ID: 968486412

View in Genome Browser
Species Human (GRCh38)
Location 4:865144-865166
Sequence CACTGCCGATGCTGCAGTCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968486402_968486412 21 Left 968486402 4:865100-865122 CCTTGGTGGGTGGTGGCCATACC 0: 1
1: 0
2: 0
3: 17
4: 134
Right 968486412 4:865144-865166 CACTGCCGATGCTGCAGTCTCGG 0: 1
1: 0
2: 0
3: 5
4: 104
968486410_968486412 0 Left 968486410 4:865121-865143 CCTTCTGTGGCTGGCGTGGGGGC 0: 1
1: 0
2: 0
3: 29
4: 281
Right 968486412 4:865144-865166 CACTGCCGATGCTGCAGTCTCGG 0: 1
1: 0
2: 0
3: 5
4: 104
968486401_968486412 26 Left 968486401 4:865095-865117 CCTGTCCTTGGTGGGTGGTGGCC 0: 1
1: 0
2: 1
3: 26
4: 203
Right 968486412 4:865144-865166 CACTGCCGATGCTGCAGTCTCGG 0: 1
1: 0
2: 0
3: 5
4: 104
968486400_968486412 27 Left 968486400 4:865094-865116 CCCTGTCCTTGGTGGGTGGTGGC 0: 1
1: 1
2: 4
3: 24
4: 218
Right 968486412 4:865144-865166 CACTGCCGATGCTGCAGTCTCGG 0: 1
1: 0
2: 0
3: 5
4: 104
968486405_968486412 5 Left 968486405 4:865116-865138 CCATACCTTCTGTGGCTGGCGTG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 968486412 4:865144-865166 CACTGCCGATGCTGCAGTCTCGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968486412 Original CRISPR CACTGCCGATGCTGCAGTCT CGG Exonic
903298734 1:22363082-22363104 CACTGCTGATGCTGGAAGCTGGG - Intergenic
904977321 1:34466822-34466844 CTCTGTTGATGCTGCAGTGTGGG + Intergenic
915300817 1:154950646-154950668 CTTTGCTGATGCTGCAGCCTTGG + Intronic
920153575 1:203929697-203929719 CACTCCTGATGCTGGACTCTTGG - Intergenic
1063477094 10:6339046-6339068 TACTGCCGCTGCTGTAGTTTTGG - Intergenic
1064786627 10:18904742-18904764 CACTGCCCATGCAGTATTCTTGG + Intergenic
1080269535 11:30436404-30436426 AGATGCAGATGCTGCAGTCTTGG + Intronic
1081473248 11:43397404-43397426 CTCTGCTGATGCTGCTGTCGTGG + Exonic
1085515781 11:77111105-77111127 CACTGCGGATGCTGCTGAGTAGG + Intronic
1086275233 11:85119239-85119261 CAAAACCGATTCTGCAGTCTGGG + Intronic
1087844077 11:102951565-102951587 CACTGCCAATGCTGCTTTCTTGG - Intronic
1088243984 11:107798998-107799020 CACTGCCACCCCTGCAGTCTGGG - Intronic
1092709903 12:11324964-11324986 CACTGGGGAAGCTGCAGTCCTGG + Intergenic
1092717372 12:11404643-11404665 CACTGGGGAAGCTGCAGTCTTGG + Intronic
1095584561 12:43836062-43836084 CGCTGCCGCTGCTGCTGTCACGG - Intronic
1097230639 12:57508264-57508286 CACGGCAGAGGCTGCAATCTCGG + Intronic
1100588309 12:95999767-95999789 CACTGACGGTGCTGCAGTCCTGG + Intergenic
1101911087 12:108860544-108860566 CAATGCTGATGCTTCTGTCTGGG + Intronic
1104467439 12:129002337-129002359 CACTGGCAAGGCTGCAGTCAAGG + Intergenic
1105284099 13:18990655-18990677 AGCTGATGATGCTGCAGTCTTGG + Intergenic
1105323585 13:19349890-19349912 CAGTGCAGATGCTACAGTCCTGG + Intergenic
1105825342 13:24117421-24117443 CACTACAGATGATGCAGTTTGGG + Intronic
1108058075 13:46505105-46505127 CACTGCCGCTGCGGGAGTGTGGG + Intergenic
1111316393 13:86566787-86566809 CACTGAATATGCTGGAGTCTTGG + Intergenic
1113954586 13:114090608-114090630 CACAGCCCATGCTCCAGTGTGGG - Intronic
1114551804 14:23537087-23537109 CAGTCCCGATGGTGCAGTCCCGG - Intronic
1115318270 14:32050036-32050058 TAGAGCCCATGCTGCAGTCTAGG - Intergenic
1117444440 14:55790167-55790189 AACTGCCGACGCAGCAGTGTTGG + Intergenic
1120073725 14:80132662-80132684 CACTCCCGATGTGGCAGTGTTGG + Intergenic
1123171544 14:106377572-106377594 CCCTGCAGCTGGTGCAGTCTGGG - Intergenic
1130134899 15:81174309-81174331 CACTGCAGATGTTGCAGGCATGG + Intronic
1133229882 16:4361416-4361438 CACTGCCCACGCTGCAGAATGGG - Exonic
1134387541 16:13787931-13787953 CACTGAAGATGCTGGAGGCTGGG - Intergenic
1135435115 16:22421392-22421414 CACTGGGGATCCTGCAGTCAGGG + Intronic
1138548972 16:57736703-57736725 CACTGCGGCTGCTGCACTTTAGG + Intronic
1138817940 16:60223935-60223957 CACTTCCACTGCTGCAGCCTGGG - Intergenic
1139596100 16:67959262-67959284 CACTTCGGAGGCTGCACTCTTGG - Intronic
1141401476 16:83750783-83750805 ACCTGCAGATGCTTCAGTCTTGG + Intronic
1145242430 17:21247813-21247835 CACTGTGGATCCTGCTGTCTCGG - Intronic
1145242617 17:21248633-21248655 CACTGTGGATCCTGCTGTCTCGG + Intronic
1153818086 18:8808225-8808247 CGCTGCTGATGCTGCAGGCCGGG - Intronic
1157701611 18:49764415-49764437 CACTGCAGATGGGGCAGCCTGGG + Intergenic
1157799415 18:50606877-50606899 CACTGCCGCTGCTGTAATCCTGG + Intronic
1157850135 18:51041075-51041097 CATTGCCCATGCCCCAGTCTAGG + Intronic
1158275038 18:55757965-55757987 CACCCCCGATGCAGGAGTCTGGG + Intergenic
1160723184 19:605903-605925 CAGTGCCGGGGCTGCAGTCCTGG - Intronic
1166897897 19:46035722-46035744 CACTTCCACAGCTGCAGTCTTGG + Intergenic
935296383 2:101653267-101653289 CATTGCCCATGCTGGAGGCTAGG + Intergenic
945199214 2:207264611-207264633 CAGTTCAGAGGCTGCAGTCTGGG + Intergenic
948272361 2:236684330-236684352 ACCTGCAGATGGTGCAGTCTCGG + Intergenic
1172587509 20:36094838-36094860 CACTGCCTACACTCCAGTCTCGG - Intronic
1172716876 20:36970879-36970901 CACTGCACATGCAGCAGTCAAGG - Intergenic
1177883393 21:26720077-26720099 CACTGCCCAGGCTGCAGTTCAGG - Intergenic
1181668406 22:24413901-24413923 CACTGCTGCTGCTGAAGGCTCGG - Intronic
1182801922 22:33038624-33038646 CACTGGGGATGGGGCAGTCTTGG - Intronic
1183280386 22:36929084-36929106 CACTGCCCACGCTGCGGCCTGGG - Intronic
1183646051 22:39127328-39127350 CACTGAGGATGGTGGAGTCTGGG + Intronic
1185075512 22:48680075-48680097 CACTGCAGCTGCTGCAGCCCCGG + Intronic
1185407012 22:50658194-50658216 CACTGGGGATACAGCAGTCTTGG - Intergenic
952517687 3:34122330-34122352 CACTGCTAGTGCAGCAGTCTCGG - Intergenic
953641610 3:44712908-44712930 CAGTGCTGAGGCTGCAGGCTGGG - Intronic
954222238 3:49161913-49161935 CACTGCTGATGAGGCAGTCATGG + Intergenic
955523407 3:59796750-59796772 CACTGAGAATACTGCAGTCTTGG - Intronic
957032263 3:75255395-75255417 CAATGCGGATGCTGCAGCCAGGG - Intergenic
957569075 3:81922908-81922930 CACTGCAGATGCCACACTCTTGG + Intergenic
957918837 3:86722294-86722316 CTATGCTGATGCTGCTGTCTGGG - Intergenic
958960854 3:100508275-100508297 CGCTGCAGTTGCTTCAGTCTTGG - Intronic
968486412 4:865144-865166 CACTGCCGATGCTGCAGTCTCGG + Exonic
968525858 4:1056843-1056865 CACTGCCTCTGCAGCAGGCTGGG + Intronic
968873117 4:3251418-3251440 CACTCCAGACCCTGCAGTCTGGG + Intronic
969418100 4:7074156-7074178 CACTGCAGATGCTGCAGGCGGGG - Intergenic
969877514 4:10146750-10146772 CAGTGCCACTGGTGCAGTCTCGG - Intergenic
970488459 4:16547605-16547627 AGCTGCCAATGCTGCAGACTGGG + Intronic
973616872 4:52687792-52687814 CACTGCAAAAGCTGCAGTTTGGG + Intergenic
979874528 4:125871485-125871507 TACTGGCAATGCTGAAGTCTAGG - Intergenic
981454070 4:144933533-144933555 CCCTGCAGAAGCTGCAGTGTTGG + Intergenic
984806148 4:183753797-183753819 CAATGCCGATGCTGCAGCTCTGG + Intergenic
988951855 5:36270530-36270552 CACTGCTGGTACTGCAGCCTGGG - Intronic
990504765 5:56433422-56433444 CACTGGGGAGGCTGGAGTCTGGG - Intergenic
992219449 5:74557418-74557440 CACTGCTGATGCTGGAGGATGGG + Intergenic
1000922041 5:167149764-167149786 AAATGAGGATGCTGCAGTCTGGG - Intergenic
1003236040 6:4295844-4295866 CAAAGCTGATGCTGCAGTCCAGG - Intergenic
1005959252 6:30684521-30684543 CACAGTTGATGCTGCAGTCCCGG - Exonic
1006180693 6:32151875-32151897 CTCGGCCGGTGCTGGAGTCTGGG + Exonic
1008617138 6:53237357-53237379 CACTGGCGAGGCACCAGTCTTGG - Intergenic
1012102281 6:95105052-95105074 CACTGCCAAGGCTGCAGGCAAGG - Intergenic
1015754573 6:136594609-136594631 CACTGCTGATCCTTCAGACTTGG + Intronic
1018344679 6:162888252-162888274 CACTTCCCATCCTGGAGTCTTGG + Intronic
1023568947 7:41552896-41552918 CACTGCTAGTGCAGCAGTCTGGG - Intergenic
1027627495 7:80563980-80564002 CACAGGGGAAGCTGCAGTCTGGG + Intronic
1034450605 7:151135252-151135274 CACTGGGGATACTGAAGTCTTGG - Intronic
1035340247 7:158156122-158156144 AAGTGCCCATGCTGCAGCCTGGG + Intronic
1035623017 8:1048754-1048776 TGCCGCCGAAGCTGCAGTCTTGG + Intergenic
1038413327 8:27375177-27375199 AACTCCCTATGCTGCAGCCTTGG - Intronic
1039839687 8:41284853-41284875 CAAGGCCGATGCTCCAGTCCAGG + Intronic
1041106982 8:54453922-54453944 CCCTGCAGATGCTGCAGTGCGGG - Intergenic
1045049872 8:98313586-98313608 CAGAGCTGATGTTGCAGTCTTGG - Intergenic
1045654572 8:104373684-104373706 CACTTCCCATGATGCAGTGTGGG - Intronic
1050673382 9:8023885-8023907 CACTGTCAATTCTGCAGTCCAGG + Intergenic
1052760833 9:32589535-32589557 CACTGCTGATTCTGCACTTTGGG - Intergenic
1052966885 9:34347079-34347101 CTCTGCCGATGCTGCACTTTGGG + Intergenic
1053382714 9:37661911-37661933 CCCTCCCGAAGCTGCATTCTTGG - Intronic
1055934233 9:81590039-81590061 CCCTGCGGATGGTGCAGTTTGGG - Intronic
1061593743 9:131615397-131615419 CCCTGCCGGTGCTGCAGGGTTGG - Intronic
1187527482 X:20067163-20067185 TACTGCCCATGCTGCCCTCTAGG + Intronic
1189016523 X:37290747-37290769 CATTGGTGATGCTGGAGTCTGGG - Intergenic
1194217376 X:91147816-91147838 CACTGCCACTGCTGCTGTCATGG - Intergenic
1195321643 X:103726059-103726081 CACTGCCGCTGCCGCACTGTGGG + Intronic
1197481100 X:126986924-126986946 CACAGCCCATGCTGAATTCTGGG - Intergenic
1200553890 Y:4611608-4611630 CACTGCCACTGCTGCTGTCATGG - Intergenic