ID: 968487076

View in Genome Browser
Species Human (GRCh38)
Location 4:867896-867918
Sequence GCCTGTGGCTCTCTCCGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 254}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968487070_968487076 2 Left 968487070 4:867871-867893 CCTCCAGCCTCTGCCTCAAGGGT 0: 1
1: 0
2: 14
3: 248
4: 3088
Right 968487076 4:867896-867918 GCCTGTGGCTCTCTCCGCCTGGG 0: 1
1: 1
2: 0
3: 22
4: 254
968487065_968487076 14 Left 968487065 4:867859-867881 CCAGCACACCCACCTCCAGCCTC 0: 1
1: 0
2: 17
3: 145
4: 1159
Right 968487076 4:867896-867918 GCCTGTGGCTCTCTCCGCCTGGG 0: 1
1: 1
2: 0
3: 22
4: 254
968487071_968487076 -1 Left 968487071 4:867874-867896 CCAGCCTCTGCCTCAAGGGTCTG 0: 1
1: 0
2: 2
3: 44
4: 531
Right 968487076 4:867896-867918 GCCTGTGGCTCTCTCCGCCTGGG 0: 1
1: 1
2: 0
3: 22
4: 254
968487067_968487076 5 Left 968487067 4:867868-867890 CCACCTCCAGCCTCTGCCTCAAG 0: 1
1: 1
2: 0
3: 83
4: 988
Right 968487076 4:867896-867918 GCCTGTGGCTCTCTCCGCCTGGG 0: 1
1: 1
2: 0
3: 22
4: 254
968487066_968487076 6 Left 968487066 4:867867-867889 CCCACCTCCAGCCTCTGCCTCAA 0: 1
1: 0
2: 4
3: 107
4: 1075
Right 968487076 4:867896-867918 GCCTGTGGCTCTCTCCGCCTGGG 0: 1
1: 1
2: 0
3: 22
4: 254
968487064_968487076 26 Left 968487064 4:867847-867869 CCTGAGGCGTCTCCAGCACACCC 0: 1
1: 0
2: 0
3: 9
4: 184
Right 968487076 4:867896-867918 GCCTGTGGCTCTCTCCGCCTGGG 0: 1
1: 1
2: 0
3: 22
4: 254
968487072_968487076 -5 Left 968487072 4:867878-867900 CCTCTGCCTCAAGGGTCTGCCTG 0: 1
1: 0
2: 3
3: 37
4: 461
Right 968487076 4:867896-867918 GCCTGTGGCTCTCTCCGCCTGGG 0: 1
1: 1
2: 0
3: 22
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968487076 Original CRISPR GCCTGTGGCTCTCTCCGCCT GGG Intronic
900119817 1:1043766-1043788 TCCTGTGCCTCCCTCAGCCTGGG + Intronic
900168138 1:1252900-1252922 TCCTCTCTCTCTCTCCGCCTCGG + Intergenic
900245948 1:1636126-1636148 GCCTCTGGCCCTCTCCCCCCAGG - Exonic
900257173 1:1703269-1703291 GCCTCTGGCCCTCTCCCCCCAGG - Exonic
900392762 1:2440901-2440923 GGCTGTGGGTCTTTCCTCCTGGG + Intronic
901271308 1:7954081-7954103 GCGTGTGGGTCTCTGCGCCCTGG - Intergenic
901911276 1:12460357-12460379 GGCTGTGTCTCTCACCGCCTGGG - Exonic
903064134 1:20689062-20689084 GCCTGGATCTCTCTCAGCCTTGG + Intronic
903367271 1:22812654-22812676 GCCTCAGGCTCTCTGAGCCTCGG + Intronic
905770391 1:40634290-40634312 GCCTGTGTCTCTCCCTGACTAGG + Intronic
906060375 1:42944498-42944520 GGCTGTGGGTCTCTGGGCCTTGG + Intronic
907295000 1:53445147-53445169 TCCTCTCTCTCTCTCCGCCTCGG + Intergenic
907336836 1:53705224-53705246 GCAGGTGGCTCTCTCCTCCCAGG - Intronic
907435343 1:54442355-54442377 GCCTGTGCCTCTGTCCCCCCAGG + Intergenic
911176907 1:94826416-94826438 CCCTGTGGATCTGCCCGCCTTGG - Intronic
913598036 1:120396331-120396353 GCCTGTGGCTCTCCCTGGCCAGG - Intergenic
914089293 1:144482989-144483011 GCCTGTGGCTCTCCCTGGCCAGG + Intergenic
914309318 1:146451226-146451248 GCCTGTGGCTCTCCCTGGCCAGG - Intergenic
914592793 1:149121911-149121933 GCCTGTGGCTCTCCCTGGCCAGG + Intergenic
916587841 1:166164329-166164351 GCCTGTGGCTTTCTCTGACTTGG + Intronic
916725338 1:167517853-167517875 GCCTGTGCCCCTCTCCTCCTTGG + Intronic
918750707 1:188266112-188266134 GCCTATGGTTCTCTCAGCCATGG + Intergenic
920609224 1:207421463-207421485 GCCTATGTCTCCCTCGGCCTAGG - Intergenic
920726982 1:208445557-208445579 GTCTGTGGGTCTCTCAGCCTTGG + Intergenic
921051563 1:211515288-211515310 GCCTGAGTCTCTCCCCGTCTGGG + Intergenic
924582748 1:245335909-245335931 GCATGGGGCTCTCCCCGCGTGGG - Intronic
1063982394 10:11464691-11464713 GCCTGTGGCTGTCTCAGGCCAGG - Intronic
1066437820 10:35410117-35410139 GTCTCTGGCTCCCTCCTCCTGGG - Intronic
1067535006 10:47102656-47102678 GCCTGAGACTCTCTCTGCCCTGG + Intergenic
1069112949 10:64468947-64468969 GTCTGTGGGTCTCTCAGCCATGG - Intergenic
1069242652 10:66162560-66162582 GCCTATGGTTCTCTCAGCCGTGG + Intronic
1069736758 10:70661658-70661680 GCAAGTGGCTGTCTCCTCCTGGG + Intergenic
1071333746 10:84585344-84585366 GCCTTTGGCTCTGTGCTCCTTGG - Intergenic
1072636540 10:97181999-97182021 GGCTGGGTCTCTCTGCGCCTGGG + Intronic
1074365189 10:112852338-112852360 GCCTGTGGCTTTCTCAACGTGGG - Intergenic
1074436637 10:113439986-113440008 GGCTGTGGGTCTCACCCCCTTGG - Intergenic
1075671063 10:124264461-124264483 GCCTGGGGCTGTCTCTGCCCTGG + Intergenic
1075946858 10:126440677-126440699 GTCTGTGGGTCTCTCAGCCATGG - Intronic
1077241863 11:1514891-1514913 CCCTGTGGCTCTCCCCGTCGGGG - Intergenic
1077384100 11:2260946-2260968 GCCTGTGGCTTTCTCTGGCGTGG - Intergenic
1077386813 11:2273139-2273161 ACCTGTGTCTCTCCCTGCCTCGG + Intergenic
1079273654 11:19013242-19013264 ATCTGTGGGTCTCTCAGCCTTGG + Intergenic
1083309072 11:61775340-61775362 CCCTGTGGCTCCCTTTGCCTTGG + Intronic
1083726099 11:64629176-64629198 GCCTGGCTATCTCTCCGCCTGGG + Intronic
1084274469 11:68044419-68044441 GCCTCTGGCTCCCTGCACCTGGG + Intronic
1086264654 11:84983277-84983299 GTCTGTGGGTCTCTCAGCCATGG - Intronic
1086946088 11:92845263-92845285 GCCAATGGCTCTCACTGCCTTGG - Intronic
1086965342 11:93021434-93021456 GCCTGTGCCTCTGTCAGCATTGG + Intergenic
1088239590 11:107759337-107759359 GTCTATGGCTCTCTCAGCCGTGG - Intergenic
1088577749 11:111287967-111287989 GCGTGGGGCTCTCTGCTCCTGGG + Intergenic
1089070139 11:115693357-115693379 CCCTGTGGTTGTCTCCTCCTGGG - Intergenic
1091319690 11:134640765-134640787 CCCTGTGACCCTCTCCTCCTGGG - Intergenic
1092303825 12:7279408-7279430 GTCTGTGGCTCTCTCAGCTGTGG + Intergenic
1093057296 12:14567885-14567907 GCCTGGGGCCCACCCCGCCTAGG + Exonic
1093389657 12:18602660-18602682 GTCTGTGGGTCTCTCAGCCATGG - Intronic
1096085933 12:48865166-48865188 GCCTGTGGCTCTCTCAAATTGGG - Intronic
1101839312 12:108316531-108316553 GCCTCTGGGTCTCTCTTCCTGGG - Intronic
1102236763 12:111298619-111298641 GCCAGAGGCTCCCTCTGCCTGGG + Intronic
1102502921 12:113364953-113364975 GCTTGTGGGTCCCTCCGACTTGG - Intronic
1102933782 12:116880974-116880996 ACCTGTTGCTCGCTCCGGCTGGG + Exonic
1107566138 13:41606717-41606739 GCCTCTGGCGCTCTCCCCCATGG - Intronic
1109290936 13:60474180-60474202 TCCTCTCTCTCTCTCCGCCTTGG + Intronic
1111971911 13:94925606-94925628 GCCTCTGGCTCCCTCCCTCTAGG + Intergenic
1112035299 13:95492019-95492041 GTCTGTGGGTCTCTCAGCCATGG + Intronic
1112308871 13:98300343-98300365 CCCCGTGTCTCTCTCAGCCTTGG + Intronic
1113262041 13:108575547-108575569 GTCTGTGCCTCTCTCCCCCAAGG - Intergenic
1113614300 13:111670096-111670118 GCCTGTGTCTCTCTCCATCGGGG - Intronic
1113619768 13:111755010-111755032 GCCTGTGTCTCTCTCCATCGGGG - Intergenic
1115398198 14:32933164-32933186 GCCTGTGTCACTCTTGGCCTTGG + Intergenic
1115687331 14:35809398-35809420 ACCCGTGGCACTCCCCGCCTTGG + Intergenic
1116144177 14:41042194-41042216 CCCTGTGGCTCTGGCCTCCTGGG - Intergenic
1116749967 14:48870886-48870908 GCCTGTAGCTCTCTCCTGGTAGG + Intergenic
1119199642 14:72742973-72742995 GCCTGTGGCCCTCTCTGCTTTGG + Intronic
1120537535 14:85715410-85715432 ACCTGTGGATCTCTCAGCCATGG + Intergenic
1121333214 14:93060923-93060945 GCCTGTGTCCCCCTCTGCCTTGG - Intronic
1122480623 14:102044828-102044850 GGGTGTGGCTCTGTCAGCCTCGG + Intronic
1123188166 14:106540046-106540068 TCCTCTCTCTCTCTCCGCCTCGG + Intergenic
1202890107 14_KI270722v1_random:148605-148627 TCCTCTCTCTCTCTCCGCCTCGG - Intergenic
1124497741 15:30196470-30196492 GCCTTTGCCTTTCCCCGCCTGGG - Intergenic
1124745845 15:32342221-32342243 GCCTTTGCCTTTCCCCGCCTGGG + Intergenic
1125970851 15:43910334-43910356 AACTGGGCCTCTCTCCGCCTTGG + Intronic
1126238735 15:46416746-46416768 GAAAGTGGCTCTCTCTGCCTTGG + Intergenic
1128818006 15:70628646-70628668 CCTTGTGGCTCTTTCAGCCTTGG - Intergenic
1129488727 15:75903406-75903428 GCCTGTGCCTCTCACTGCCCTGG - Intergenic
1129519440 15:76176624-76176646 GCCTGTGGCTCTCTGTGCCCAGG + Intronic
1129693020 15:77724363-77724385 GGCTATGACTCTCTCAGCCTCGG + Intronic
1129937137 15:79460195-79460217 GCTTGTGACTCTCACCACCTTGG + Intronic
1132302892 15:100787441-100787463 GGCTGTGGCTCCTGCCGCCTGGG + Intergenic
1132317607 15:100901173-100901195 GCCCCAGGCTCTCTCCGTCTGGG - Intronic
1134091041 16:11391898-11391920 GTCTGGGGCTCTCTCTGCCCTGG - Intronic
1136264622 16:29107564-29107586 GCCTCTAGCTGGCTCCGCCTGGG - Intergenic
1137586227 16:49665353-49665375 GCCTGTGGAGCTCGCAGCCTAGG + Intronic
1138390047 16:56663374-56663396 GCCTGTCGCTCTTCCCACCTAGG + Intronic
1138797912 16:59992873-59992895 GTCTATGGGTCTCTCAGCCTTGG + Intergenic
1141034303 16:80614459-80614481 GCCTGTGGCTGTCTTCCCATTGG - Intronic
1141660655 16:85439378-85439400 CCATCTGGCTCTCTCAGCCTTGG + Intergenic
1141809355 16:86364518-86364540 GTCTGTGCCTCTCTGAGCCTTGG - Intergenic
1142364169 16:89641022-89641044 TCCTCTCTCTCTCTCCGCCTCGG - Intergenic
1142397364 16:89839818-89839840 GCCTTTGACTCTCTTAGCCTTGG - Intronic
1151546930 17:74799017-74799039 GCGTGTGTCACTCTCCCCCTGGG + Intronic
1152698365 17:81807176-81807198 GCCTGCCGCTGTCTCCGCCAGGG + Intronic
1153065512 18:1040143-1040165 GTCTGTGGGTCTCTCAGCCATGG - Intergenic
1154509603 18:15082611-15082633 GCATGTTTCTCTCTCTGCCTAGG - Intergenic
1156460504 18:37319015-37319037 GCCTCTGGCTGCCCCCGCCTGGG + Intronic
1160224589 18:77002219-77002241 GCACCTGGCTCTCTCCACCTGGG + Intronic
1160538247 18:79606813-79606835 GGCAGTGGCTCCCTCCGCCTGGG - Intergenic
1160697387 19:491677-491699 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697417 19:491743-491765 GCCTGGGGCTGTCTCCTCCCAGG - Intronic
1160697444 19:491810-491832 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697472 19:491876-491898 GCCTGGGGCTGTCTCCTCCCAGG - Intronic
1160697500 19:491942-491964 GCCTGGGGCTGTCTCCTCCCAGG - Intronic
1160697527 19:492009-492031 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697555 19:492075-492097 GCCTGGGGCTGTCTCCTCCCAGG - Intronic
1160697594 19:492174-492196 GCCTGGGGCTGGCTCCGCCCAGG - Intronic
1162127437 19:8506979-8507001 GCCTGGGACTCTCTCGACCTGGG - Intergenic
1164320119 19:24137106-24137128 GACTGTGGATCTCTCAGCCATGG + Intergenic
1165319089 19:35074909-35074931 GCCTGTGGCTCTCTTCACACTGG + Intergenic
1165708704 19:37994483-37994505 CCCTTTGCCTCTCTCCTCCTTGG + Intronic
1168241104 19:55089248-55089270 CCCCGTGGCTCTCGCCACCTAGG + Intergenic
927187434 2:20491945-20491967 GCCTGCGACTCCCTCAGCCTGGG - Intergenic
928128220 2:28630525-28630547 CACTGTGGCTCTGTCCTCCTGGG - Intronic
928593088 2:32837074-32837096 GCCTGTGGCTCTTTCAGCCATGG - Intergenic
929133462 2:38601977-38601999 ACCGGGAGCTCTCTCCGCCTCGG - Intronic
931450829 2:62366400-62366422 GGCTGTTGCTCTCTGCACCTGGG + Intergenic
932100595 2:68896286-68896308 GTCTATGGGTCTCTCAGCCTTGG + Intergenic
932384842 2:71323028-71323050 GTCTGTGGGTCTCTCAGCCATGG + Intronic
932489476 2:72111284-72111306 GCCTGTGGTTCACTCCTCCCTGG + Intergenic
933121418 2:78542324-78542346 GTCTGTGGGTCTCTCGGCCATGG - Intergenic
936407132 2:112214779-112214801 GCCTGTGGGTCTCTCCTACCTGG - Exonic
937826299 2:126371796-126371818 GCCTATGCCTCCCTCGGCCTAGG - Intergenic
937826629 2:126373898-126373920 GCCTATGCCTCCCTCGGCCTAGG + Intergenic
938080952 2:128369857-128369879 GCCTGTGGCTGTCCCTGCCCTGG + Intergenic
938221751 2:129575036-129575058 GCCTGGGCCTCTCTCCCACTAGG - Intergenic
939364684 2:141216540-141216562 GCCAGTGGCTCTCTCATTCTGGG - Intronic
940217588 2:151316142-151316164 GTCTGTGGGTCTCTCAGCCGTGG - Intergenic
941631567 2:167890811-167890833 GTCTGTGGGTCTCTCAGCCATGG + Intergenic
944432020 2:199644394-199644416 GTCTGTGGGTCTCTCAGCCATGG + Intergenic
945784032 2:214211656-214211678 GCCTGTGGCTTTCTCAGTCTTGG - Intronic
946710243 2:222497926-222497948 GCCTGGGACTCTCTCCCCCAGGG - Intronic
948222833 2:236287154-236287176 GCCTGTGGCTCTTTACTCTTTGG - Intergenic
948380459 2:237546994-237547016 GACTGTGGCTCAGTCCTCCTGGG + Intronic
1169733579 20:8812656-8812678 GTCTGTGCCTTTCTCCCCCTTGG + Intronic
1171043365 20:21787947-21787969 CCCTGTGGGTCTCACTGCCTGGG + Intergenic
1171347738 20:24478708-24478730 GGCTGTGGCGCTCTCCTCCCAGG - Intronic
1172182276 20:33010818-33010840 GCATCAGGCTCTCTCCACCTGGG - Intronic
1172309108 20:33903550-33903572 GCCTTTGCCTCTGTCCTCCTTGG - Intergenic
1173145285 20:40519529-40519551 GCCTCTGGCTCTCTTCTACTGGG + Intergenic
1173691144 20:44962078-44962100 GCCTGAGACTCTCCCAGCCTGGG + Intergenic
1174017704 20:47502095-47502117 GCCGCTGGCTCTCGCAGCCTGGG - Intronic
1174060801 20:47831551-47831573 GCCTGTTTCTTCCTCCGCCTTGG - Intergenic
1174071097 20:47899819-47899841 GCCTGTTTCTTCCTCCGCCTTGG + Intergenic
1174152955 20:48498843-48498865 GCCTGTTTCTTCCTCCGCCTTGG - Intergenic
1175444935 20:59013429-59013451 ACCTGTGGCTCTCCCCTCCAGGG - Intergenic
1175780028 20:61676451-61676473 GCCCGGGGCTCCCTCCTCCTGGG + Intronic
1175784838 20:61705974-61705996 GCCTGTGGATTTCTCCCCCACGG + Intronic
1175901284 20:62360861-62360883 CTCTGGGGCTCTCTCGGCCTCGG - Intronic
1176070716 20:63224870-63224892 GCCTGTGGCTCTCTAGGCGCTGG + Intergenic
1176286575 21:5022112-5022134 GCCTGGCGCTCTCCCAGCCTTGG + Intergenic
1176788466 21:13289163-13289185 GCATGTTTCTCTCTCTGCCTAGG + Intergenic
1177987621 21:27997368-27997390 GCGTGTTTCTCTCTCTGCCTAGG + Intergenic
1179533809 21:42038607-42038629 GCCTGTGGCTCTCCCTTCCTTGG + Intergenic
1179638605 21:42731895-42731917 CCCTGGGGCTCTCTGGGCCTGGG - Exonic
1179870606 21:44241363-44241385 GCCTGGCGCTCTCCCAGCCTTGG - Intergenic
1179875993 21:44267767-44267789 GCCTGCGGCTCTCTCAACCTTGG + Intergenic
1180332239 22:11492357-11492379 TCCTCTCTCTCTCTCCGCCTCGG - Intergenic
1181109383 22:20592280-20592302 GCCTGTGGCTGGCTCTTCCTGGG + Intergenic
1181791902 22:25274492-25274514 GCCTGTGTCTCACTCAGCTTTGG - Intergenic
1182480792 22:30607414-30607436 TCCTGTGCCTCTTTCCTCCTGGG + Intronic
950186940 3:10951264-10951286 GCCTGTGGTTCTCTAGGACTAGG + Intergenic
951977915 3:28534316-28534338 ACCTGTGGTTCCCTCTGCCTGGG - Intronic
952301430 3:32107177-32107199 CCCTTTAGCCCTCTCCGCCTCGG - Intronic
952809503 3:37388629-37388651 GGTTGTAGCTCTCTCAGCCTAGG + Intronic
952885592 3:38009502-38009524 CCCTCTGTCTCTCTGCGCCTGGG - Intronic
952918745 3:38269657-38269679 GCCTGAGGCTCTCTCTTCTTTGG + Intronic
954117701 3:48476366-48476388 GCCTCTGGCTATCTCCCTCTGGG - Intronic
954188139 3:48935954-48935976 GCCTCTGGTTCTCTTCTCCTGGG + Intronic
954578018 3:51687380-51687402 CCCTGTGCCTCTCTCAGCCCAGG + Intronic
954678888 3:52330869-52330891 GCCTGTGTGTCTCTCTGCCCTGG + Intronic
955175571 3:56610921-56610943 GTCTGTGGCTCTCTCAGCCGTGG + Intronic
957971766 3:87391055-87391077 GCCTGTGGGTCTCTCAGCCATGG - Intergenic
962999409 3:140664229-140664251 GTCTGTGGGTCTCTCAGCCATGG - Intergenic
964120450 3:153177915-153177937 ACCTGTGGGTCTCTCGGCCATGG + Intergenic
965693788 3:171385296-171385318 ACCTGGGGCCCTCTCAGCCTAGG + Intronic
965874322 3:173299140-173299162 GTCTGTGGGTCTCTCAGCCATGG + Intergenic
966758530 3:183393785-183393807 GCATGCTGCTCTCTCAGCCTGGG - Intronic
967190049 3:186977224-186977246 GACTGTGGCTCCCTCCCCCACGG + Intronic
968487076 4:867896-867918 GCCTGTGGCTCTCTCCGCCTGGG + Intronic
968607185 4:1541092-1541114 GTCTGCTGCTCTCTCCTCCTGGG - Intergenic
969496736 4:7530496-7530518 CCCTGTGCCTCTCCCCACCTTGG + Intronic
969700562 4:8765464-8765486 GCCTGTGCCTGTCTCCTGCTGGG - Intergenic
970109363 4:12620168-12620190 GCCTGGGGCTCTGTGCTCCTGGG + Intergenic
970569324 4:17364414-17364436 GCCAGTTGCTCTCTGAGCCTTGG - Intergenic
973215474 4:47664396-47664418 TCCTGAGTCTCTCTCAGCCTCGG - Intronic
975710472 4:77156734-77156756 GCCTGAGCCTCTCTCTGCCTTGG - Intergenic
976342636 4:83962759-83962781 GCCTATGTCTCTCTCAGCCTAGG - Intergenic
978316887 4:107448028-107448050 GTCTGTGGGTCTCTCAGCCATGG + Intergenic
978999366 4:115199091-115199113 GTCTGTGGGTCTCTCAGCCATGG + Intergenic
979228071 4:118313210-118313232 GCCTGTGTCCCTCGCCGCCAGGG + Exonic
980897633 4:138875196-138875218 GCCTGGGGGTGTCTCCTCCTGGG + Intergenic
981461166 4:145014723-145014745 GTCTGTGGGTCTCTCAGCCATGG - Intronic
983530388 4:168804334-168804356 GCCTCTGGCTCTCACCACGTAGG - Intronic
984958124 4:185066234-185066256 GTGTGTGGCTCTCTCAGCCAGGG - Intergenic
985056253 4:186037939-186037961 GCTTGTGGCCCTCTCTGCCCTGG - Intergenic
986214804 5:5709556-5709578 GGCTGTGTTTCTCTCCACCTGGG - Intergenic
986387245 5:7246809-7246831 ATCTGTGGCTCTCTCTGCCTTGG - Intergenic
987856447 5:23425180-23425202 GCCTATGTCTCCCTCAGCCTAGG + Intergenic
988407872 5:30847608-30847630 GCGTGTGGCTCTTTCTTCCTTGG - Intergenic
989027350 5:37083065-37083087 GTCTGTGGGTCTCTCAGCCAGGG - Intergenic
991117438 5:62970347-62970369 GTCTGTGGGTCTCTCAGCCATGG - Intergenic
992088894 5:73300823-73300845 GCCTAGGGCTCTCTTTGCCTGGG + Intergenic
992520213 5:77542941-77542963 GTCTGTGGGTCTCTCAGCCATGG - Intronic
992743281 5:79795138-79795160 GCCTTTGGCTCTTTCAGGCTTGG + Intronic
994222121 5:97208384-97208406 GTCTGTGGGTCTCTCAGCCGTGG + Intergenic
994788140 5:104189130-104189152 GCCTATGTCTCTCTTGGCCTAGG + Intergenic
997105921 5:131019433-131019455 ACCTGTGGGTCTCTCAGCCATGG + Intergenic
999942488 5:156559215-156559237 GCCCCTGGCTCTCTCAGACTGGG + Intronic
1002901826 6:1416324-1416346 GCCTCGGGCTCTTTCCTCCTTGG - Intergenic
1010707705 6:79134725-79134747 GTCTGTGGGTCTCTCAGCCGTGG + Intergenic
1014090572 6:117399546-117399568 GCCTGAGGCTCTCTGCACATAGG + Intronic
1015596476 6:134872092-134872114 GCCTATGTCTCGCTCAGCCTAGG - Intergenic
1016918849 6:149271423-149271445 GCCTGTGGCTCTATTACCCTCGG + Intronic
1017190417 6:151648048-151648070 GTCTGTGTGTCTCTCCGCCATGG + Intergenic
1017287322 6:152690861-152690883 ACCTGATGATCTCTCCGCCTCGG + Intergenic
1018060920 6:160089085-160089107 GCCTGTGCTTCCCTCCTCCTAGG + Exonic
1019339132 7:500221-500243 GCCCGTGGCTCACTCCCGCTTGG - Intronic
1020358525 7:7303236-7303258 GTCTGTGGGTCTCTCAGCCGTGG + Intergenic
1021133425 7:16938116-16938138 GCCTGCTGCTATCTCTGCCTGGG + Intergenic
1025234132 7:57222461-57222483 GCCTGTTTCTTCCTCCGCCTTGG + Intergenic
1026873690 7:73868096-73868118 GCCTCTGCCTCTGCCCGCCTAGG + Intergenic
1027591945 7:80129055-80129077 GCCTGAGGCTCTCTCTTCCAAGG + Intergenic
1028849882 7:95526219-95526241 ACCTGGGGCTCTCTCCCACTGGG - Intronic
1029506120 7:100965130-100965152 GCCTGTGGCTCTCTCCGTCTGGG + Intronic
1029652293 7:101901770-101901792 GCCTGTGGCTCACTCCCTGTTGG - Intronic
1031387511 7:121170302-121170324 GCCTGTACCTCTCTGAGCCTTGG + Intronic
1031919950 7:127593182-127593204 GCTTGGTGCTCTCTCCACCTAGG + Intronic
1032075492 7:128833928-128833950 GGCTGGGGCTCTGGCCGCCTGGG - Intronic
1032495724 7:132360686-132360708 GCCAGTGCCTCTGTCCACCTCGG + Intronic
1033364082 7:140658256-140658278 GCCTCTTTGTCTCTCCGCCTTGG - Intronic
1035068257 7:156123283-156123305 GGCTGTGGCTCACTCCTTCTTGG + Intergenic
1035742977 8:1943186-1943208 GCCTGTGCCCCTTTCCGGCTGGG - Intronic
1037772553 8:21811060-21811082 GCCTGTGGCTGGCCCCTCCTGGG + Intronic
1038188148 8:25294278-25294300 GCCTGTGGGTCTGGCCGCCATGG + Intronic
1038516629 8:28193121-28193143 GCTGGTGGCTGTGTCCGCCTAGG + Intergenic
1040017734 8:42713429-42713451 GCCTGTGGATTTCTCCTGCTTGG - Intronic
1040543348 8:48379086-48379108 GCCTGTGGCTCACTCAGCAGAGG + Intergenic
1041364234 8:57083914-57083936 GCCTATGGGTCTCTCAGCCGTGG - Intergenic
1041454355 8:58041557-58041579 GACTGTGGCTCACTCCACATGGG - Intronic
1041944626 8:63427260-63427282 GCCTGTGTCTCTCTTCAACTGGG + Intergenic
1045337848 8:101224403-101224425 GGCTGGGGCTGTCTCCCCCTTGG - Intergenic
1046609525 8:116408725-116408747 GCCTGTGACTCTCCCCATCTCGG - Intergenic
1046638909 8:116703610-116703632 TCCTCTCTCTCTCTCCGCCTCGG + Intronic
1047309893 8:123683138-123683160 GCCTCTGCCTCTCTCCTCCATGG - Intronic
1049226319 8:141452170-141452192 GCCAGTGACTCTCTCCTCCTGGG - Intergenic
1049297932 8:141853144-141853166 GCCTGTGTCTCTCTACCTCTAGG - Intergenic
1049466617 8:142753875-142753897 GCCTGTGTCTCTCTGAGACTAGG + Intergenic
1049591491 8:143464890-143464912 GCCTGTTTCTCTCCCCGCCCTGG - Intronic
1049846550 8:144804798-144804820 TCCTGTCTCTCTCTCCGCCTCGG - Intronic
1050651960 9:7786037-7786059 GCCTATGTCTCCCTCGGCCTAGG - Intergenic
1051418788 9:16870728-16870750 GCCGCTGGCTCCCTCCGTCTCGG + Intronic
1053009690 9:34625951-34625973 GCATTAGGCTCTCTCCGCCTAGG + Intronic
1053135541 9:35648225-35648247 GCCTGTGGTTCCCTTTGCCTTGG + Intergenic
1053397455 9:37787308-37787330 GCCTAGGGCTCCCGCCGCCTAGG - Intronic
1055250009 9:74292823-74292845 GCCTGTGGCTCCCAGCACCTTGG + Intergenic
1056937110 9:90924413-90924435 TCCTGGGGTTCTCTCCTCCTAGG + Intergenic
1057522689 9:95772541-95772563 GCCTGTGGCCCTGTCAGCCCAGG + Intergenic
1060722812 9:125989810-125989832 CCCTGCAGCTCTCTCTGCCTTGG + Intergenic
1061329666 9:129884671-129884693 GCCTGTGGTTCTGTCGGCCATGG + Intergenic
1061412833 9:130430508-130430530 GCCTGGGTCTCTCTCCGTCCGGG + Exonic
1062049365 9:134439205-134439227 ACCTGTGCCTGTCCCCGCCTTGG + Intronic
1203758792 EBV:723-745 TCCTCTGGCTCTCTTCGCCAGGG + Intergenic
1203487199 Un_GL000224v1:67772-67794 TCCTCTCTCTCTCTCCGCCTCGG - Intergenic
1203499820 Un_KI270741v1:9672-9694 TCCTCTCTCTCTCTCCGCCTCGG - Intergenic
1189794852 X:44635801-44635823 GCCTGTAGCTCCCTTCTCCTGGG + Intergenic
1196225129 X:113157566-113157588 GCCTATGGGTCTCTCAGCCGTGG + Intergenic
1198272355 X:135066713-135066735 CCCTCTCTCTCTCTCCGCCTCGG + Intergenic
1199668590 X:150121579-150121601 GCCTATGGGTCTCTCAGCCATGG - Intergenic
1201408503 Y:13673468-13673490 GTCTGTGGTTCTCTCAGCCATGG - Intergenic
1201423556 Y:13825358-13825380 CTCTGTCTCTCTCTCCGCCTCGG + Intergenic