ID: 968483862

View in Genome Browser
Species Human (GRCh38)
Location 4:849450-849472
Sequence GAATCAGCTGTTCCTTCGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968483856_968483862 16 Left 968483856 4:849411-849433 CCAAATAAATCACAGACGTGACA 0: 1
1: 0
2: 0
3: 7
4: 120
Right 968483862 4:849450-849472 GAATCAGCTGTTCCTTCGGGAGG 0: 1
1: 0
2: 1
3: 5
4: 81
968483855_968483862 24 Left 968483855 4:849403-849425 CCGAAACACCAAATAAATCACAG 0: 1
1: 0
2: 1
3: 33
4: 394
Right 968483862 4:849450-849472 GAATCAGCTGTTCCTTCGGGAGG 0: 1
1: 0
2: 1
3: 5
4: 81
968483854_968483862 25 Left 968483854 4:849402-849424 CCCGAAACACCAAATAAATCACA 0: 1
1: 0
2: 2
3: 43
4: 401
Right 968483862 4:849450-849472 GAATCAGCTGTTCCTTCGGGAGG 0: 1
1: 0
2: 1
3: 5
4: 81
968483853_968483862 30 Left 968483853 4:849397-849419 CCACGCCCGAAACACCAAATAAA 0: 1
1: 0
2: 0
3: 5
4: 94
Right 968483862 4:849450-849472 GAATCAGCTGTTCCTTCGGGAGG 0: 1
1: 0
2: 1
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968483862 Original CRISPR GAATCAGCTGTTCCTTCGGG AGG Exonic
901961275 1:12828433-12828455 GACCCAGCTGTTCCTTCAGTTGG + Intronic
901967868 1:12883038-12883060 GACCCAGCTGTTCCTTCAGTTGG + Intronic
901983266 1:13053303-13053325 GACCCAGCTGTTCCTTCAGTTGG + Intronic
901985743 1:13074028-13074050 GACCCAGCTGTTCCTTCGGTTGG - Intronic
901996066 1:13152739-13152761 GACCCAGCTGTTCCTTCGGTTGG + Intergenic
901998823 1:13175615-13175637 GACCCAGCTGTTCCTTCAGTTGG - Intergenic
902017308 1:13318742-13318764 GACCCAGCTGTTCCTTCAGTTGG - Intronic
902030216 1:13416683-13416705 GACCCAGCTGTTCCTTCTGTTGG - Intronic
905905318 1:41614221-41614243 CAGGCAGCTGTTCCTTGGGGAGG - Intronic
907851361 1:58258179-58258201 GACACAGCTGCTCCTTCGCGGGG - Intronic
915750202 1:158199880-158199902 GAATCAGCTGTGGCATCAGGAGG + Intergenic
919814493 1:201428978-201429000 GAACCACTTGTTCCTTTGGGTGG - Intronic
921123612 1:212157864-212157886 GTGTCAGGTGTTCCTTCTGGAGG + Intergenic
924691384 1:246355078-246355100 GCATCAGCTTTTCCTTCCTGTGG + Exonic
924798335 1:247309133-247309155 GAAGCATCTGCTCCTTCAGGAGG - Intronic
1062927164 10:1325854-1325876 GAACAAGCTGTTCATTCTGGAGG + Intronic
1064309646 10:14200968-14200990 GATTCAGCTGTTCCTGCAGCTGG - Intronic
1065434780 10:25694991-25695013 GAAACAGCTGCCCCTTCGAGGGG - Intergenic
1068085648 10:52370335-52370357 GAATAATCTATTCCTTGGGGAGG - Intergenic
1074435257 10:113428640-113428662 AAATCACCTGTTCCATGGGGTGG + Intergenic
1083199003 11:61108366-61108388 GAATCTGCTGTTCCTTCCTGCGG + Intronic
1083921693 11:65784458-65784480 GCATCAGCTGTTCCTTCTGCTGG + Intergenic
1084653631 11:70502844-70502866 GAATCACCTGGTCCTTAAGGTGG - Exonic
1084670991 11:70606583-70606605 GAATCAGCAGGTCCTTTGTGGGG + Intronic
1089641180 11:119848190-119848212 AAATCAGCTGCTCCTTCCGAGGG - Intergenic
1089783923 11:120894685-120894707 AAAACAGCTGTTCCTACAGGAGG + Intronic
1090883494 11:130855469-130855491 GAGTGAGCTCTTCCTTTGGGTGG - Intergenic
1094331527 12:29299367-29299389 AAATCAGCTCTTCCTCTGGGAGG - Intronic
1100136751 12:91562352-91562374 GAATGAGCTGTGCCCTCTGGAGG - Intergenic
1112439986 13:99418208-99418230 GCCTCAGCTCTTCCTTCTGGGGG - Intergenic
1129607899 15:77033722-77033744 GAATGAGCTGGTCCTTGGGAAGG - Intronic
1130128333 15:81113846-81113868 GAATCACTTGGTCCTTCTGGTGG + Intronic
1130131783 15:81149605-81149627 GAAGCAGTGGTTCCTTAGGGTGG + Intergenic
1131067752 15:89444730-89444752 GAATCAGCTGCTGCTTCAGATGG - Intergenic
1132751887 16:1461425-1461447 GAACCAGCTGTTCCTGGAGGAGG - Exonic
1132973299 16:2699345-2699367 GAAGCAGCTCAGCCTTCGGGAGG + Intronic
1133226151 16:4341406-4341428 GAATCTGCTGTGCCTCCTGGAGG + Exonic
1134213730 16:12299524-12299546 GAAACACCTGTTCCTCCAGGGGG + Intronic
1135221471 16:20617954-20617976 GAATCAGGTCTTCCTATGGGAGG - Intronic
1141285372 16:82667058-82667080 GAATCAGCTGTTCCTTCTAGAGG + Intronic
1152930762 17:83108487-83108509 GACGAAGCTGTTGCTTCGGGAGG + Intergenic
1158327430 18:56326603-56326625 GAATCATCTGTTCCTTCCCTTGG - Intergenic
1159527978 18:69618284-69618306 GAATCAATTGTTCCTTGTGGAGG + Intronic
1160433380 18:78827646-78827668 GGATCGGCTGTTCCCTGGGGAGG - Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1162627133 19:11893737-11893759 CATTCAGCTGCTCCCTCGGGAGG - Intronic
1162636276 19:11970028-11970050 CATTCAGCTGCTCCCTCGGGAGG - Intronic
1164179188 19:22805389-22805411 GGCTCAGCTCTTCCTTGGGGAGG - Intergenic
1168465524 19:56598266-56598288 GCATCTGCTGTTCCCTCTGGAGG - Intronic
928412892 2:31067955-31067977 GAACCTGCTCTTCCTTCGTGTGG + Intronic
929532468 2:42761669-42761691 GACTGAGCAGCTCCTTCGGGTGG - Intergenic
936271114 2:111049803-111049825 AAAACAACTGTTCCTTGGGGCGG - Intronic
937352587 2:121175583-121175605 GATTCAGCTGCTGCTACGGGAGG - Intergenic
938109762 2:128556006-128556028 GAATCAGCGGCTCCCACGGGAGG + Intergenic
943148582 2:184079153-184079175 AAATCAGTTGTTTCTTAGGGTGG - Intergenic
947211915 2:227716491-227716513 GAAACAGTTGTTCCTTTTGGTGG - Intronic
947527505 2:230887817-230887839 GACTCAGCAGATCCTTCAGGAGG + Intergenic
1175709108 20:61205162-61205184 GAATCTGCTGTTTCATCAGGAGG + Intergenic
1184863347 22:47189327-47189349 GTGTCAGGTGTTCCTTCGCGTGG + Intergenic
950705120 3:14774735-14774757 GAATCAAATGTACCTTAGGGAGG + Intergenic
952148975 3:30565879-30565901 GAATCAGCTGATCCCTCAGTGGG + Intergenic
955639792 3:61069996-61070018 GAATCAGCTGAACCTGCAGGCGG - Intronic
967574735 3:191076886-191076908 GAATCAGCTGTTCCAGCCTGTGG + Intergenic
968483862 4:849450-849472 GAATCAGCTGTTCCTTCGGGAGG + Exonic
969131618 4:4994769-4994791 GACTCAGCTTTTCCTCCAGGTGG + Intergenic
978134232 4:105237216-105237238 GAAGCAGCTGTTCTTTTGGTTGG - Exonic
978527763 4:109682709-109682731 GCTGCAGCTGTTCCTTCAGGTGG - Exonic
981566928 4:146111687-146111709 GAATCAGATCTGCCTTCTGGCGG - Intergenic
981784295 4:148460599-148460621 GAATCTGATGTTCCTTCAGTTGG - Intergenic
994042613 5:95275377-95275399 GAAGCAGCTGCTCCTTCCAGAGG + Intronic
995556337 5:113332846-113332868 GAATCAGCTGATATTTCAGGAGG - Intronic
997766640 5:136511374-136511396 CAATCTGCTGTTACTTGGGGTGG + Intergenic
1006665661 6:35691217-35691239 GAATCAGCTCTTCCTACGAGAGG + Intronic
1009953164 6:70419715-70419737 GAATCTGCTGTTCCTTCATTTGG + Intronic
1012146192 6:95686047-95686069 GAGTCAGCTCTTCCTCCTGGAGG + Intergenic
1015549458 6:134396943-134396965 GATTGAGCTGCTCCTTCTGGGGG + Intergenic
1016977098 6:149820034-149820056 CAATCAGATGTTACTTAGGGTGG - Exonic
1019420615 7:949069-949091 GCATCTGCTGTTCCTTGGTGGGG - Intronic
1032738285 7:134712811-134712833 GAATCAGGCGTGCCTTCGAGTGG + Intergenic
1045346431 8:101297873-101297895 GTGTCAGCAGTTCCTTCTGGAGG - Intergenic
1050495746 9:6239879-6239901 GGAGCAGCTGTTCCTTTCGGTGG + Intronic
1050707167 9:8414738-8414760 GAACCAGCTCTACCTTGGGGTGG - Intronic
1055172016 9:73270237-73270259 GAATCATTTTTTCCTTTGGGTGG - Intergenic
1192439210 X:71162473-71162495 AAATCAGCTTTTCCTTTGCGTGG - Intronic
1198231486 X:134693802-134693824 GAATCTGATGTTCCTTCAGATGG + Intronic
1199606168 X:149581362-149581384 GAAACTGCAGTTCCTTCTGGGGG - Intergenic
1199632953 X:149788006-149788028 GAAACTGCAGTTCCTTCTGGGGG + Intergenic
1200018714 X:153184133-153184155 GAAACTGCAGTTCCTTCTGGGGG + Intergenic