ID: 968480334

View in Genome Browser
Species Human (GRCh38)
Location 4:830365-830387
Sequence CCCTTTCCTCCACAGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968480334_968480342 7 Left 968480334 4:830365-830387 CCCAGAGGCTGTGGAGGAAAGGG No data
Right 968480342 4:830395-830417 TGTGGGCTGCAGCTGCTCGAGGG No data
968480334_968480339 -10 Left 968480334 4:830365-830387 CCCAGAGGCTGTGGAGGAAAGGG No data
Right 968480339 4:830378-830400 GAGGAAAGGGGCCTTGCTGTGGG No data
968480334_968480341 6 Left 968480334 4:830365-830387 CCCAGAGGCTGTGGAGGAAAGGG No data
Right 968480341 4:830394-830416 CTGTGGGCTGCAGCTGCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968480334 Original CRISPR CCCTTTCCTCCACAGCCTCT GGG (reversed) Intergenic
No off target data available for this crispr