ID: 968487268

View in Genome Browser
Species Human (GRCh38)
Location 4:868680-868702
Sequence GCTTCCCTGCAGGAGAGGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 430}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968487259_968487268 7 Left 968487259 4:868650-868672 CCGTGGAGCCAGGCTGCCGGGGA 0: 1
1: 0
2: 4
3: 70
4: 404
Right 968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG 0: 1
1: 0
2: 3
3: 42
4: 430
968487260_968487268 -1 Left 968487260 4:868658-868680 CCAGGCTGCCGGGGAAGCTCCGG 0: 1
1: 0
2: 0
3: 50
4: 317
Right 968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG 0: 1
1: 0
2: 3
3: 42
4: 430
968487251_968487268 25 Left 968487251 4:868632-868654 CCCCAGCATCATACTGAGCCGTG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG 0: 1
1: 0
2: 3
3: 42
4: 430
968487252_968487268 24 Left 968487252 4:868633-868655 CCCAGCATCATACTGAGCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 70
Right 968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG 0: 1
1: 0
2: 3
3: 42
4: 430
968487262_968487268 -9 Left 968487262 4:868666-868688 CCGGGGAAGCTCCGGCTTCCCTG 0: 1
1: 0
2: 1
3: 27
4: 295
Right 968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG 0: 1
1: 0
2: 3
3: 42
4: 430
968487250_968487268 29 Left 968487250 4:868628-868650 CCTGCCCCAGCATCATACTGAGC 0: 1
1: 0
2: 1
3: 25
4: 495
Right 968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG 0: 1
1: 0
2: 3
3: 42
4: 430
968487249_968487268 30 Left 968487249 4:868627-868649 CCCTGCCCCAGCATCATACTGAG 0: 1
1: 0
2: 2
3: 18
4: 200
Right 968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG 0: 1
1: 0
2: 3
3: 42
4: 430
968487254_968487268 23 Left 968487254 4:868634-868656 CCAGCATCATACTGAGCCGTGGA 0: 1
1: 0
2: 0
3: 6
4: 60
Right 968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG 0: 1
1: 0
2: 3
3: 42
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968487268 Original CRISPR GCTTCCCTGCAGGAGAGGGA GGG Exonic
900993780 1:6109606-6109628 GTTTCCCTGCAGGGGAGATAAGG + Intronic
901332117 1:8418101-8418123 GGCTCCCTGCAGGGCAGGGATGG + Intronic
901455720 1:9361749-9361771 CCTGCCCTCCAGGAGAGAGAGGG - Intronic
901495197 1:9617077-9617099 GCTTCTCTGCTAGAGAGGGGTGG - Intergenic
901679841 1:10906552-10906574 GATTCTCTGGAGGGGAGGGAGGG - Intergenic
901705785 1:11071958-11071980 GCTTCCCTTCTGCTGAGGGATGG - Intronic
902466557 1:16622110-16622132 ACTCCCCTGCACGAGAGGAATGG + Intergenic
902508102 1:16950936-16950958 ACTCCCCTGCACGAGAGGAATGG - Exonic
902558884 1:17264481-17264503 GGTTACCTGTAGGAGAAGGAGGG - Intronic
902764804 1:18607059-18607081 GCTGGCCTGCAGGAAGGGGACGG + Intergenic
904031429 1:27535897-27535919 GGTCCCCTGAAGGACAGGGATGG + Intronic
904041886 1:27590109-27590131 CCTCCCCTCCAGGAGAAGGAGGG - Intronic
904575712 1:31503922-31503944 GAGTCCCTGCAGGGCAGGGAAGG - Intergenic
905645545 1:39622913-39622935 GCTTTCCAGGAGGAGAAGGAAGG - Intergenic
905974073 1:42162863-42162885 GCTTCCCTGCTGCGGAGGGGAGG + Exonic
906157780 1:43623989-43624011 ACTACCTTGGAGGAGAGGGATGG + Intergenic
906479351 1:46189984-46190006 GCCTCACTGCAGTAGAGGGTGGG + Exonic
907241057 1:53081316-53081338 GCTTCCATGCAGCAGAGCCAGGG + Intronic
910012902 1:82487191-82487213 GTCTCCCAGGAGGAGAGGGAGGG + Intergenic
910434442 1:87190953-87190975 GCTTTTCTGCTGGAGAGGGAGGG + Intergenic
912371887 1:109179964-109179986 GCTGCCATGCAGAGGAGGGAGGG + Intronic
912692140 1:111812445-111812467 GCTTCCCTCCAGGGGAAGCAGGG + Intronic
913491556 1:119384626-119384648 GCTTCCTTGTAAGAAAGGGATGG - Intronic
914397104 1:147280147-147280169 CCTTGCCTGCAGCAGAAGGAGGG + Exonic
915167665 1:153957711-153957733 GCCTCCTTGGAGGAGAGGTAGGG - Intronic
915217794 1:154351754-154351776 GCTTTCCTCCAGGGAAGGGAGGG + Intergenic
916214919 1:162386091-162386113 ACATCCCTGCAGCAGGGGGACGG - Intronic
922024938 1:221741449-221741471 GCATCCCTGCAGCAGAGGGTCGG + Intronic
922769588 1:228174867-228174889 GCATCGCTGCAGGAGAGGGCAGG + Exonic
922929336 1:229376668-229376690 TCTGCCCTGCAGCAGAGGCAGGG - Intergenic
923202333 1:231724516-231724538 GCTGTGCTGCAGGAGAGGGGAGG + Intronic
923344600 1:233039262-233039284 GACTCCCTGCTTGAGAGGGAAGG - Intronic
924083231 1:240420961-240420983 ACCTCCATGGAGGAGAGGGAAGG + Intronic
924456112 1:244219990-244220012 GCTGCCCAGGAGGAGGGGGAAGG - Intergenic
1062835732 10:634449-634471 GCATCCCTGGAAGAGAGGGCAGG - Intronic
1064104356 10:12488903-12488925 GCTGCACAGCAGGAGGGGGACGG - Intronic
1064619473 10:17201163-17201185 GCTTCCCAGCTGGGGAGGGAGGG - Intronic
1066350708 10:34634409-34634431 TTTTCCCTCCAGGGGAGGGAAGG + Intronic
1066416483 10:35226384-35226406 GCTGCCTTGCAGCAGGGGGAAGG + Intergenic
1067724857 10:48762373-48762395 GTTCCCCTGCTGGAGAGTGATGG + Intronic
1067842210 10:49690065-49690087 GCTTCCCTGCAGGAGGTGAGCGG + Intronic
1069606696 10:69743395-69743417 GATTTCCTGCAGGAGAGGGCTGG + Intergenic
1070167952 10:73912137-73912159 GCAGCCCTGCAGCAGAGGGCAGG - Intronic
1070748107 10:78947325-78947347 GCTGCCCTGCAGGACAGAGCAGG + Intergenic
1070987025 10:80697908-80697930 GATTCCTAGCTGGAGAGGGAGGG - Intergenic
1071434777 10:85637533-85637555 GCTTCCTTGTAGGAGAATGAGGG - Intronic
1072438029 10:95431195-95431217 GCTTTCTTGAAGGAAAGGGAGGG - Intronic
1073163908 10:101426864-101426886 GCTTCCCTTCACAAGAGGGCAGG - Intronic
1073483381 10:103801018-103801040 CCTACCCTGCAGGCAAGGGAGGG + Intronic
1074878872 10:117636056-117636078 GCTTCCCAGGAGCAGAGGGGAGG - Intergenic
1075182762 10:120226631-120226653 GCTCCCCTGCAGCAGAGGTTTGG + Intergenic
1075395391 10:122123341-122123363 GCATCCCTGCAGGCCAGGCATGG - Intronic
1076421355 10:130334734-130334756 GCTTGCCAGGAGGAGAGGGTGGG - Intergenic
1076574415 10:131454174-131454196 GCTTGCCTGCAGCAGGGGGCAGG - Intergenic
1076634954 10:131875876-131875898 GCCTCCCTGCAAGGGAGGGGAGG - Intergenic
1076724510 10:132407226-132407248 TCTTCCCAGCAGGAGAAGGCAGG + Intronic
1076767518 10:132644639-132644661 GCTTCCTTGGAGGAGCGGAAAGG - Intronic
1076995323 11:294836-294858 GCCTGGCTGCAGGTGAGGGATGG - Exonic
1077190123 11:1252508-1252530 GCCCACCTGCCGGAGAGGGATGG - Exonic
1077394456 11:2314363-2314385 GGTTCCCTGCAGGCCAGGGCTGG - Intronic
1077563527 11:3281353-3281375 TCTTCCCTGCAGGTGAGGCTAGG - Intergenic
1077569418 11:3327168-3327190 TCTTCCCTGCAGGTGAGGCTAGG - Intergenic
1078414816 11:11156457-11156479 GCTTCCCTGCAGGATTGCGGAGG + Intergenic
1078535627 11:12171088-12171110 CCTTCCCTGCAGGGTGGGGATGG + Intronic
1079294463 11:19219941-19219963 CTTTTCCTGCAGGAGAGGGATGG + Intergenic
1080088232 11:28312756-28312778 GCATGCATGCAGGAGAGGAAAGG + Intronic
1080584797 11:33672103-33672125 GCTCCCCTACAGGAAAGGGATGG + Exonic
1081640212 11:44747945-44747967 GCTCTGCTGCAGGTGAGGGAGGG - Intronic
1084085848 11:66854860-66854882 GCATCTCTTCAGGAGAGGCAGGG - Intronic
1084647700 11:70468880-70468902 GCTTCCCTAAAGCGGAGGGATGG + Intronic
1084702528 11:70796608-70796630 GGTTGCTTGCAGGAGAGGGTGGG + Intronic
1085766540 11:79288064-79288086 TCTTCCTTGAAGGAGAAGGATGG + Intronic
1087128964 11:94652549-94652571 ACTTGCCTTCAGGAGAGGAAGGG - Intergenic
1087799607 11:102489299-102489321 TCTTTCCTCCAGGAAAGGGAGGG + Intronic
1088792790 11:113241020-113241042 CCTTCCCTGAAGGAGAGGCGAGG + Intronic
1088816237 11:113422893-113422915 CCATCCCTGCCTGAGAGGGAAGG - Intronic
1088895847 11:114077716-114077738 CCCTCCCTGCAAGAAAGGGAGGG + Intronic
1088988411 11:114929567-114929589 GGTGCCCTGCAGGAGAAGGCAGG - Intergenic
1089554975 11:119311248-119311270 GCATCCCTGCAGGGGATGGCAGG - Intronic
1089600363 11:119610612-119610634 GCTTCCCTTCTGGGGAGGCAGGG + Intergenic
1089602222 11:119623208-119623230 GCTTCCCAGCAGGAGAGGAAGGG + Intergenic
1089858376 11:121567163-121567185 GCTCCCCGCCAGGGGAGGGAGGG + Intronic
1089970775 11:122691483-122691505 CATTCCCTGCACGAGAGGAAAGG - Intronic
1090517114 11:127440647-127440669 CCTTCCTTGCAGGAAATGGAGGG + Intergenic
1090639156 11:128715957-128715979 ATTTCCCTGCAGGAGAGGCAGGG + Intronic
1090672466 11:128958421-128958443 GGTTACTTGCAGGAGAGGAAGGG - Intergenic
1091609819 12:1996445-1996467 GCTTGCATAGAGGAGAGGGAAGG - Intronic
1092203196 12:6600002-6600024 CCTTTACTGCAGGAGAAGGAAGG - Exonic
1092731406 12:11538523-11538545 GCTCCCCTGCTAAAGAGGGAAGG + Intergenic
1094708398 12:32936958-32936980 GCTCTCCTGCATTAGAGGGAGGG + Intergenic
1094713601 12:32989111-32989133 GCTCCCATGGAGGAGAGAGAGGG + Intergenic
1096053758 12:48633749-48633771 GGTTCCCAGTAGGAGAAGGAAGG + Intergenic
1096656669 12:53096772-53096794 GCTTACCTGAAGGACGGGGATGG + Intergenic
1097271866 12:57780438-57780460 GGTCCCCAGCAGCAGAGGGAAGG - Exonic
1097580891 12:61455008-61455030 GCTGCACAGCAGGAGAGTGATGG - Intergenic
1099004924 12:77224592-77224614 GCTTCCCAGCAGGAAACAGAAGG - Intergenic
1100339481 12:93664593-93664615 ACTACCCTGCTGGAGAGGGCAGG + Intergenic
1102436641 12:112929328-112929350 GCTTCCCTTTGGGAGATGGATGG - Intronic
1102528458 12:113528805-113528827 CCTTTCCTGCTGGAGAGAGAGGG - Intergenic
1102633008 12:114298690-114298712 TCTTCCCTGCAGAAGATGGAGGG - Intergenic
1102905945 12:116675393-116675415 TCTGGCCTGCAGGAGAGGCAGGG - Intergenic
1103794629 12:123494791-123494813 GTTTCACTGGAGGACAGGGAAGG - Intronic
1104604950 12:130180902-130180924 GGTTTCCTGCAGGAGACGGGTGG - Intergenic
1104838663 12:131809172-131809194 GGTTCCCTGGAGGGCAGGGAGGG + Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105241144 13:18610361-18610383 GCGTCCCTGCAGGAGGCAGAAGG + Intergenic
1105444705 13:20443026-20443048 TCTTCCCTTCAGGAAAGGCAGGG - Intronic
1105754245 13:23450444-23450466 GCTGCCCTGAAGCAGAGAGATGG - Intergenic
1105795796 13:23851166-23851188 GCATCCCTGCAGGACAGAAAAGG - Intronic
1106327935 13:28712013-28712035 GCTTCCCTGCAAGATAGTAAGGG + Intronic
1108026623 13:46184709-46184731 GCTTCAGGGCAGGAGAGGGTGGG - Intronic
1108360699 13:49665938-49665960 TCTTCCCTGTTGGTGAGGGATGG + Intronic
1108641566 13:52387046-52387068 GCTAGCCTGGAGTAGAGGGAGGG - Intronic
1108779585 13:53812901-53812923 GCTTCTTTTCAGGAGAGGGAGGG + Intergenic
1109073768 13:57806394-57806416 TGTTCCCTGAAGGAGAGGGCAGG - Intergenic
1110475081 13:75904160-75904182 GGTTCCCTCCAGGAGAGGTGAGG + Intergenic
1113297036 13:108970505-108970527 CCTTGCCTGTGGGAGAGGGAGGG - Intronic
1114227511 14:20752586-20752608 GCTTGCTTGCAGGGGAGGAATGG + Intergenic
1115099844 14:29685363-29685385 GCTTCCCTGCAGATGATGAAAGG - Intronic
1115827029 14:37289917-37289939 GATTCCCTGTAGGTGAGGAAAGG + Intronic
1117290003 14:54323018-54323040 CCTTCCCTGCAGGGGAGTCATGG - Intergenic
1117653109 14:57926865-57926887 GCTCCACTTCAGGTGAGGGAAGG - Intronic
1117830034 14:59741160-59741182 GCTTGGCTGGAGGAGGGGGAAGG - Intronic
1118764488 14:68900732-68900754 GTTCCCCTGCAGGAGAAGGAGGG + Intronic
1119878278 14:78078662-78078684 GCCTCCCTGAAGGTGAGGGCTGG - Intergenic
1120568195 14:86085522-86085544 GCTTCCAGGCACGAGAGGGAAGG + Intergenic
1121414795 14:93771944-93771966 GCTGCCCAGCTGGAGAGGAAGGG - Intronic
1121584961 14:95056983-95057005 GCTTCCCAGCTGCAGAGGGAAGG - Intergenic
1121685020 14:95829445-95829467 ACTTCCTAGCAGGGGAGGGAGGG + Intergenic
1122046131 14:99025324-99025346 GCTCGCCTGCTGGACAGGGATGG + Intergenic
1122205396 14:100145657-100145679 CCCTCCCTGCCAGAGAGGGATGG - Exonic
1122783238 14:104152559-104152581 GCTTCCCTGAAGGGAGGGGACGG + Intronic
1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG + Intronic
1123035533 14:105470317-105470339 GTTTCTCTGCAGGTGAGGGCGGG - Exonic
1123490210 15:20774786-20774808 GCGTCCCTGCAGGAGGCAGAAGG - Intergenic
1123546711 15:21343873-21343895 GCGTCCCTGCAGGAGGCAGAAGG - Intergenic
1123935470 15:25191986-25192008 GCTGCCCTGCATGAGATTGAAGG - Intergenic
1123935895 15:25193916-25193938 GCTGCCCTGCATGAGACTGAAGG - Intergenic
1125521118 15:40348368-40348390 GCTGCCCTGCAGGGTGGGGAGGG - Intergenic
1125598267 15:40901112-40901134 GCTTCCCTTGCAGAGAGGGAAGG + Intronic
1127165688 15:56243525-56243547 GCTTCACCGCGGGAGAGGCATGG + Intergenic
1128114497 15:65096746-65096768 GCCTCCCTGCAGGACAGGCATGG - Intronic
1128234654 15:66059353-66059375 GCATTCCTGCAGAAGAGGAAAGG + Intronic
1128252377 15:66172282-66172304 GCCTCCCTCCAGGAGCTGGAAGG + Intronic
1128280048 15:66387091-66387113 GCTGCCCTGCAGGAGCGGAGCGG - Exonic
1128329063 15:66744131-66744153 GCTGCCCTGGAGGAGAGGGCCGG + Intronic
1128392469 15:67191610-67191632 GCTTCACCTCAGGAGAGAGAAGG - Exonic
1129084862 15:73078273-73078295 GAATCCCTGCAGGAGAAGCAGGG + Intronic
1129230595 15:74195119-74195141 GCTGCTCTGCAGGAGAGGCAGGG - Intronic
1129235390 15:74220756-74220778 GCTTCCCTGGGGGAGAGTGGGGG + Intergenic
1129467502 15:75732147-75732169 GTTTCCCTTCAGGGGAGGAAGGG + Intergenic
1129615726 15:77097712-77097734 TCTATCCTGCAGGAGAGGGAAGG + Intergenic
1129707934 15:77805288-77805310 TCTTCCCAGCAGGAGTAGGAGGG - Intronic
1129719702 15:77871422-77871444 GTTTCCCTTCAGGGGAGGAAGGG - Intergenic
1130322829 15:82854795-82854817 GCTGCGCTGCAGGACAGGGACGG + Exonic
1130512564 15:84601344-84601366 GCTTCTCGGTAGGAGAGGCAAGG - Intronic
1130753635 15:86739860-86739882 GCCACCCTTCTGGAGAGGGAGGG - Intronic
1130829445 15:87584489-87584511 GCTCACATGCAGGTGAGGGAAGG - Intergenic
1131654752 15:94444424-94444446 CCTTCCCTGCAGGTCAGGGCTGG + Intronic
1132256911 15:100384082-100384104 GCTTCCCTGGAGCACAGGGCAGG + Intergenic
1202955042 15_KI270727v1_random:71088-71110 GCGTCCCTGCAGGAGGCAGAAGG - Intergenic
1132830734 16:1926790-1926812 GCTGCAATGCAGGAGAGGGGAGG - Intergenic
1132842759 16:1986258-1986280 GCTGAACTGCAGGGGAGGGAAGG + Exonic
1132997442 16:2830527-2830549 GCCTCCCTCCAGGAGAGCCAGGG + Intronic
1133329058 16:4959968-4959990 GCTTCCTTAAAGGGGAGGGAAGG - Intronic
1134061973 16:11204813-11204835 GTTTCTCTGCAGGCGTGGGAAGG - Intergenic
1134663461 16:16001541-16001563 GTTTCCCAGCAGAAGAGAGAAGG + Intronic
1135509363 16:23068875-23068897 GCTTTGCTGCGGGAGCGGGAGGG + Exonic
1135913714 16:26584080-26584102 GCTTCTCTGCTGGAAAGAGAAGG + Intergenic
1136136632 16:28260308-28260330 GTTTCCCTGCAGGTGGGGGTGGG - Intergenic
1137523479 16:49213331-49213353 GCCTTCCTGCAGGAGAAGGTAGG + Intergenic
1137565124 16:49528006-49528028 GCTTGCCTGCAGGAGGGGCTTGG + Intronic
1137650317 16:50114437-50114459 GGTTCCCTGCAGGTGCTGGAAGG + Intergenic
1138057153 16:53847259-53847281 GCATCCCTACGGGAGAAGGAGGG - Intronic
1138096389 16:54215210-54215232 GCTTCCCTGAAGGAAAGCGGGGG - Intergenic
1139250632 16:65492138-65492160 GCCTGCCTGCATGGGAGGGAGGG - Intergenic
1140121300 16:72085207-72085229 CCCTCCCTGCAGGAAAGGGGTGG + Exonic
1140191287 16:72819289-72819311 GCTTTCCTAAAGGACAGGGAAGG - Intronic
1140737047 16:77907748-77907770 TCCTCCCTGCAGGATAGGGGAGG - Intronic
1141057594 16:80833004-80833026 GCTTGGCTGCAGGAGAAGAAGGG - Intergenic
1141844865 16:86601424-86601446 GCTTCCCTCTAGGGGATGGAGGG + Intergenic
1141849597 16:86636407-86636429 GCTGCCTTGAAGAAGAGGGAGGG + Intergenic
1141869260 16:86773413-86773435 GCTTCTCTGTGTGAGAGGGAGGG + Intergenic
1142223655 16:88867040-88867062 GCTTCCGACCAGGAGAGGCAGGG + Intergenic
1142416883 16:89948142-89948164 GCTTCACGGCTGCAGAGGGAGGG - Intronic
1142638703 17:1272522-1272544 TCTTGCCAACAGGAGAGGGAAGG + Intergenic
1142713983 17:1738088-1738110 GCTTCCCTGTCCTAGAGGGATGG - Exonic
1142717679 17:1755819-1755841 GCTTCCCTGCTGGAGGTGCAGGG + Intergenic
1142767667 17:2074835-2074857 CCTTTCCTGATGGAGAGGGAGGG + Intronic
1143015109 17:3887523-3887545 GCCTCCCTGGAAGAGAGGGCAGG + Intronic
1143417173 17:6758659-6758681 TCTTCCCTGCAGGAGAGATGGGG + Intronic
1143724728 17:8837205-8837227 GCTTCCCTGATGGAGCAGGAGGG - Intronic
1143858286 17:9869115-9869137 GCTTCCATGATGGAGAGGAAGGG - Intronic
1146277304 17:31523876-31523898 GCTTACCTGCAGCAGGGGGCCGG - Exonic
1146790658 17:35748798-35748820 GCTACAGTGGAGGAGAGGGAGGG + Intronic
1147155843 17:38544156-38544178 GTCTCCCTGCAGGAGAGGGGTGG + Intronic
1147340625 17:39751454-39751476 GCTTCTCTGGGGGAGAGGGTGGG + Intergenic
1147559680 17:41501177-41501199 AGTTCCCTGCAGGAGAGAGGAGG - Exonic
1147668941 17:42165688-42165710 CCTTCCCTGTAGGTAAGGGATGG + Exonic
1147954165 17:44123243-44123265 CCTTCCCTACAGGTAAGGGAGGG - Intronic
1148018807 17:44540216-44540238 GCTGCCCAGCAGGAGGGGGTGGG + Intergenic
1148715171 17:49710847-49710869 GGTCTCCTGGAGGAGAGGGAAGG + Exonic
1148804199 17:50256113-50256135 GCATTCCTGCAGGAGTGGGCAGG - Intergenic
1148860666 17:50602803-50602825 GCGTTCCTGCAAGAGAGGGGAGG - Exonic
1149515560 17:57278404-57278426 ACTTCACTGCAGGAAAGGGGAGG + Intronic
1150132566 17:62677252-62677274 TGTACCCTGAAGGAGAGGGAAGG - Exonic
1150289548 17:63973506-63973528 CCTTCCCTCCAGGCCAGGGATGG - Intergenic
1150479626 17:65499316-65499338 GTTTCCCTCCAGGGGAGAGAGGG - Intergenic
1150682278 17:67293572-67293594 GCAGGCCTGCAGGAGAGGGAGGG - Intergenic
1150682874 17:67297268-67297290 GCAGGCCTGCAGAAGAGGGAGGG - Intergenic
1151360567 17:73586209-73586231 GCTAGCCAGCAGGAGAGGCATGG - Intronic
1151443007 17:74145739-74145761 GGTTTCCTGCAGAAAAGGGATGG + Intergenic
1151600812 17:75105044-75105066 GCTGCCCTACAGGTGAGGGCTGG - Intronic
1152578918 17:81157463-81157485 GGTTCCCTGCAGCAGAGAGTAGG - Intronic
1152739598 17:82013149-82013171 GATTCCCTGCAGCGGAGGCAGGG + Intronic
1152884998 17:82844549-82844571 GCCTCCCTCCAGGGGAGGGCTGG + Intronic
1154447814 18:14449540-14449562 GCGTCCCTGCAGGAGGCAGAAGG - Intergenic
1157152124 18:45228639-45228661 GTTTCCCTGCAGGTTAGTGAAGG - Intronic
1159258574 18:65980568-65980590 GGTTCCCAGCTGGAGATGGATGG - Intergenic
1160774224 19:847782-847804 GTCTCCCTGGAGGACAGGGACGG - Exonic
1161300922 19:3542951-3542973 TCTTGCCTGGAGAAGAGGGAGGG - Intronic
1161679046 19:5669868-5669890 GCTATCCAGCAGGAGAAGGAAGG + Intergenic
1161709452 19:5839639-5839661 ACTGCCCTGCAGGAGTGGGTGGG - Exonic
1161715764 19:5875436-5875458 ACTGCCCTGCAGGAGTGGGCGGG - Intronic
1162771580 19:12952672-12952694 GATTTGCTGCAGGAGAGGGTGGG - Exonic
1162961127 19:14127502-14127524 GCCAGCCTGCAGGAGGGGGAAGG + Intronic
1163248416 19:16111533-16111555 GCCCCACTGTAGGAGAGGGAAGG - Intergenic
1163326641 19:16607862-16607884 GCTGCCCTGAAGGGGAGGCAGGG - Intronic
1163478140 19:17539141-17539163 GCTTCGCTGCAGGACTGAGAGGG - Exonic
1164235111 19:23324964-23324986 GCTACCCTGGCTGAGAGGGATGG + Intronic
1164446563 19:28322678-28322700 GAGGCCCTGCAGGAGCGGGAAGG + Intergenic
1166414833 19:42587990-42588012 GGGTCTCTGCATGAGAGGGAAGG - Intronic
1166516449 19:43450698-43450720 GCTTCCCTGCAGCATAGAGCTGG + Intergenic
1166745784 19:45141261-45141283 GCTGCCCTGGAGGAGAGGCGTGG - Intronic
1168118465 19:54239372-54239394 GCCCTGCTGCAGGAGAGGGAGGG - Intronic
925381872 2:3433909-3433931 TTCTCCCTGCAGGAGAGAGACGG + Intronic
926590129 2:14732001-14732023 CTGTCCCTGCAAGAGAGGGAAGG - Intergenic
927292577 2:21419706-21419728 GCTGTCCCTCAGGAGAGGGATGG + Intergenic
927863122 2:26572795-26572817 GCTTCCGAGGAGGAGAAGGAGGG + Intronic
929127539 2:38535315-38535337 GCTTCCGTGCCACAGAGGGAGGG - Intergenic
929599984 2:43198851-43198873 CCAGCCCTGCAGGAGAGGGCAGG - Intergenic
931320980 2:61174889-61174911 GCTTACCTGCAGCAAAGTGAGGG - Intergenic
931441991 2:62296550-62296572 GCTTCCCTGCAAGGGCGGGAGGG + Intergenic
931457727 2:62425128-62425150 TCTTGCCTCCAGGACAGGGATGG - Intergenic
931463510 2:62467847-62467869 GCTTCCCTGCAGGAGCATGTGGG + Intergenic
931668642 2:64627531-64627553 GCTGCCCTGCCTGAGAGGGGAGG + Intergenic
932215597 2:69964079-69964101 GCTTCCATGCAGGGGTGTGATGG - Intergenic
932721431 2:74141401-74141423 CATTCCCTGCTGGGGAGGGAGGG + Intronic
932846012 2:75136563-75136585 GCTTTGCTGGAGGAGGGGGAAGG - Intronic
933806312 2:86000348-86000370 GAGTCCCAGCAGGAGAGAGATGG - Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934657416 2:96123433-96123455 GCTGCCCTGAGGGAGAGGTAGGG + Intergenic
934991781 2:98926808-98926830 CCTTCGCTGCAGGCGTGGGAAGG - Intronic
935287102 2:101574724-101574746 GCTTACCTGCAGCAGAGAGACGG + Intergenic
935668827 2:105538025-105538047 GTAGCCCTGCAGCAGAGGGAGGG - Intergenic
936078276 2:109415619-109415641 GCGTCCCTGGAGGACAGGCAGGG - Intronic
936971815 2:118183781-118183803 ACTTGTGTGCAGGAGAGGGAGGG + Intergenic
937202117 2:120210379-120210401 GCATCACTGCAGGGAAGGGAGGG - Intergenic
937335278 2:121058688-121058710 GCCTCCCCGCAGCAGAGGAAAGG + Intergenic
937451847 2:122008711-122008733 ACAGCCCTGCAGGATAGGGAGGG - Intergenic
937460556 2:122082022-122082044 GCCTGTCTGCAGGAGAGGGAAGG - Intergenic
937484617 2:122301674-122301696 GCATCCCTGAAAGAGAAGGAGGG + Intergenic
938244231 2:129765000-129765022 GCATCCCAGCTGGAGTGGGAAGG - Intergenic
938716714 2:134028065-134028087 GCTTCCCTGAAGGGCAGGGCAGG - Intergenic
941650482 2:168087207-168087229 GCTTACCTGCAGAAGAAAGAGGG + Intronic
945069654 2:205977411-205977433 GCCTCCCTGCAGGGCAGGGCTGG + Intergenic
945450128 2:209984839-209984861 GGTTCACTGCAGGAGGGGTAGGG - Exonic
946037599 2:216756241-216756263 GCATTCCTCCAGGAGGGGGATGG + Intergenic
947091008 2:226511455-226511477 TATTCCCTGCTGGAGAGAGAAGG + Intergenic
948267098 2:236642986-236643008 GCCTCCCTCCAGCTGAGGGAGGG + Intergenic
948788622 2:240365757-240365779 GCTTTGCTCCAGGAGAGGGGTGG - Intergenic
948982559 2:241501775-241501797 GCTGCCCTGCTGGGGAGGAAGGG + Intronic
1170388715 20:15849278-15849300 TCTTTCTTGCAGGAGTGGGAGGG + Intronic
1171237124 20:23536048-23536070 GAATCCCAGCAGGAGAGGAATGG - Intergenic
1171964156 20:31516736-31516758 GCTGCCCTGCAGGAGATGCTTGG - Intronic
1172357757 20:34291693-34291715 GCTTCCCTGTAGGAGGGCGTTGG - Intronic
1172657279 20:36544842-36544864 GCTTCCCTGCAGGAAGGGGTGGG - Exonic
1173470432 20:43319445-43319467 GCTTCTCTGCAGGCCAGGGATGG + Intergenic
1173628862 20:44494678-44494700 CCTCCTCTGCAGGTGAGGGAGGG + Intergenic
1174161910 20:48557120-48557142 CCTTCCCTGGAGGAAGGGGAGGG - Intergenic
1174417926 20:50379735-50379757 GGTTCCCAGCAGGACAGGCAGGG + Intergenic
1174738959 20:52993624-52993646 GCTTTCCTGAAGTGGAGGGAAGG + Intronic
1175771619 20:61627908-61627930 GCTGGCCTGCAGGGAAGGGAGGG - Intronic
1175834560 20:61985205-61985227 GCTGTCCTGCAGGTGAGTGACGG + Intronic
1175898311 20:62349941-62349963 CCTTCCCTGGAGGAGAGGTGGGG + Intronic
1175938654 20:62526907-62526929 ACTTCCCTGCAGCAGAGGAGGGG - Intergenic
1175945576 20:62557046-62557068 GCTTGCACGCAGGAGAAGGACGG + Intronic
1175983856 20:62754668-62754690 GTTGACCTGCAGGAGAGGAAGGG - Exonic
1176044495 20:63085341-63085363 GATGCCCTGCAGGCGAGGGCTGG - Intergenic
1176083736 20:63286525-63286547 GCATCCTTGCTGGGGAGGGAAGG + Intronic
1176448393 21:6841125-6841147 GCGTCCCTGCAGGAGGCAGAAGG + Intergenic
1176826563 21:13706147-13706169 GCGTCCCTGCAGGAGGCAGAAGG + Intergenic
1177785605 21:25668129-25668151 GTGTCCCTGGAGCAGAGGGAGGG + Intronic
1178117519 21:29432617-29432639 TCTTTCCTGCAGAAGAAGGATGG + Intronic
1178315307 21:31561862-31561884 GCTTCCCTGAAGGTGAGTAATGG + Intergenic
1179104253 21:38384051-38384073 GCACCCCTGCAGCTGAGGGATGG - Intronic
1179179138 21:39030579-39030601 GTTGCCCTGCAGGTGAGTGATGG - Intergenic
1179281829 21:39940285-39940307 GCTTCCCTACAAGGGAAGGAAGG + Intergenic
1179438782 21:41379337-41379359 GCTTCACGGCAGGAGCGTGAGGG + Intronic
1179445298 21:41426530-41426552 GCCTTCCTGCAGGAGAGGTTGGG + Intronic
1179890058 21:44330845-44330867 GCATCCCTGGCTGAGAGGGAAGG + Exonic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1180834309 22:18922222-18922244 GCTGCCCTGCCTGAGAGGGTGGG - Intronic
1180835702 22:18928501-18928523 GCTTCCCTCCAGGAGAGAGTTGG - Intronic
1181065501 22:20303881-20303903 GCTGCCCTGCCTGAGAGGGTGGG + Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181573027 22:23778127-23778149 CCTGCACTGAAGGAGAGGGATGG - Intronic
1181574275 22:23783837-23783859 GCTACCCTGAGGGACAGGGATGG - Exonic
1183163071 22:36127768-36127790 GTTTCCCTGCAGGAAAGAGGAGG + Intergenic
1183945807 22:41325106-41325128 GCTTTCCTTTAGGAGAGGGCTGG + Intronic
1183975684 22:41510759-41510781 GCTTCCTTGAGGGACAGGGAAGG - Intronic
1184839866 22:47046343-47046365 GCTTCCCTAGAGGAGAGCCACGG + Intronic
1184908494 22:47509152-47509174 GCCTCCCTCCAGCAGAGGAAAGG + Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1203284398 22_KI270734v1_random:147521-147543 GCTGCCCTGCCTGAGAGGGTGGG - Intergenic
1203285791 22_KI270734v1_random:153800-153822 GCTTCCCTCCAGGAGAGAGTTGG - Intergenic
949940312 3:9149631-9149653 GCTGGCCTGCAGGAGGGTGAGGG + Intronic
950304061 3:11904892-11904914 GCTCTCCTGCAGGACAGGGGAGG + Intergenic
950505823 3:13393873-13393895 GCTGTCCTGCAGGACAGGGGAGG - Intronic
953795572 3:45983279-45983301 GCTGCCCTGCAGAGGAGTGAAGG + Intronic
954035613 3:47849439-47849461 CCATCCCTGCAGGTGAGGCAGGG + Exonic
954070956 3:48142532-48142554 GCTACCCAGCGGGGGAGGGAAGG - Intergenic
954626578 3:52025153-52025175 GCTCCGGGGCAGGAGAGGGATGG + Intergenic
954640353 3:52094077-52094099 ACTTCCCTGTGGGGGAGGGAAGG + Intronic
954671989 3:52296181-52296203 GCTTCCTTACAGCAGAGGGCGGG + Intergenic
955004717 3:54957890-54957912 GGTTCTCAGCAGGGGAGGGAAGG - Intronic
958443653 3:94187934-94187956 GCTTCCCTTCAGTAGATGAATGG - Intergenic
959495749 3:107049339-107049361 GCTTCCCAGGAGAAGAGGGAAGG - Intergenic
960973458 3:123155258-123155280 ACTTACTTGGAGGAGAGGGATGG + Intronic
961141421 3:124559693-124559715 GCATCCCTGGAGGAGAGGATGGG + Intronic
963954177 3:151234843-151234865 GCTACCCACCAGGAGAGTGATGG - Intronic
964719961 3:159761585-159761607 GGTTCCTGGCAGGAGATGGAAGG + Intronic
965488482 3:169307771-169307793 GGTTCCCTATAGGAGTGGGAGGG - Intronic
966849167 3:184154326-184154348 GCTTCCCTCCAGCTGAGGGAAGG + Intronic
968469693 4:773751-773773 GCCTCCCTGCAGGGCAGGGCAGG + Intergenic
968480444 4:830792-830814 GTGTCACTGGAGGAGAGGGAGGG - Intergenic
968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG + Exonic
968565304 4:1309499-1309521 GCTGCCCTGCTGGAGGGAGAGGG + Intronic
969052485 4:4383151-4383173 GCTTCCCTGCAGAGCTGGGATGG - Intronic
969084013 4:4641865-4641887 GCTACTCTGGAGGGGAGGGAAGG - Intergenic
969347093 4:6576370-6576392 GCTCTCCTGGGGGAGAGGGACGG - Intronic
969417844 4:7072712-7072734 GCTGGCCTGAAGGACAGGGAAGG + Intergenic
969475795 4:7421881-7421903 GCGGGCTTGCAGGAGAGGGAGGG + Intronic
969476834 4:7426805-7426827 GCTTCACTGCCGGTGCGGGAGGG - Intronic
973672380 4:53234345-53234367 GCTTCCCTGGAGAGGAGAGAAGG + Intronic
974016451 4:56653600-56653622 GCTTCCCTGCAGGTCAAGGCAGG + Intronic
977266055 4:94856256-94856278 GCACCCCTGCAGCAGATGGAGGG - Intronic
981025201 4:140070880-140070902 GGTTCCCCTCTGGAGAGGGAAGG - Intronic
981102289 4:140842585-140842607 GCCACCCAGCAGGAGATGGATGG - Intergenic
982230530 4:153204670-153204692 TTTTCCCTGCAGAAGAGGGAAGG + Intronic
983560509 4:169097025-169097047 GTTTCCTTGGAGAAGAGGGAGGG - Intronic
984591973 4:181627031-181627053 GTTTCCCTGCAGGAGAAACATGG + Intergenic
984793505 4:183635926-183635948 GCTTTCCTTCAGCAGATGGACGG + Intergenic
985566902 5:623451-623473 CCTTGCCAGCAGGAGAGGGTGGG + Intronic
985961336 5:3305583-3305605 GTTTCCCTGGAGGAGAGTGTGGG + Intergenic
987076049 5:14382610-14382632 CCCTCCCTGCAGGGGAGGGTGGG - Intronic
987162693 5:15160651-15160673 GCCACCCTCCAGCAGAGGGAGGG + Intergenic
988063190 5:26200563-26200585 ATTTTCCTGCTGGAGAGGGAGGG + Intergenic
988731436 5:33976619-33976641 CCCTCCCTGCAGGACAGGGGTGG + Intronic
988836851 5:35041519-35041541 GCCCCCCTGCAGCAGTGGGATGG + Intronic
990255545 5:53964904-53964926 GCTTACCTTCAGGAGTGGGGTGG - Intronic
990521897 5:56588865-56588887 GCTTTCCTGCGTGAGAGGGAGGG + Intronic
992423484 5:76630737-76630759 GCTTTCCTGGAGAAGAGGAAAGG + Intronic
995431842 5:112088209-112088231 GCATCCTTGCAGGAGAGTGGGGG - Intergenic
995995335 5:118291659-118291681 CCTTTCCAGCAGGAAAGGGAAGG - Intergenic
997009406 5:129859192-129859214 GCTTCCCTGTAGGAATGCGAAGG + Intergenic
997234938 5:132267331-132267353 GCTTCACTGAACCAGAGGGAAGG + Intronic
997280633 5:132642039-132642061 GCTACCCTGCAGGAAGTGGAGGG - Intronic
997878845 5:137572145-137572167 ACTGCACTGCAGGTGAGGGATGG + Intronic
998194470 5:140055653-140055675 GGTTCCAGGCAGGACAGGGAAGG + Intergenic
999763670 5:154722246-154722268 GCCTCCCTGCAGGAGGAGGTAGG - Intronic
999968324 5:156833596-156833618 GCTGCCTTGCAGTAGAGTGAGGG - Intergenic
1000710232 5:164565715-164565737 GCTTCTTTCCAGGAGAGTGAGGG - Intergenic
1001031437 5:168266177-168266199 GTTTCCCTTCAGGAGGAGGATGG + Intergenic
1001274584 5:170341095-170341117 GCTTCCCTGCAGGAGGGCAGAGG - Intergenic
1001515928 5:172355338-172355360 GCTTCCGTGAAGGAGGGGAACGG - Intronic
1002325064 5:178399232-178399254 GCTCCCCAGCACGTGAGGGAGGG - Intronic
1003468610 6:6406826-6406848 GATTCACTGCAGGAGAGTGATGG - Intergenic
1003645010 6:7907710-7907732 GGGTCTATGCAGGAGAGGGAAGG - Intronic
1003913853 6:10767087-10767109 ACTGCCCTGCAAGAGCGGGAGGG + Intronic
1004396376 6:15248953-15248975 GCTTCCCACCAGGTGAGGGCCGG + Intronic
1007678838 6:43620690-43620712 GGTTCCCTGCAACAGAGGGAAGG + Exonic
1008164628 6:48120978-48121000 CCTTCCATGAAGGAGAAGGAAGG + Intergenic
1008936670 6:56999644-56999666 GCTTAGCTGCAGGGGAAGGAGGG - Intronic
1009991413 6:70846906-70846928 GATTCCCTCCAGGTGAGGTAAGG + Intronic
1012848325 6:104418054-104418076 ACTTCCCAACAGGAGAGTGAAGG + Intergenic
1013491108 6:110646852-110646874 GCTCCCCGGCAGGTGAGAGAAGG + Intronic
1013963429 6:115928213-115928235 GCCTCCCTGCGGGACAGGGCTGG - Intergenic
1014205406 6:118651186-118651208 GCTTCCCTGCCGGTAAGGAACGG - Intronic
1015015924 6:128412855-128412877 TCTTCCCTTCACGAGCGGGAGGG + Intronic
1016325891 6:142900680-142900702 GCTTCCTTTCTGGAGAGAGAAGG + Intronic
1016341696 6:143068398-143068420 GCTACCCTGCAGGTGAGGCATGG - Intronic
1017799409 6:157879310-157879332 GCTTCCCTTAGGGAGAGTGAGGG + Intronic
1019104890 6:169660066-169660088 GCTGCAGTGGAGGAGAGGGACGG + Intronic
1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG + Intergenic
1019339035 7:499626-499648 GCTCCCTTGCAGTGGAGGGATGG + Intronic
1019434438 7:1014908-1014930 CCGTCCCTGCAGGGCAGGGAGGG - Intronic
1021558604 7:21946125-21946147 TCCCCCCTGCAGCAGAGGGAGGG + Intergenic
1021793168 7:24226914-24226936 ACTTCCCTGAAGCAGTGGGAGGG - Intergenic
1022112113 7:27238248-27238270 GCATCCCTGAAGGCCAGGGAGGG + Intergenic
1023229626 7:38012984-38013006 ACTTCCCTGCAGGGGACGGAGGG - Intronic
1024993614 7:55254864-55254886 GCTTCCCTGCGGGACTGAGAGGG + Intronic
1029373991 7:100167068-100167090 GCGTCCTGGCAGGAGAGAGAGGG + Exonic
1030827997 7:114185650-114185672 GTTTCCCTGAAGGAGAGGTGTGG - Intronic
1031597023 7:123660153-123660175 GTTTCACTGCTGGACAGGGAAGG + Intronic
1032079316 7:128850791-128850813 TCTGCCCTGCAGGAGAGGTGCGG + Exonic
1032168146 7:129561978-129562000 TCTTCCCTGGGGAAGAGGGAGGG + Intergenic
1032273051 7:130429141-130429163 GGATCCCTGCAGGGGAGAGATGG - Intronic
1032325438 7:130924193-130924215 GCTCCCCAGCAGGGCAGGGATGG + Intergenic
1034244491 7:149634318-149634340 TCTTCCCTGTATGAGAGAGATGG - Intergenic
1034511852 7:151542222-151542244 GTTTGACTGCAGGAGAGGAATGG - Intergenic
1034881445 7:154765739-154765761 GCCCCCCAGCAGGACAGGGAAGG + Intronic
1035079210 7:156202325-156202347 GCTCCGCTCCAGGAGAGAGATGG + Intergenic
1035620197 8:1030839-1030861 TCTTTCCTCCAGGAGAGGGAAGG - Intergenic
1035626706 8:1076391-1076413 GTTTCCATGCAGGAGACGTACGG + Intergenic
1036424995 8:8636819-8636841 GGCTCCATGCAGGAGAGAGATGG + Intergenic
1036779024 8:11633202-11633224 GCTTTGCTGCAGCAGAGGAAAGG - Intergenic
1037521523 8:19684624-19684646 GCCTCCCAGGAGGAGTGGGAGGG - Intronic
1037819229 8:22127684-22127706 CCTTCACTGCACCAGAGGGATGG - Exonic
1038168953 8:25111173-25111195 GCCTCACTGCAAGAGAGGGTGGG + Intergenic
1038425344 8:27460948-27460970 TCTTCCCTACCGGGGAGGGATGG - Exonic
1038613046 8:29071517-29071539 GGGTCCGGGCAGGAGAGGGAGGG - Intronic
1038720048 8:30027450-30027472 GCTGCCCTGCAGGAGCGAGCAGG - Intergenic
1038779004 8:30555265-30555287 GCATTCCTGAAGAAGAGGGATGG + Intronic
1039474502 8:37832672-37832694 GCTTCCCTGCATAACAGAGAGGG - Intronic
1039891480 8:41688584-41688606 ACTTCCCTGCAGAAGAAGAAAGG + Exonic
1040487148 8:47884250-47884272 GCTGCCCTGCAGGGGAGAGCTGG + Intronic
1042185717 8:66134795-66134817 GCTTCCCTGCAGGTGTAGCAGGG - Intronic
1042312617 8:67393830-67393852 TCTCCCTCGCAGGAGAGGGAAGG + Intergenic
1044730594 8:95225827-95225849 GCCTCCCTGCAGGGGTGGGAGGG - Intergenic
1045242733 8:100416631-100416653 GCCTTCCTGCAGCAGAGGAAAGG - Intergenic
1048345727 8:133572759-133572781 GCTTCCCTGTAAAAGAGGGAGGG - Intergenic
1048662270 8:136618337-136618359 GCTTGCCTGCCGGAGAAGGAGGG - Intergenic
1049222920 8:141436058-141436080 TCTGCCTTGCAGGAGCGGGACGG - Intergenic
1049429116 8:142551007-142551029 GCTTTATTGGAGGAGAGGGATGG + Intergenic
1050173288 9:2844323-2844345 GCTTCCGTGCTGGAAAGAGAGGG + Intergenic
1050524693 9:6535422-6535444 GCCTACCTGTAGGAGAGGGCAGG - Intronic
1053479512 9:38405581-38405603 CCGTCCCTGGAGGAGAGGGCAGG + Intergenic
1053886438 9:42647507-42647529 GTTTCCCTGCGGAAGAGGGGAGG + Intergenic
1054225457 9:62454956-62454978 GTTTCCCTGCGGAAGAGGGGAGG + Intergenic
1055276388 9:74622155-74622177 CCTTCACTGAAGGACAGGGATGG - Intronic
1056928354 9:90853967-90853989 GGATGCCTGCAGGAGAGGGAGGG + Intronic
1057185485 9:93055286-93055308 GCTTCCCTGCTGGAGGAGGCAGG - Intergenic
1057468517 9:95337606-95337628 GCTTCCCTGCAAAAGGGGGTGGG + Intergenic
1057781773 9:98056457-98056479 CATTCCCTGCAGGAGGCGGACGG - Intergenic
1058166682 9:101626901-101626923 GCTTCCCTTCAGGCTAGGGCAGG + Intronic
1058736790 9:107900943-107900965 GCCTCACAGCAGGAAAGGGAAGG + Intergenic
1058907821 9:109495923-109495945 ACTTCCGTGCAGGAAAGGGCAGG - Intronic
1060494916 9:124111538-124111560 GCTCCCCTGGAGGAGGGGGATGG - Intergenic
1060499658 9:124143499-124143521 GGGTCCCAGCAGGAAAGGGATGG + Intergenic
1060599765 9:124869786-124869808 GATTTCCTGCAAGGGAGGGACGG - Intronic
1060783857 9:126433620-126433642 GCTTCCAAGCAGGAAAGGCAGGG - Intronic
1060995470 9:127873056-127873078 GCTTCTCTGCGGGAGAGAAAAGG + Exonic
1061042550 9:128148524-128148546 GCTTCCCTGCTGGACAAGGCTGG + Intergenic
1061573944 9:131494689-131494711 CCTTCTCTGCAGGACAAGGAAGG - Intronic
1061957874 9:133973033-133973055 GCCTCCCTCCTGGAGAGAGATGG + Intronic
1062220163 9:135410724-135410746 GCTGCTCTCCAGGGGAGGGAAGG - Intergenic
1062266542 9:135689044-135689066 ACCTCCATGCAGGTGAGGGACGG + Intergenic
1062525052 9:136974833-136974855 GCTTCCCTCCAGGAAAAGGTTGG + Intergenic
1203520798 Un_GL000213v1:43393-43415 GCGTCCCTGCAGGAGGCAGAAGG - Intergenic
1187031580 X:15493450-15493472 TCTTCCCGGCACGAGAGGCAGGG - Exonic
1187033178 X:15509604-15509626 CCTTCCCTGGAGGGAAGGGAAGG + Intronic
1189861877 X:45280907-45280929 GCATCCCTGAAAAAGAGGGAGGG - Intergenic
1190474483 X:50813529-50813551 GCGTCCCTGCGGGACAGTGAAGG - Intronic
1190598441 X:52067828-52067850 TCTTCCGAGCAGGGGAGGGAAGG + Intronic
1190610383 X:52186245-52186267 TCTTCCGAGCAGGGGAGGGAAGG - Intronic
1192318043 X:70067103-70067125 GCTTGGCTGCAGGAGGGGCATGG + Intergenic
1197843963 X:130780816-130780838 CCTTCCCTGCAAACGAGGGAGGG - Intronic
1200710615 Y:6481595-6481617 GCTTCCCAGCAGCAGAGGGAGGG + Intergenic
1200953519 Y:8923249-8923271 GCTTCCCAACAGCAGTGGGAAGG - Intergenic
1201023318 Y:9680389-9680411 GCTTCCCAGCAGCAGAGGGAGGG - Intergenic
1202231616 Y:22664601-22664623 GCTTCCCAACAGCAGTGGGAGGG - Intergenic
1202311542 Y:23531564-23531586 GCTTCCCAACAGCAGTGGGAGGG + Intergenic
1202559260 Y:26139030-26139052 GCTTCCCAACAGCAGTGGGAGGG - Intergenic