ID: 968480363

View in Genome Browser
Species Human (GRCh38)
Location 4:830466-830488
Sequence AGGGGCCTTCCCGGAGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968480348_968480363 15 Left 968480348 4:830428-830450 CCCAGCCTCAACACCTCAGGGCA No data
Right 968480363 4:830466-830488 AGGGGCCTTCCCGGAGGACAGGG No data
968480351_968480363 10 Left 968480351 4:830433-830455 CCTCAACACCTCAGGGCAGGAAG No data
Right 968480363 4:830466-830488 AGGGGCCTTCCCGGAGGACAGGG No data
968480349_968480363 14 Left 968480349 4:830429-830451 CCAGCCTCAACACCTCAGGGCAG No data
Right 968480363 4:830466-830488 AGGGGCCTTCCCGGAGGACAGGG No data
968480356_968480363 2 Left 968480356 4:830441-830463 CCTCAGGGCAGGAAGGAGGGGCT No data
Right 968480363 4:830466-830488 AGGGGCCTTCCCGGAGGACAGGG No data
968480345_968480363 18 Left 968480345 4:830425-830447 CCTCCCAGCCTCAACACCTCAGG No data
Right 968480363 4:830466-830488 AGGGGCCTTCCCGGAGGACAGGG No data
968480343_968480363 22 Left 968480343 4:830421-830443 CCGCCCTCCCAGCCTCAACACCT No data
Right 968480363 4:830466-830488 AGGGGCCTTCCCGGAGGACAGGG No data
968480344_968480363 19 Left 968480344 4:830424-830446 CCCTCCCAGCCTCAACACCTCAG No data
Right 968480363 4:830466-830488 AGGGGCCTTCCCGGAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968480363 Original CRISPR AGGGGCCTTCCCGGAGGACA GGG Intergenic
No off target data available for this crispr