826985-827007 CCCGGGATTTCCTCTGCAGCGGA No data
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data
968479488_968479506 13 Left 968479488 4:826963-826985 CCCACCGCTCCCTCCCCTGGCCC No data
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data
968479487_968479506 14 Left 968479487 4:826962-826984 CCCCACCGCTCCCTCCCCTGGCC No data
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data
968479489_968479506 12 Left 968479489 4:826964-826986 CCACCGCTCCCTCCCCTGGCCCC 0: 1
1: 0
2: 18
3: 251
4: 2252
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data
968479499_968479506 -8 Left 968479499 4:826984-827006 CCCCGGGATTTCCTCTGCAGCGG No data
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data
968479495_968479506 0 Left 968479495 4:826976-826998 CCCCTGGCCCCCGGGATTTCCTC No data
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data
968479493_968479506 4 Left 968479493 4:826972-826994 CCCTCCCCTGGCCCCCGGGATTT No data
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data
968479498_968479506 -7 Left 968479498 4:826983-827005 CCCCCGGGATTTCCTCTGCAGCG No data
Right 968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968479506 Original CRISPR TGCAGCGGACGCGGCACTGC GGG Intergenic
No off target data available for this crispr