ID: 968486501

View in Genome Browser
Species Human (GRCh38)
Location 4:865585-865607
Sequence GAGCCCGAGGTGGCTCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 5, 3: 9, 4: 133}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968486486_968486501 23 Left 968486486 4:865539-865561 CCGCCATCCCCACAGCCTGCGTT 0: 1
1: 1
2: 2
3: 30
4: 385
Right 968486501 4:865585-865607 GAGCCCGAGGTGGCTCCACCTGG 0: 1
1: 0
2: 5
3: 9
4: 133
968486487_968486501 20 Left 968486487 4:865542-865564 CCATCCCCACAGCCTGCGTTCCC 0: 1
1: 0
2: 4
3: 58
4: 468
Right 968486501 4:865585-865607 GAGCCCGAGGTGGCTCCACCTGG 0: 1
1: 0
2: 5
3: 9
4: 133
968486491_968486501 8 Left 968486491 4:865554-865576 CCTGCGTTCCCGCCTCTCCTAAA 0: 1
1: 0
2: 0
3: 8
4: 90
Right 968486501 4:865585-865607 GAGCCCGAGGTGGCTCCACCTGG 0: 1
1: 0
2: 5
3: 9
4: 133
968486492_968486501 0 Left 968486492 4:865562-865584 CCCGCCTCTCCTAAAACCCACCA 0: 1
1: 0
2: 1
3: 29
4: 619
Right 968486501 4:865585-865607 GAGCCCGAGGTGGCTCCACCTGG 0: 1
1: 0
2: 5
3: 9
4: 133
968486495_968486501 -9 Left 968486495 4:865571-865593 CCTAAAACCCACCAGAGCCCGAG 0: 1
1: 0
2: 1
3: 12
4: 110
Right 968486501 4:865585-865607 GAGCCCGAGGTGGCTCCACCTGG 0: 1
1: 0
2: 5
3: 9
4: 133
968486488_968486501 16 Left 968486488 4:865546-865568 CCCCACAGCCTGCGTTCCCGCCT 0: 1
1: 0
2: 1
3: 18
4: 225
Right 968486501 4:865585-865607 GAGCCCGAGGTGGCTCCACCTGG 0: 1
1: 0
2: 5
3: 9
4: 133
968486493_968486501 -1 Left 968486493 4:865563-865585 CCGCCTCTCCTAAAACCCACCAG 0: 1
1: 0
2: 4
3: 28
4: 252
Right 968486501 4:865585-865607 GAGCCCGAGGTGGCTCCACCTGG 0: 1
1: 0
2: 5
3: 9
4: 133
968486494_968486501 -4 Left 968486494 4:865566-865588 CCTCTCCTAAAACCCACCAGAGC 0: 1
1: 0
2: 1
3: 18
4: 169
Right 968486501 4:865585-865607 GAGCCCGAGGTGGCTCCACCTGG 0: 1
1: 0
2: 5
3: 9
4: 133
968486489_968486501 15 Left 968486489 4:865547-865569 CCCACAGCCTGCGTTCCCGCCTC 0: 1
1: 0
2: 2
3: 15
4: 194
Right 968486501 4:865585-865607 GAGCCCGAGGTGGCTCCACCTGG 0: 1
1: 0
2: 5
3: 9
4: 133
968486490_968486501 14 Left 968486490 4:865548-865570 CCACAGCCTGCGTTCCCGCCTCT 0: 1
1: 0
2: 3
3: 25
4: 292
Right 968486501 4:865585-865607 GAGCCCGAGGTGGCTCCACCTGG 0: 1
1: 0
2: 5
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968486501 Original CRISPR GAGCCCGAGGTGGCTCCACC TGG Intronic
900425476 1:2576463-2576485 GTTCCCGGCGTGGCTCCACCAGG + Intergenic
901302718 1:8211253-8211275 GCACCCGAGGCTGCTCCACCTGG - Intergenic
903364121 1:22795346-22795368 GAGTCGGAGGTGGCTCGCCCAGG + Intronic
904688294 1:32275741-32275763 GAGCCCGAGGTGGAGACACGGGG + Intronic
906542281 1:46596507-46596529 CAGCCTAAGGTGGCTCCACGTGG - Intronic
909933627 1:81526941-81526963 TAGCCAGAGGTGGCTCCAAACGG - Intronic
1067553075 10:47248646-47248668 GAGCAGCTGGTGGCTCCACCAGG - Intergenic
1069546776 10:69334669-69334691 GAGCCCTAGGAGGCACCACGTGG - Intronic
1075630049 10:123995294-123995316 GCCCACGAGGTGACTCCACCAGG - Intergenic
1076070411 10:127484177-127484199 GAGCCCAAGTTTGCTCCACATGG + Intergenic
1076618362 10:131771411-131771433 TAGCCCCAGGTGGCTCCACCAGG + Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077545988 11:3170217-3170239 GAGGCTGAGGTGGCTCCAGGGGG + Intergenic
1080551293 11:33376017-33376039 GAGCGCGCGGTGGCTCCGCGCGG + Intergenic
1082767103 11:57179135-57179157 GAGCCCCAGGTGCCCCCACCTGG + Intergenic
1084154641 11:67306843-67306865 GAGGCCGGGGTGCCTCCAGCTGG - Exonic
1084978081 11:72814247-72814269 GACCCGGAGGCGGCTCCTCCCGG + Intergenic
1085507129 11:77066994-77067016 GAGCCCGAGGCTGCTGCGCCGGG + Exonic
1088821458 11:113460864-113460886 GAGGCCTTGGAGGCTCCACCTGG - Intronic
1089195776 11:116693306-116693328 GAGCCCACAGTGGCTCCTCCAGG - Intergenic
1089522850 11:119077125-119077147 GAGCATGAGGTGGCTCCACCGGG + Intronic
1089622005 11:119727782-119727804 AAGCCCGCGGTGTCTCCTCCAGG + Intronic
1091844644 12:3646475-3646497 GGGCCTGAGGTGTCACCACCTGG + Intronic
1096469957 12:51869544-51869566 GAGAAGGAGGTGTCTCCACCGGG - Intergenic
1096792001 12:54051311-54051333 TAGTCCCAGATGGCTCCACCGGG - Intronic
1100405512 12:94269462-94269484 GAGCCCTAGGTGTCTCCACCAGG + Intronic
1103944656 12:124519326-124519348 GAGGCAGAGGAGGCTCCACCAGG + Intronic
1104797438 12:131529375-131529397 GGGCCAGAAGTGGCTGCACCCGG - Intergenic
1106363277 13:29051830-29051852 AAGCCTGAGGTGGCTACACTTGG - Intronic
1113426076 13:110209637-110209659 GTGCCCCAGGTGACTTCACCAGG - Intronic
1119460551 14:74798849-74798871 GAGCCCTAGGAGGCTCATCCCGG - Exonic
1202872605 14_GL000225v1_random:177808-177830 GACCCCCAGGTGGCTACAACAGG - Intergenic
1124868292 15:33515574-33515596 GAGGCCTAGGTAGCTCCACTTGG - Intronic
1127689778 15:61384176-61384198 AAGGCCCATGTGGCTCCACCTGG - Intergenic
1128143007 15:65315524-65315546 GAGCCTGAAGTGGCTCTAGCTGG + Intergenic
1128944991 15:71813861-71813883 GAGCCCCTGGTGGCTCCTCTGGG + Intronic
1130666104 15:85871467-85871489 GAGGCCGAGGTGGGATCACCTGG - Intergenic
1131380752 15:91962056-91962078 GAGCCTGAGATGGCTGCATCAGG - Intronic
1131488237 15:92839958-92839980 GAGCCCCAGGCAGCTGCACCTGG + Intergenic
1132184335 15:99791041-99791063 GAGCCCGAGGAGGCACAACTAGG - Intergenic
1132584561 16:700626-700648 GCGCCCGAGGCGGCAGCACCAGG + Intronic
1132649690 16:1014829-1014851 GGGCTGGAGGTGGCTCCTCCTGG + Intergenic
1132851624 16:2027296-2027318 GGGCCCGAGGGGGCTCCCGCGGG + Intronic
1132982522 16:2745738-2745760 GTGCCCGAGGTGCCTAAACCAGG - Intergenic
1132997097 16:2829092-2829114 GAGCCAGACGTGGGTCCAGCCGG - Intergenic
1135521651 16:23182721-23182743 GAGCCCGCGGTGGCGCTGCCAGG + Exonic
1137502536 16:49022739-49022761 GAGCCGGCGGTGACTCAACCTGG + Intergenic
1139546689 16:67653042-67653064 GAGCCCGAGCTGGCGGCTCCGGG + Exonic
1142146291 16:88494265-88494287 GAGCGCAAGGTGGCTGCTCCCGG - Intronic
1142224766 16:88872031-88872053 GAGCTCCAGGTGGCCCCAACTGG + Intergenic
1148587285 17:48790164-48790186 GAGGCCGAGGTGCCACCTCCAGG + Intronic
1148641687 17:49192644-49192666 CAGCCCGAGGTGGCTGCTGCCGG - Intergenic
1148876040 17:50687761-50687783 ATGCCCCAGGTGGCCCCACCAGG - Intronic
1150600329 17:66645631-66645653 GAGACAGTGATGGCTCCACCAGG - Intronic
1153952324 18:10067825-10067847 GAGCCCCTGGTGACTCCACTAGG + Intergenic
1157625130 18:49044803-49044825 GAGCCCGAGGCTGCTCCTCATGG + Intronic
1159921567 18:74231593-74231615 GGGCCAGAGGTGGCTTCACCTGG - Intergenic
1160237776 18:77099574-77099596 GAGCCCCAGGTGGCACAGCCGGG - Intronic
1160827301 19:1086519-1086541 GAGCCCCAGGTGGCCACACCTGG - Exonic
1161236007 19:3198630-3198652 GAGCCCCAGGGAGCTCCTCCAGG - Intronic
1161427288 19:4210486-4210508 GAGGCCCAGGTGGCTGCAGCAGG - Intronic
1162575663 19:11497452-11497474 GAGCCCCAGGTGCCTCCTCTAGG + Intronic
1163136341 19:15314070-15314092 GTGCCAGTGGTGGGTCCACCTGG - Intronic
1167661222 19:50797056-50797078 GAGGCCTGGGTGGCTCCCCCTGG + Intergenic
925148396 2:1598479-1598501 GAGCACGCGGAGGCTGCACCAGG + Intergenic
926162158 2:10496613-10496635 GAGCCCCAGGAGGCTCAAACAGG - Intergenic
926350243 2:11987435-11987457 GAGCCTGTGGTGGTTCCACGTGG + Intergenic
927812562 2:26188010-26188032 GAGTCCGAGATGCCTCCTCCTGG + Exonic
928593569 2:32840271-32840293 GGGCCCCAGGTGAGTCCACCCGG + Intergenic
929155544 2:38785599-38785621 GAGGCCGAGGTGGGTCGATCAGG - Intergenic
929945577 2:46369309-46369331 GAGACAAAGGTGGCTCTACCTGG + Intronic
930780037 2:55215680-55215702 CAGCCCAAGATCGCTCCACCTGG - Intronic
934079188 2:88452727-88452749 GAGCCCGGCGCGGCTCCTCCTGG + Intergenic
934576835 2:95407228-95407250 GAGCGAGAGGTGGCTCCAGTAGG - Intronic
934619929 2:95797714-95797736 GAGCCCCAGGAGGTTCCTCCAGG - Intergenic
934639055 2:96015396-96015418 GAGCGAGAGGTGGCTCCAGTAGG - Intergenic
934640959 2:96026843-96026865 GAGCCCCAGGAGGTTCCTCCAGG + Exonic
934794593 2:97090016-97090038 GAGCGAGAGGTGGCTCCAGTAGG + Intronic
938940176 2:136162885-136162907 GAGCCAGAGATGGCTCAAACTGG - Intergenic
939112104 2:138020566-138020588 GAGCCCAGTGTGGCTCCAGCTGG + Intergenic
1173310137 20:41889979-41890001 GAGCCCGTGGTGACTGCTCCTGG - Intergenic
1174393309 20:50231485-50231507 GACCCAGAGGTTGCTCCAGCTGG + Intergenic
1175151597 20:56939387-56939409 GAGCCCGAGGTGGGTGGATCAGG + Intergenic
1175470765 20:59225896-59225918 GAGCCCAGGGTAGCTCCAGCTGG + Intronic
1175876181 20:62231257-62231279 GAGCCCCAGATGTTTCCACCAGG - Intergenic
1175928964 20:62484644-62484666 GAGCACGGAGTGGCTCCCCCAGG - Intergenic
1176217937 20:63957048-63957070 GGGCCCCAGGCGGCTCCCCCAGG - Exonic
1176260715 20:64178057-64178079 GATCCTGAGGTGCCTCCTCCGGG - Intronic
1178707774 21:34889244-34889266 GAGCGCGGAGTGGCTCCCCCGGG - Intronic
1184045229 22:41969032-41969054 GAGCCCCAGCTTGCTCCAGCTGG - Intergenic
1184228108 22:43142289-43142311 GAGGCCGAGGTGGGTGAACCTGG + Intronic
950831301 3:15878586-15878608 GAGCTGGTGGTGGCTCCAGCAGG + Intergenic
952301375 3:32106911-32106933 GCGCCCGAGGAGGCCGCACCGGG + Intronic
953061975 3:39434923-39434945 GATCCAGAGGAGGCACCACCAGG - Intergenic
954036276 3:47852829-47852851 GAGCCCGAGTTGGGGCCGCCAGG + Exonic
954861429 3:53694215-53694237 CAGCCCGTGGGGGCTCCACTGGG + Intronic
961360689 3:126365321-126365343 CATCCTGAGCTGGCTCCACCAGG - Intergenic
968486501 4:865585-865607 GAGCCCGAGGTGGCTCCACCTGG + Intronic
968810773 4:2798825-2798847 GTGGCTCAGGTGGCTCCACCAGG + Intronic
968878283 4:3285704-3285726 GAGCTCGAGGTGGTGCCTCCCGG + Intergenic
970603924 4:17661774-17661796 GAGTGAGAGGTGGCACCACCAGG + Intronic
971652976 4:29303722-29303744 GGGCCCAGGATGGCTCCACCTGG + Intergenic
977726519 4:100302707-100302729 GTTCCCGAGGTTGCTCGACCCGG - Intergenic
985795823 5:1961605-1961627 GACCAGGACGTGGCTCCACCTGG - Intergenic
985889529 5:2705078-2705100 GATGCCAAGGTGGCTCCTCCTGG + Intergenic
991620868 5:68544272-68544294 GAGGCCGGGGTGGTTCCAACAGG + Intergenic
997614590 5:135237656-135237678 GAGACCCAGCTGGCTCCACAGGG - Intronic
999431887 5:151531697-151531719 GTGCCCGAGGACGCCCCACCTGG - Exonic
1001452024 5:171834037-171834059 CAGCCCAAGGTGACGCCACCAGG - Intergenic
1001639507 5:173234890-173234912 GGGCCCGAGGCGGCTGCGCCGGG - Exonic
1004732108 6:18368065-18368087 GAGCTGGTGGTGGCTCCAGCAGG - Intergenic
1011162180 6:84403724-84403746 AAGCCCCAGCTGGCTCCACCTGG + Intergenic
1019143585 6:169962874-169962896 GAGCCCGAGGTGGCTGCAGCAGG - Intergenic
1019485128 7:1285816-1285838 GGGGCAGAGGTGGCTGCACCTGG - Intergenic
1019516633 7:1443026-1443048 GAGCCTGAGGTGGGGGCACCAGG + Intronic
1019938542 7:4271721-4271743 GAGCCTGTGGGGGCTCCCCCAGG - Intergenic
1020099190 7:5385050-5385072 CGGTCCAAGGTGGCTCCACCGGG + Intronic
1023758856 7:43445027-43445049 GAGCCCGAGGGGGCTACTCCAGG + Exonic
1026135530 7:67657377-67657399 GAGGCCGAGGTGGGTGCATCAGG + Intergenic
1026801835 7:73405047-73405069 GAGACTGCGGAGGCTCCACCTGG - Intergenic
1031087775 7:117320763-117320785 GAGCTACAGGTGGCTCCTCCAGG - Exonic
1033097047 7:138441249-138441271 GAGCTGGTGGTGGCTCCAGCAGG + Intergenic
1034260068 7:149749672-149749694 GGGCCCCAGTTGGCTCCCCCAGG - Intergenic
1035303695 7:157916412-157916434 GAGCTTGAGGTGGCTCCTCATGG + Intronic
1035317983 7:158009104-158009126 GAGCCCCAGGAGGCCCCACCTGG + Intronic
1038136543 8:24792176-24792198 GATCCAGAGGTGGCTACACTTGG - Intergenic
1038554081 8:28494407-28494429 GAGCCCGAGGAGGCGCCGCGCGG + Intronic
1039964201 8:42271785-42271807 GATCCCCAGCTGACTCCACCAGG - Intronic
1040322931 8:46327583-46327605 GAGCCAGTGCTGGCTCCTCCTGG - Intergenic
1047275313 8:123401125-123401147 GAGCTGGTGGTGGCTCCAGCAGG + Intronic
1048070270 8:131013430-131013452 GAGCTTGAAGTGGCTCAACCCGG - Intronic
1049800063 8:144513524-144513546 GTGCCCAAGGTGGGTCCACGGGG + Intronic
1055359914 9:75478568-75478590 GAGCTCGAGATGGGGCCACCAGG - Intergenic
1055463028 9:76537227-76537249 GAGCCTCAGGAGGCTCCTCCAGG + Intergenic
1057063499 9:92026581-92026603 GGGCCCCAGGCGGCTCCCCCAGG + Intergenic
1058112019 9:101041111-101041133 GAGGCAGAGGTGTCTCAACCTGG + Intronic
1058526825 9:105867367-105867389 GAGCCTGAGGTACCTCCTCCAGG - Intergenic
1060431548 9:123555181-123555203 GAGCCCCGGGTGGCTCCACCAGG - Intronic
1061492816 9:130955729-130955751 GACCCTGAGGTGGCTACACAAGG - Intergenic
1061824434 9:133248941-133248963 GAGGCCAAGGTGGCACCACTGGG + Intergenic
1061828319 9:133275245-133275267 GAGCCCGAGGCGCCCCCTCCCGG + Intergenic
1061957440 9:133971054-133971076 GAGCCCGCGGTGCCTCCTGCGGG + Intronic
1062398286 9:136361434-136361456 GAGGCCCAGGTGGCTCCCCCGGG + Intronic
1186352576 X:8755298-8755320 AAGCCCAAGGTGGCACCACCTGG - Intergenic
1186480721 X:9894767-9894789 GAGCCCAAGCTGGCTGCCCCTGG + Exonic
1188772544 X:34171369-34171391 AAGCCCAAGGTGACTCCAGCAGG - Intergenic
1189362018 X:40360156-40360178 GAGCTAGTGGTGGCTCCAGCAGG - Intergenic
1189659213 X:43279076-43279098 GAGCTGGTGGTGGCTCCAGCAGG - Intergenic