ID: 968488025

View in Genome Browser
Species Human (GRCh38)
Location 4:873590-873612
Sequence CAGGCAGCACAAAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 440}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968488025 Original CRISPR CAGGCAGCACAAAGGGCAGA AGG (reversed) Intronic
900781037 1:4617334-4617356 CAGGCAGCACTTTGGCCAGATGG - Intergenic
902202180 1:14841928-14841950 CAGCCAGCACAAAAGCCTGAAGG - Intronic
903552320 1:24166514-24166536 AAGGCAGAAGAAAAGGCAGATGG - Intronic
903685883 1:25131678-25131700 CAGGTGGCACATATGGCAGATGG - Intergenic
904257822 1:29267561-29267583 CAGCCAGCACAAAGGCCTGGAGG + Intronic
905282489 1:36858093-36858115 AAGGCAACACCAAGGGCAGTGGG - Intronic
905506866 1:38486654-38486676 CAGGCAGGAGGAAGGGAAGAAGG + Intergenic
905527780 1:38652211-38652233 GTGACAGCACAAAGTGCAGATGG + Intergenic
906061573 1:42952556-42952578 CAGACAGCACACAGGGCTGTGGG + Intronic
907487503 1:54787866-54787888 CTGGCAGCACACAGGACAGCCGG - Intronic
907576044 1:55526573-55526595 GAGGCTGCACAATGGGCAGAAGG + Intergenic
908113161 1:60916916-60916938 CAGCCAGCAAAAAGGGAAGGTGG + Intronic
908631386 1:66112610-66112632 CAGGCAGCATCAATGGCAGAGGG - Intronic
908733268 1:67248921-67248943 CAGGAAGCACAAGGGGCTGGGGG - Intronic
912697479 1:111852327-111852349 CAGGCCCCACAGAGGGCTGAGGG - Intronic
916005231 1:160653771-160653793 GAGGAAGCCCACAGGGCAGATGG + Intergenic
916560906 1:165933591-165933613 GATGCAGCAGAAAGGGCGGAAGG + Intergenic
918463359 1:184797703-184797725 CAGACAGAACAAAGGGAAAAGGG - Intronic
920845705 1:209591485-209591507 CAGGCAGCAAAAAGGGGAATGGG + Intronic
922340608 1:224652196-224652218 GAGGCAGCACACAGGAAAGAAGG - Intronic
922395137 1:225191403-225191425 CAGAAAGCACAAAGGCCAGAAGG - Intronic
924053936 1:240106184-240106206 AAGGCATCCCAAAAGGCAGAAGG - Intronic
1062930349 10:1348611-1348633 CAGACAGCAGACAGAGCAGAGGG - Intronic
1063067084 10:2621045-2621067 CAGGCCACACAAAGGGCTGGGGG + Intergenic
1063947847 10:11194580-11194602 CGAGCTGCACAAAGGGAAGATGG + Intronic
1065027126 10:21549600-21549622 CAGGCAGAAAGAAGGGGAGAGGG + Intronic
1065068702 10:22000552-22000574 CAGTAAGCACAAAGGCCAGGAGG - Intronic
1065432822 10:25676648-25676670 CAAAGAGCACAAAAGGCAGAGGG - Intergenic
1065701490 10:28430186-28430208 CAGGCAGAAAAAGGGGCAGGCGG + Intergenic
1066353367 10:34658472-34658494 AAGGCGGCACCAGGGGCAGACGG + Intronic
1066477831 10:35765064-35765086 CAGGCAGCAAGGACGGCAGAGGG - Intergenic
1067340889 10:45402472-45402494 CAGCCAGCACGGAGGGCTGAAGG + Intronic
1068077245 10:52271550-52271572 CAGTGAGCACAAGTGGCAGAGGG - Intronic
1069068983 10:63974933-63974955 CAGTCAGCACAAACAGCAAATGG - Intergenic
1069705064 10:70453851-70453873 GAGGGATAACAAAGGGCAGAAGG + Intergenic
1070128658 10:73641559-73641581 CAAGCAGCTCAAATGGCACAGGG + Exonic
1071183439 10:83013493-83013515 CAGAGAGCACCACGGGCAGAGGG + Intergenic
1071468503 10:85961991-85962013 AAGGAAGCAAAAAGAGCAGAAGG + Intronic
1071495016 10:86162226-86162248 CAGGGAGGAAAAAGGGAAGAGGG + Intronic
1073177079 10:101563223-101563245 CTGGAAGTAGAAAGGGCAGAGGG - Intergenic
1073249632 10:102113993-102114015 CAGGCAGCAACAGGGACAGATGG - Intronic
1073998155 10:109339567-109339589 CAGGAAGCACAAGGGGCCGGGGG - Intergenic
1074323936 10:112429807-112429829 CTGGCAGCCCAAAGTCCAGAGGG + Intergenic
1074453689 10:113579612-113579634 GAGGCAGCAGAAAAGGAAGAAGG - Intronic
1074693679 10:116029171-116029193 CCTGGAGCACAAAGAGCAGATGG - Intergenic
1074989671 10:118692147-118692169 GAGGCAGCACAAAAGGTAGGAGG + Intronic
1075081198 10:119385070-119385092 CAGCCAGCACAAAGGCCTGAAGG + Intronic
1075726555 10:124613546-124613568 CATGCAGGGCAGAGGGCAGAAGG - Exonic
1075897950 10:126014142-126014164 CCAGCAGCAGAAAGGGCACAAGG - Exonic
1076761699 10:132608963-132608985 CAGGCAGGACACAGGCCCGAGGG - Intronic
1076828007 10:132979934-132979956 CAGGGAGCACAAAGAGAAGGTGG + Intergenic
1077035990 11:494775-494797 CAGGCTGCACACAGGCCAGAAGG + Exonic
1077109027 11:854009-854031 CAGGCAGCACAGAGGCCTGAAGG - Intronic
1077214185 11:1388523-1388545 CAGACAGCCCAAAGAGCAGGAGG + Intergenic
1077338880 11:2017291-2017313 CAGGCAGCACAGAGGTCACCAGG - Intergenic
1078010945 11:7572670-7572692 CAGGTATCTGAAAGGGCAGAAGG - Intronic
1078176069 11:8971861-8971883 CAGGCAGCATTAAGGCCTGAAGG + Intergenic
1078528446 11:12118429-12118451 CAGGCCGCAGGAAGAGCAGAAGG - Intronic
1078937737 11:15966318-15966340 CAGGCAGAAGCAATGGCAGAGGG + Intergenic
1079000242 11:16747712-16747734 GAGGCAGCAGAAAGAGCAGGTGG + Intronic
1079236341 11:18693376-18693398 CTGTAAGCAGAAAGGGCAGAAGG + Intronic
1079373044 11:19868397-19868419 CAGAAAGCACAAAGGACAGAGGG + Intronic
1079577796 11:22025167-22025189 CAGGAAGCACAAGGGGTAGGGGG + Intergenic
1080553590 11:33395868-33395890 TACTCAGCACAGAGGGCAGAAGG + Intergenic
1081572167 11:44298487-44298509 CAGGCAGCACCCTGGGCAGGTGG + Intronic
1081942809 11:46958869-46958891 CACGCAGAACAAAAGGCAGAGGG - Intronic
1083048034 11:59754180-59754202 CAGCGAGCACAGCGGGCAGAAGG + Intronic
1083200401 11:61118058-61118080 CAGGCAGCCCACGGGGCAGGAGG + Intronic
1083327792 11:61881958-61881980 CTGGTAGAAAAAAGGGCAGAGGG + Intronic
1083550175 11:63582359-63582381 CAACCAGCACAGAGGGAAGAAGG + Intronic
1083667105 11:64281589-64281611 CAGGCAGAGAGAAGGGCAGATGG - Intronic
1084632713 11:70364930-70364952 AAGGCAGGCCACAGGGCAGAGGG - Intronic
1084767189 11:71320290-71320312 TTGTCAACACAAAGGGCAGAAGG + Intergenic
1084767460 11:71322055-71322077 TTGTCAGCACAAAGGGCGGAAGG - Intergenic
1085306079 11:75486847-75486869 TTTGCAGCACAAAGGGGAGAAGG + Intronic
1085524617 11:77157102-77157124 CAGGCAGCAATACGGGCAGGTGG - Intronic
1087961962 11:104363061-104363083 CAGGGAACAAAAAGGGCTGATGG - Intergenic
1089125556 11:116174199-116174221 AAGGAAACACAAATGGCAGAGGG - Intergenic
1089293032 11:117449950-117449972 CAGGCAGGACATAGGGCAAGGGG - Intronic
1089297092 11:117476204-117476226 CAAGCAGCCCACAGAGCAGAAGG - Intronic
1089663525 11:120001570-120001592 CAGAGAGCACACAGGGCAGGTGG - Intergenic
1090374523 11:126279625-126279647 CAGGCAGCAAGGAGGCCAGATGG + Intergenic
1091154930 11:133363317-133363339 AAGGCAGCGCAGAGGGCCGAGGG + Intronic
1091236725 11:134027045-134027067 AAAGGAGCACAAAGGGCAAAAGG + Intergenic
1202821864 11_KI270721v1_random:72473-72495 CAGGCAGCACAGAGGTCACCAGG - Intergenic
1092111290 12:5966601-5966623 CAGGCAGCACAGTGGCCAGAGGG - Intronic
1092895725 12:13008408-13008430 CAGACTGCACAAAGGAGAGAGGG - Intergenic
1095871554 12:47033889-47033911 CAGGCAACAGAGAAGGCAGATGG + Intergenic
1096122043 12:49094585-49094607 CAGGCACCAGAGAGGGCAGCAGG + Exonic
1096148214 12:49293581-49293603 CAGGACGCACAAAGGGGGGAGGG + Intronic
1096782799 12:54000689-54000711 CAGCAAGCACAAAGAGGAGAAGG + Exonic
1097169081 12:57102472-57102494 CAGCCACCACAAAGGGCACGCGG + Exonic
1097822918 12:64145772-64145794 GAGGCAGCACACAGGGGAGGTGG + Exonic
1099148630 12:79079866-79079888 GAGTCAGCACAAAGGACAGATGG - Intronic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1099424039 12:82501036-82501058 CAGGAAGGACAAAGGGCTAAGGG + Intergenic
1100602620 12:96124947-96124969 CAGCCTGCAGAAAGGGGAGAAGG + Intergenic
1101018960 12:100532133-100532155 CAGTGAGCACTAAGTGCAGAGGG - Intronic
1101094763 12:101326694-101326716 CAGGAAGGACAAAGGCCAGAAGG - Intronic
1101166114 12:102035621-102035643 CAGGTAGCACAAAGTGAAGAAGG + Intronic
1104705909 12:130947274-130947296 CAGGAAGAACAAAGGTCAAAAGG + Intergenic
1104714236 12:131005953-131005975 CAGGCTGCAGAGAGAGCAGAGGG - Exonic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1106393276 13:29356288-29356310 CAGACAGCTCACAGGGCACATGG - Intronic
1106753218 13:32796123-32796145 CGGACAGCACACAGGACAGAGGG - Intergenic
1107394243 13:39998793-39998815 CAGGCAGAACAACTGGGAGAGGG - Intergenic
1109339713 13:61040313-61040335 CAGGCAGCAGCAATGCCAGATGG - Intergenic
1111590244 13:90337034-90337056 CAGTCAGCACGATGGGGAGAAGG + Intergenic
1111859598 13:93685189-93685211 TAGGCAGCACAAAGGCCTCAAGG + Intronic
1113109917 13:106812046-106812068 CAGACAGCAGAAAGAGCATAGGG + Intergenic
1113284768 13:108834599-108834621 CAGGAAACATAAAGGGCAAAAGG - Intronic
1113550054 13:111185793-111185815 CAGGCAGCACCCAGGGGAGGAGG - Intronic
1113782387 13:112984054-112984076 CATGCAGGACAGAGGGGAGATGG - Intronic
1115879484 14:37899162-37899184 CAGGAAGCACAAATGCCACATGG - Intronic
1116795022 14:49380857-49380879 CAGCCAGGACAATTGGCAGAAGG - Intergenic
1117090368 14:52244116-52244138 CAGGCAGCACCATGTGCAAAGGG + Intergenic
1117468813 14:56021303-56021325 CAGGCAACAGAAAGGGCAGCAGG + Intergenic
1117598178 14:57344933-57344955 GAGGCAGCATGCAGGGCAGAAGG + Intergenic
1117989537 14:61420140-61420162 CATTTAGTACAAAGGGCAGAAGG - Intronic
1118887110 14:69876854-69876876 CTGGCAGCACAAAGTGCCCAGGG - Intronic
1118889234 14:69894204-69894226 CATGCACCACACAAGGCAGAGGG - Intronic
1118979278 14:70702901-70702923 CAGGCAGCAAGAAGGAAAGAAGG + Intergenic
1119894037 14:78205008-78205030 CCATCAACACAAAGGGCAGAAGG - Intergenic
1120506816 14:85362983-85363005 AAGGGAGCACAAAGGAAAGAGGG + Intergenic
1120995859 14:90418432-90418454 CAGGCAGCAAAATGGGCACAGGG - Intergenic
1121141048 14:91542287-91542309 CAGAAACCACAAAGGCCAGAAGG + Intergenic
1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG + Intronic
1121571542 14:94950156-94950178 GAGGCAGCACAAGGAGAAGAGGG + Intergenic
1121666734 14:95677911-95677933 CAGGCAGGAGAAAGGGCTGGAGG + Intergenic
1121939819 14:98059423-98059445 CAGGAAGGATAAAGGGGAGAGGG + Intergenic
1122153776 14:99738411-99738433 CAGGCAGAGCAAAGGGCAGTGGG - Intronic
1122389949 14:101373385-101373407 CGGGCAGCAGAAAGGGAAGTTGG - Intergenic
1122794684 14:104200229-104200251 CAGGCTGCACAGTAGGCAGATGG - Intergenic
1124252612 15:28116932-28116954 CAGGGAGCACAGAGGCCACATGG - Intronic
1126181583 15:45790760-45790782 CAGACTGAACAAGGGGCAGATGG - Intergenic
1127159674 15:56168794-56168816 AAGGCAGGAAAAAGGGAAGAAGG - Intronic
1128478918 15:68020583-68020605 CAGGCAGAGCAGAAGGCAGAAGG - Intergenic
1128498670 15:68212087-68212109 CAGGGAGCAAAAAGACCAGAGGG + Intronic
1128844123 15:70874319-70874341 CAGGAGGTACAAAGGGCAGGTGG + Intronic
1129034306 15:72640405-72640427 CTGGCAGCACGAGTGGCAGAAGG + Intergenic
1129198797 15:73986482-73986504 CAGGCAGCAGACAGCCCAGATGG + Intronic
1129215576 15:74096811-74096833 CTGGCAGCACGAGTGGCAGAAGG - Intergenic
1129732712 15:77941140-77941162 CTGGCAGCACGAGTGGCAGAAGG - Intergenic
1131962581 15:97805129-97805151 GAGGCAGGACAAAGAGAAGAAGG - Intergenic
1132143637 15:99414181-99414203 CAGGCAGCATATAGGGCTGGGGG + Intergenic
1132647088 16:1004044-1004066 CATGAAGCACATAGGGCAGTGGG + Intergenic
1132907285 16:2289300-2289322 GAGTCAGCACACCGGGCAGAGGG - Intronic
1133017653 16:2951668-2951690 CATGCAGCACAGGTGGCAGAGGG + Intergenic
1133255079 16:4511749-4511771 CAGTGAGGACACAGGGCAGACGG + Exonic
1134176465 16:12010821-12010843 CAGGAACAACAAAGGGCAGCTGG - Intronic
1135073347 16:19371524-19371546 CAGGCTGCAATAAGGGCAGCTGG + Intergenic
1135228754 16:20685238-20685260 GAGGCAGCATCAAGGCCAGATGG + Exonic
1136876109 16:33858260-33858282 CAGGAAGCACAAACAGCACAAGG + Intergenic
1137728781 16:50674621-50674643 CTGGGAGGAGAAAGGGCAGAGGG + Intronic
1138315453 16:56065838-56065860 GAGGCATCCCAAAGGGCATAAGG - Intergenic
1138613716 16:58147764-58147786 CAGGCAGCACTGAGGGAGGAGGG - Intergenic
1139248283 16:65469965-65469987 CAAGGAGCACAAAGTGCTGAGGG + Intergenic
1139345311 16:66299377-66299399 CAGGCAGAAAACAGGGAAGAAGG - Intergenic
1139945100 16:70635408-70635430 CAGGAAGCACAAAGGCCTGTTGG + Intronic
1140020064 16:71230326-71230348 CAGGTAGCCTGAAGGGCAGAAGG - Intronic
1140746307 16:77983319-77983341 CAAGAAGCACAGAGGGCAGGAGG + Intergenic
1142517029 17:438827-438849 CAGGCAGCAGCTAGGGGAGATGG + Intergenic
1142566448 17:843359-843381 CTGGGAGCACAAACGGCATATGG + Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1142745625 17:1956184-1956206 CAGGCAGCTCAGCAGGCAGAGGG + Intronic
1144327662 17:14197260-14197282 CAGACACCACAAAGGGGAAAAGG - Intronic
1144341327 17:14312709-14312731 GGGGCAGCACAAAGGGCAGGTGG - Intronic
1144661184 17:17071997-17072019 CAGACAGCCCAAAAGGCAGCAGG - Intronic
1145013524 17:19382841-19382863 CAGGCACACCAAAGGGCAGTGGG + Exonic
1145276633 17:21435292-21435314 CAGGCAGGGCAAAGAGCACAGGG + Intergenic
1145303565 17:21656964-21656986 CGGGCAAGACAAAGGGCAGAGGG - Intergenic
1145346477 17:22044885-22044907 GGGGCAAGACAAAGGGCAGAGGG + Intergenic
1145378674 17:22375225-22375247 CAGGAAGCAGAAAGAACAGACGG + Intergenic
1146138558 17:30344788-30344810 TAGGCAGCACCCAGGGCAGATGG + Intergenic
1147567537 17:41547030-41547052 CAGGGATCACAAAGGCCTGAAGG - Intergenic
1147859317 17:43508507-43508529 CAGGCAGCAGAAAGGTAACATGG + Exonic
1148128892 17:45250864-45250886 CAGGAAGGAGAGAGGGCAGAGGG + Intergenic
1148542704 17:48492987-48493009 CTGTCACCACAAAGGGCAGGAGG + Intergenic
1149457222 17:56797623-56797645 CAGACAGCACAAATAACAGAGGG + Intronic
1149494172 17:57106598-57106620 CAGTCAGCTCCAAGGGCAGAAGG + Exonic
1151163026 17:72181813-72181835 CAGGAAAGGCAAAGGGCAGAAGG - Intergenic
1151334674 17:73432930-73432952 GAGGAAGCACACAGGGCAGATGG + Intronic
1152096227 17:78273239-78273261 CAGGCAACCAAAAGGGCAAATGG - Intergenic
1152310219 17:79545447-79545469 CAGGCAGGGGCAAGGGCAGAGGG - Intergenic
1152395723 17:80031633-80031655 AAGGGTGCACAAATGGCAGATGG - Intronic
1152714933 17:81894634-81894656 CAGGCAGCAGACAGCACAGAGGG - Intronic
1153119121 18:1700150-1700172 CAGGAAGCGCAAAGAGCAGGGGG + Intergenic
1153394143 18:4598793-4598815 TAAGCAGCAAAAAGGGCAAAAGG - Intergenic
1154310877 18:13265417-13265439 CAGGCAGCACAGTGGGAAGGGGG - Intronic
1155353875 18:24932226-24932248 CAGGCAGCTCCCAAGGCAGATGG - Intergenic
1155619503 18:27761267-27761289 CAGTTAGCACAAAGGACAGTGGG + Intergenic
1156555660 18:38065094-38065116 CAGCCAGCAAAAAGTCCAGAGGG + Intergenic
1158317247 18:56224886-56224908 CAGGCAGCACAGAGCACTGAGGG - Intergenic
1158986980 18:62827792-62827814 CAGACTGGACAAAGGCCAGAAGG - Intronic
1159868685 18:73735941-73735963 GAGGCAGAACAAAGTGGAGAAGG + Intergenic
1160717244 19:581974-581996 CACGCAGCCCAAGGGGCAGAAGG - Intronic
1161327013 19:3668864-3668886 ACGGCAGCACAAAGGTCACAAGG + Intronic
1161751663 19:6102139-6102161 CAGGCAGCAGATGGGGGAGAGGG - Intronic
1162207375 19:9065843-9065865 CAGGCAGAACCAAGGGCCCAGGG - Intergenic
1163396845 19:17068867-17068889 CTGGCAGCATGAAGGGCTGATGG + Intronic
1163725502 19:18921172-18921194 CAGGCAGCAGAAAGGGTACTGGG + Intronic
1164500917 19:28819573-28819595 CTGCCAGCACAGAGGGCAGAGGG - Intergenic
1164590508 19:29504379-29504401 CAGGCAGAAGAAACGGCAGCTGG + Intergenic
1164687220 19:30174929-30174951 CAGGCAGCATGAAAAGCAGAAGG - Intergenic
1165934304 19:39380070-39380092 CCGGCAGCAGAAAGGGTAGGCGG + Exonic
1165996735 19:39848978-39849000 CTAGCAGCACAAAGGGGAGCAGG - Intergenic
1167497359 19:49827462-49827484 CAGGCACCAGGAAAGGCAGAAGG - Intronic
1168449019 19:56448565-56448587 CTGGCAGCTCCAAGGGGAGAGGG + Intronic
1168598287 19:57696549-57696571 CAGGCAGCAGAGGGAGCAGAGGG + Intronic
1168714408 19:58518600-58518622 CAGGCACCAGAAAGGGGAGGGGG + Intronic
925904272 2:8529940-8529962 CTGGCAGCAGACAGGCCAGAGGG - Intergenic
926728173 2:16014625-16014647 CAGCCTGCAGAAAGTGCAGATGG - Intergenic
927197965 2:20560970-20560992 CAGTCCCCACAAGGGGCAGAGGG + Intronic
927321677 2:21754556-21754578 CTCGCAACACAAAGGGCAAAAGG + Intergenic
927859849 2:26553775-26553797 GAGGAAGGAGAAAGGGCAGACGG - Intronic
928462620 2:31489270-31489292 CAGGAAGCACAAGGGGTGGAGGG + Intergenic
928872472 2:35997014-35997036 CAAGCAGCAAAAGGAGCAGATGG - Intergenic
929911571 2:46094159-46094181 CAGCAGGCACACAGGGCAGAAGG - Intronic
931258349 2:60595027-60595049 AAGGCAGCAAACTGGGCAGATGG + Intergenic
931314685 2:61117519-61117541 CAGGATGCACAAAGAGAAGACGG + Exonic
932129909 2:69178324-69178346 CAGGCAGCACAAAGGCCCAGGGG - Intronic
932796552 2:74700795-74700817 CATGCAGAACAAAGGACAGAAGG + Intergenic
933784042 2:85824160-85824182 CAAGCAGCAGAAAGGACAGCTGG + Intergenic
933941844 2:87251683-87251705 CAGGCAGCATCAAGCCCAGAAGG - Intergenic
935413377 2:102788746-102788768 GAGGAAGCACACTGGGCAGAAGG - Intronic
935745728 2:106188683-106188705 CCCGCAGCACTAAGGTCAGAAGG + Intronic
935931034 2:108125805-108125827 CAAGCAGAACATAGGCCAGATGG - Intergenic
936062765 2:109306444-109306466 CAGGCTGCACATACCGCAGAAGG + Intronic
936338379 2:111609886-111609908 CAGGCAGCATCAAGCCCAGAAGG + Intergenic
937071526 2:119067276-119067298 CAGGCAGCACAAAGGGCTCAGGG + Intergenic
937142826 2:119616854-119616876 CAGGCAGCACAAGAAGCACATGG - Intronic
937382631 2:121394434-121394456 CAGAAACCACAAAGGACAGAAGG - Intronic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
940180483 2:150926760-150926782 GAGGCAGGAGAAAGGGCACATGG - Intergenic
941725666 2:168857492-168857514 CACTCAGCACAAAGGCCAGGAGG - Intronic
942779897 2:179629725-179629747 CAGGAAGCACAAGGGGCTGGGGG + Intronic
944507235 2:200425138-200425160 CAGGAAGCACAAATGGCGGGGGG - Intronic
945174706 2:207030952-207030974 TAGGCAGTATAAAGGGGAGAGGG + Intergenic
945547381 2:211173322-211173344 CAGGGAGTACAAAGTGAAGAGGG - Intergenic
945946428 2:215999997-216000019 CAGGCAGGACAAACAGCAGGTGG + Intronic
946170076 2:217889909-217889931 CAGGCAGCATCAGGGGCAGGAGG - Intronic
946313891 2:218897290-218897312 GAGGCAGCAGAAAGGGGAGGGGG + Intronic
946430202 2:219622166-219622188 CTGGAAGAACAAAAGGCAGAAGG + Intergenic
948692156 2:239712860-239712882 CAGACAGAGCAAAGGGCAGTGGG + Intergenic
948929731 2:241124301-241124323 CAGGCAGCACCAAGGCCTGGAGG + Intronic
1169536003 20:6541179-6541201 CAGGCAGCAGAAAGGAGAAAGGG - Intergenic
1170586333 20:17737068-17737090 CAGCCCACACATAGGGCAGAGGG + Intergenic
1170599678 20:17831665-17831687 CCGGCAGCACTAAGAGCAGTCGG - Intergenic
1170732053 20:18984338-18984360 CAGTGCGCACAAAGGCCAGAGGG - Intergenic
1170853223 20:20022962-20022984 CCGGCAGCAGAAACAGCAGAGGG + Intronic
1171187344 20:23132319-23132341 CAGGGAGCTCATATGGCAGAAGG + Intergenic
1171468270 20:25348332-25348354 CAGGGATCAAAAAGGTCAGATGG + Intronic
1171521086 20:25774649-25774671 TGGGCAAGACAAAGGGCAGAGGG - Exonic
1171555840 20:26081830-26081852 TGGGCAAGACAAAGGGCAGAGGG + Intergenic
1171943967 20:31359286-31359308 AAGGCAGAACAAAGGGAAGAAGG + Intergenic
1172192069 20:33068123-33068145 GGGGCTGCACAAAGGGCAAAAGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173066070 20:39713290-39713312 GAGGCAGGACTAAGGGAAGATGG + Intergenic
1173123987 20:40319968-40319990 GAGGCATTACAAAGGGCAAAGGG + Intergenic
1173220041 20:41125151-41125173 CAGGGAGCAGGAAGGCCAGAAGG + Intergenic
1173603177 20:44310584-44310606 CAGGCAGGACAGAGGTGAGATGG + Intronic
1174089385 20:48034901-48034923 CAGGCAGGACAAAGGGCACCTGG + Intergenic
1174310284 20:49647869-49647891 AAGGCAGCACAGAGTACAGAAGG - Intronic
1175114700 20:56673881-56673903 CTGGCAGCACAAAGAGCCAATGG + Intergenic
1175206894 20:57317971-57317993 CAGGGGGCACAAGGGGCAGAAGG - Intergenic
1175738848 20:61406452-61406474 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738853 20:61406480-61406502 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738867 20:61406550-61406572 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738880 20:61406620-61406642 CAGGCAGAACAGATGGCAGATGG - Intronic
1175738895 20:61406690-61406712 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738942 20:61406921-61406943 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175826948 20:61941695-61941717 CAGGAGGCACGGAGGGCAGAGGG - Intergenic
1175894024 20:62328135-62328157 CAGGGAGCACAAATGGGAGCAGG + Intronic
1176654936 21:9579766-9579788 CGGGCAAGACAAAGGGCAGAGGG - Intergenic
1176975457 21:15315780-15315802 TAGGAAGCTCACAGGGCAGAGGG - Intergenic
1177746523 21:25221891-25221913 CAGGCACAAACAAGGGCAGATGG - Intergenic
1177802660 21:25843115-25843137 CAGGCAGCAGAAAGGGAATGTGG - Intergenic
1177818295 21:26002235-26002257 CAGTCAGCACTAAGCCCAGAAGG - Intronic
1178359881 21:31939926-31939948 CAGACAGCAAAGAGGACAGAAGG - Intronic
1179281760 21:39939739-39939761 TAGCCAGCACACAGGGCAGCTGG + Intergenic
1179527473 21:41991831-41991853 GAGGCTGCAGTAAGGGCAGACGG + Exonic
1180116299 21:45707750-45707772 CAGGCAGCACACAGAGAAGCAGG - Intronic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1180997200 22:19971455-19971477 CAGGTAGCACCAAGGGCGCAGGG + Intronic
1181025375 22:20124582-20124604 CAGGCAGCCCCAAGGGGAGATGG - Intronic
1181133247 22:20746840-20746862 CAGGCCCCACAAAAGCCAGAGGG + Intronic
1182115759 22:27755386-27755408 CAGGCAGCACAGGGGGCCGAGGG + Intronic
1183460504 22:37947194-37947216 CAAGCAGCCCACAGGGCAGGTGG - Intronic
1183809942 22:40247068-40247090 CAGACAACAGACAGGGCAGAGGG - Intronic
1184066254 22:42123519-42123541 CATGCAGCCCACAGGGGAGATGG + Intergenic
1184068722 22:42135671-42135693 CATGCAGCCCACAGGGGAGATGG + Intergenic
1184253762 22:43275768-43275790 CAGGGAGAACAACAGGCAGATGG + Intronic
1184606304 22:45576601-45576623 GAGACAGCAGAAAGGCCAGAGGG - Intronic
1184834823 22:47014913-47014935 CAGGCAGCTCAGAAGGGAGAGGG - Intronic
1184842190 22:47058557-47058579 CAAGCAGAAGAGAGGGCAGAGGG - Intronic
1185108943 22:48890106-48890128 GAGGCAGCACAAAGGCTGGAAGG + Intergenic
1185126187 22:49012018-49012040 CAGCAAGCTCAAAGGCCAGAAGG - Intergenic
1185149813 22:49157803-49157825 CAGGATGCAGGAAGGGCAGAAGG + Intergenic
1203281678 22_KI270734v1_random:134976-134998 AGGGCAGCACAAAGGGTGGAGGG + Intergenic
949346592 3:3082671-3082693 GTGGCAACACAGAGGGCAGAAGG + Intronic
950047685 3:9959723-9959745 GAGGCAGCACTAGGGCCAGATGG - Intergenic
950420483 3:12895837-12895859 CAGAGAGCAGAAAGGGCACATGG + Intergenic
951266751 3:20577230-20577252 CAGGCAGCACAGTGTGGAGAAGG + Intergenic
952185781 3:30966865-30966887 AAGGAAGGAAAAAGGGCAGAAGG + Intergenic
952519596 3:34143316-34143338 CAGGAAGAACAAGGGGGAGAAGG - Intergenic
953228278 3:41040946-41040968 CAGGCAGCAACAAGAGCAGGAGG - Intergenic
953240538 3:41144784-41144806 CTGGCAACAGAAAGAGCAGATGG + Intergenic
953905959 3:46868418-46868440 CCGTCAGCACAGTGGGCAGAGGG - Intronic
954034144 3:47841499-47841521 CAGGGAGCCAGAAGGGCAGAAGG - Intronic
954035502 3:47848955-47848977 CAGCCCGCACAAAGGCCAGGTGG - Exonic
954328993 3:49879138-49879160 AAGGCAGCATCAAGGGAAGAGGG - Intergenic
954385928 3:50243837-50243859 CAGGCAGGACAGCAGGCAGACGG + Intronic
954618450 3:51982578-51982600 CTGGGAGTACAAAGGGCAGCTGG + Intronic
954985351 3:54785883-54785905 CAGGCAGGAGACAGGGTAGATGG - Intronic
956165226 3:66393244-66393266 CAGTGAGCACAAAAGGCAGGAGG + Intronic
956749037 3:72331857-72331879 CAGGGAGCAGTAAGGGCTGATGG - Intergenic
956759033 3:72421345-72421367 ATAGCAGCACAAAGGCCAGAAGG + Intronic
957307712 3:78479824-78479846 CAGGCAGCAAAAAAATCAGAAGG + Intergenic
957572685 3:81968739-81968761 CAGGGACCACAACGGCCAGAGGG - Intergenic
959137625 3:102444156-102444178 CAGGCAGCAAAAAAAGCAAATGG - Intronic
960066468 3:113378990-113379012 CAGGCAGGTCAAAGAGGAGAAGG - Intronic
960966647 3:123110343-123110365 CACGGAGCACACAGGGCAGAAGG - Intronic
961787701 3:129357594-129357616 CAGGCAGGAAAGAGGGGAGAAGG - Intergenic
961957676 3:130820998-130821020 CATGTAGCAAAAGGGGCAGATGG + Intergenic
962291428 3:134140060-134140082 CAGGAAGCACAAGGGGTAGGGGG + Intronic
963179240 3:142336565-142336587 AAGGAAGGACAAAGGGGAGAAGG + Intronic
963305891 3:143652619-143652641 AAGGCAGCAAAGGGGGCAGAGGG - Intronic
964303762 3:155318587-155318609 CATGCAGCACTCAGGGCAGCTGG + Intergenic
964649467 3:158994611-158994633 CAGTTAACACAAAGGACAGATGG - Intronic
965355592 3:167669181-167669203 GAGGCAGGATAAAGGGAAGAGGG - Intergenic
966593433 3:181705096-181705118 GAGCCAGCAAAAAGGGAAGAAGG + Intergenic
966855014 3:184187890-184187912 CAGGCAGCAGAAAGGAGAGTCGG + Exonic
966943159 3:184759706-184759728 CAGCCAGCACAGACGGCGGATGG + Intergenic
967322607 3:188209502-188209524 CAGCCAGCAGACAGGGCAGCAGG - Intronic
968488025 4:873590-873612 CAGGCAGCACAAAGGGCAGAAGG - Intronic
968588804 4:1447411-1447433 CAGGCAGCAGGAGGGGCACAGGG + Intergenic
968680115 4:1912656-1912678 CAAGAAGCAGAAAGGGAAGATGG - Intronic
968726539 4:2250514-2250536 CAGGCAGGCCAAGGAGCAGAGGG + Exonic
969293942 4:6258095-6258117 CAGTGAGCACAAAGGCCAGCTGG + Intergenic
969471668 4:7392726-7392748 CAGGCATCACAGAGGGGGGAGGG + Intronic
969956570 4:10897226-10897248 CAGGCATCAGAGAGGCCAGAAGG + Intergenic
970189637 4:13501473-13501495 AAGGAAGAACATAGGGCAGATGG - Intergenic
970399773 4:15706001-15706023 CGAGCAGGACCAAGGGCAGAGGG + Intronic
970752061 4:19375897-19375919 CTGGCACCAAAAAGGACAGAAGG - Intergenic
971347380 4:25823697-25823719 CAGGAACCACAAGGGGCAGATGG + Intronic
972529808 4:39951183-39951205 GAGGCAGAACAGAGGCCAGATGG - Intronic
972585862 4:40436625-40436647 CAGGCAGCATAAGAGGCCGAGGG - Exonic
974805806 4:66879069-66879091 CAGGAAGCTCAGTGGGCAGATGG + Intergenic
976125133 4:81826340-81826362 CTGGCAGCACAAAGAGCAAGAGG - Intronic
981105128 4:140872515-140872537 TTGGCAGGACAATGGGCAGAAGG + Intronic
981850946 4:149229586-149229608 CAGGAAGCACAAGGGGTTGAGGG + Intergenic
983404296 4:167307023-167307045 CAAGCAGAATAAAGGGCACATGG + Intergenic
983986725 4:174068449-174068471 CTGCCAGCCCAAAGGTCAGAGGG - Intergenic
984148575 4:176095712-176095734 AAGGAAGGACAAAGGGCTGAAGG - Intronic
985709051 5:1417941-1417963 CATGCTGCCCAAAGGACAGAGGG - Intronic
985769230 5:1798749-1798771 CAGGCAGCAGATGGGGCAGGAGG + Exonic
985881407 5:2641562-2641584 AAGACAGCTCAAGGGGCAGAGGG - Intergenic
985966017 5:3339217-3339239 CACGGTGCACAAAGAGCAGAGGG + Intergenic
986165661 5:5269606-5269628 CTCCCATCACAAAGGGCAGATGG + Intronic
986932369 5:12842167-12842189 AAGGCAACAGAAAGGGCAGTAGG + Intergenic
987327946 5:16829230-16829252 CAGGCAGCACCCAGGGCACAGGG - Intronic
988063604 5:26205396-26205418 CAGAAAGCAGAATGGGCAGAAGG - Intergenic
988167898 5:27617554-27617576 CAGGAAGCACAAAGAGCTGGGGG - Intergenic
988722858 5:33895600-33895622 CAAGCAGGTCAAAGGGTAGAAGG + Intergenic
991105424 5:62837274-62837296 CAGGAAGCACAAGGGGTAGGGGG + Intergenic
992297330 5:75337790-75337812 CCGGCAGCTCGCAGGGCAGACGG + Intronic
992746943 5:79829540-79829562 CAGGCAGCACTAAGTGCTGGAGG + Intergenic
994165991 5:96608826-96608848 CAGGCAGAAGAAAGAGCAGGAGG + Intronic
996199536 5:120654157-120654179 CAAGCAGCAAAAAAGGGAGAAGG - Intronic
996682147 5:126239213-126239235 CACTCAGGACAAAGGGCACAAGG - Intergenic
996789344 5:127275990-127276012 CAGCCAGCCCAAAGGGTAGTAGG + Intergenic
997297052 5:132775024-132775046 CTGACAGCCCAAAGTGCAGAGGG + Intronic
997364036 5:133314136-133314158 CAGGGAGCACCAAGGGCAGGTGG - Intronic
997603009 5:135153241-135153263 AAGGCAGCAGAAGGAGCAGAGGG - Intronic
998182819 5:139957128-139957150 CAGGCAGGAGCATGGGCAGAAGG - Intronic
998394885 5:141812034-141812056 CAGGCAGCACCGAGTGCAGCAGG + Intergenic
998629211 5:143879842-143879864 GAGTCAGCACAAAGGGTCGAGGG + Intergenic
999293385 5:150442196-150442218 CAAGCAGCATAAAGGACAGCTGG - Intergenic
999377279 5:151095616-151095638 CTGGCAGCACAACAGGCAGATGG + Intergenic
999383040 5:151135063-151135085 GAGGATGCACAAAGGGAAGAGGG + Intronic
999428931 5:151509796-151509818 CAGGCAGGAGAAACGGGAGATGG - Intronic
999500153 5:152138881-152138903 AAGGCTGCACGAAGGGGAGATGG + Intergenic
999963471 5:156783002-156783024 CAGGAAGCACAAGGGGTTGAGGG + Intergenic
1001556179 5:172638794-172638816 GGGACAGCACAAAGTGCAGAGGG + Intergenic
1002095062 5:176825737-176825759 ATGGCAGCAAAATGGGCAGAAGG + Intronic
1002307696 5:178293533-178293555 CAGGCAGCAGAAAGGGCCACGGG + Intronic
1002325865 5:178405127-178405149 CTGGCAGCCCAAGGGCCAGATGG + Intronic
1006397966 6:33799292-33799314 CAGACAGCACCCTGGGCAGATGG - Intronic
1006609762 6:35287308-35287330 CAGGCAGCACAACATCCAGAGGG - Intronic
1006861565 6:37174709-37174731 GAGGCAGAAAAAAGGGCAGGTGG - Exonic
1007210481 6:40189869-40189891 CAAGCTCCACAAAGGGCAGATGG + Intergenic
1007584408 6:42979938-42979960 CAGGCAGCAGAGCAGGCAGAAGG + Intergenic
1007702810 6:43774347-43774369 CAGGCTGCACCCATGGCAGAAGG + Exonic
1008464734 6:51817760-51817782 CAGGAAGCACAAAGATGAGAAGG + Intronic
1009498567 6:64382157-64382179 CAGGCAGAAAAACAGGCAGAGGG - Intronic
1009848511 6:69164994-69165016 CAGGCAGAATAAAGGTCTGAGGG - Intronic
1010058130 6:71588973-71588995 CAGGCAGCACCAGTTGCAGAAGG + Intergenic
1010760760 6:79719776-79719798 GAGTCAGCACAGAGGGCAGTGGG - Intergenic
1011409685 6:87055082-87055104 CAGGGAGGAGAATGGGCAGAGGG - Intergenic
1013163330 6:107567209-107567231 CAGGAAGCACATTGGGAAGACGG + Intronic
1013769509 6:113612031-113612053 CAGGCAGCTGAGATGGCAGAGGG + Intergenic
1014533278 6:122586380-122586402 CAGTCAGCTGAAAGGACAGATGG - Intronic
1014900859 6:126963511-126963533 GAGGCACAACAAAGGACAGAAGG - Intergenic
1015411413 6:132897883-132897905 CAGGCAGCTGAAAAGGAAGAGGG - Intergenic
1016486832 6:144549769-144549791 CAGGAGGCACAAAGGACAGTAGG + Intronic
1016510410 6:144836439-144836461 CAGGCAGCACAAAGGTCGGCTGG + Exonic
1017177470 6:151518310-151518332 CAGGCAGCTCCAGGGGCTGAGGG + Intronic
1018095698 6:160385521-160385543 CAGACAGTACAGAGGTCAGAGGG - Intronic
1018499751 6:164394463-164394485 AAGGCAGGAAAAAGGGCAAAAGG - Intergenic
1018777129 6:167027951-167027973 CAGGACGCACAAAGAGCAGATGG - Intronic
1020361404 7:7330414-7330436 CAGACAGGACGAAGAGCAGAAGG - Intergenic
1022412776 7:30152242-30152264 GATGCAGCACAATGGGCAGGAGG - Intronic
1022910375 7:34895276-34895298 CAGCCAGGACAATGGGGAGAAGG + Intergenic
1023290025 7:38659050-38659072 CAGGAAGCACAAAGGCCCTATGG + Intergenic
1024097602 7:45996396-45996418 CAGCAAGCATGAAGGGCAGAAGG + Intergenic
1025281563 7:57629597-57629619 CGGGCAAGACAAAAGGCAGAGGG - Intergenic
1025303167 7:57835918-57835940 CGGGCAAGACAAAAGGCAGAGGG + Intergenic
1025851834 7:65250632-65250654 CCGGCAGAACCAAGGGCAGCAGG + Intergenic
1026536815 7:71245360-71245382 CAGGCAGCACAAAGTAAAAATGG - Intronic
1026977259 7:74506402-74506424 CTGGCACCACAAAGGGCACCAGG - Intronic
1027334682 7:77136643-77136665 TAGGAAGCACAAAGTTCAGATGG + Intronic
1027360541 7:77404114-77404136 AAAGCAGCACACAGGGCACAAGG + Intronic
1028553588 7:92099030-92099052 CAGGAAGTAGAAAGGGAAGATGG - Intronic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029596848 7:101542577-101542599 CACTCAGAACAGAGGGCAGAGGG - Intronic
1030858318 7:114589761-114589783 CAGGGAACATAAAGGGCAAAGGG - Intronic
1031049959 7:116934994-116935016 CAGGGAGGAAGAAGGGCAGAGGG - Intergenic
1032327412 7:130943356-130943378 CAGGCAGCAGAAAGGCTAAATGG + Intergenic
1033003866 7:137538919-137538941 CAGGCAGCATAAAGCCCAAAAGG + Intronic
1033194903 7:139319425-139319447 CAGGCAGCCAAAAGGAAAGAAGG - Intergenic
1033602001 7:142895002-142895024 CAGGCAGACCAAAGTGCAGAAGG + Intergenic
1033674004 7:143519855-143519877 CAGACAGCACACTGGGCAGGTGG - Intergenic
1035415051 7:158676213-158676235 TAGGAAACACAAAGGGCAGAGGG + Intronic
1036483465 8:9158540-9158562 CACGCATCTCAGAGGGCAGAGGG + Intronic
1037875466 8:22544985-22545007 CAGGCAGAAAAGATGGCAGAGGG + Intronic
1038162172 8:25050129-25050151 CAGCCAGCAGAGAGGCCAGAGGG + Intergenic
1039424794 8:37477070-37477092 CATGCAGCAGAAGGGGCAAAAGG + Intergenic
1041381597 8:57258848-57258870 CTGGCTGCACAAAGGGTTGAGGG - Intergenic
1042785204 8:72537824-72537846 CGGGCACCACAAAGGGCTGTGGG - Exonic
1045911037 8:107410134-107410156 CAGCCTGGACAAAGGTCAGAGGG + Intronic
1049173486 8:141176778-141176800 CAGCCACAGCAAAGGGCAGAGGG - Intronic
1049421655 8:142519283-142519305 CCGGCAGCTCATAGGGCACAGGG - Intronic
1049636077 8:143690154-143690176 CAGGCAGCCAGCAGGGCAGAAGG - Intronic
1049657385 8:143804846-143804868 CAGGGAGGCCCAAGGGCAGAAGG + Intronic
1051538601 9:18188847-18188869 CAGGCAGCATTAAGGGCTGTTGG + Intergenic
1051814178 9:21086120-21086142 CAGGAAGCACAATGCCCAGATGG - Intergenic
1054921751 9:70550286-70550308 CAGGCAGGAAAAAGAGGAGAAGG - Intronic
1054966796 9:71037789-71037811 CAGGCAGGAAGAATGGCAGATGG - Intronic
1055400405 9:75917530-75917552 GAGGCAGCTCAAAGAGTAGATGG + Intronic
1055783607 9:79847312-79847334 CAGAGAGAACAAAGGGCAAAGGG - Intergenic
1056308757 9:85319166-85319188 ATGGCAGCTCCAAGGGCAGATGG + Intergenic
1056713985 9:89013613-89013635 CAGGCAGCAAAAAGAGAAAATGG + Intronic
1057231630 9:93324873-93324895 CAGGCAGCACAGTGGGCTTAGGG + Intronic
1057236457 9:93365739-93365761 CAGGCAGCACAGTGGGCTTAGGG - Intergenic
1057286970 9:93764529-93764551 CAGCAAGGGCAAAGGGCAGAAGG - Intergenic
1058081992 9:100710376-100710398 CAGGAAGCACAAGGGGCCAAGGG - Intergenic
1058204668 9:102088477-102088499 CAAGCAGCACAAAGATCAAAGGG - Intergenic
1058450287 9:105090098-105090120 CAGGCTGGAAAAAGGGCAAAGGG + Intergenic
1058884586 9:109313676-109313698 CAGGCAGCACACAGCGCAGATGG + Intronic
1059221083 9:112619182-112619204 CAGGCAACACAAAGTAGAGAGGG + Intronic
1059812652 9:117873055-117873077 CATGGAGCCCAAAGGGTAGATGG + Intergenic
1060606446 9:124918837-124918859 CAGGAGGCAGAAAAGGCAGAAGG - Intronic
1060818247 9:126646808-126646830 GAGCCAGCACAAGGAGCAGAGGG - Intronic
1061873653 9:133533560-133533582 CAAGCTGGACAGAGGGCAGACGG + Intronic
1062359187 9:136179334-136179356 GAAGCAGGACAAAGGGCAGGCGG - Intergenic
1062701321 9:137905906-137905928 GAGGCAGCCCAGAGGGCACAAGG - Intronic
1203632661 Un_KI270750v1:83219-83241 CGGGCAAGACAAAGGGCAGAGGG - Intergenic
1187246803 X:17560199-17560221 CAGGCAGCCCAAAGGAGAGAGGG - Intronic
1187933950 X:24318090-24318112 CAGGGATCACAAAGGGAAGCTGG + Intergenic
1188662902 X:32781602-32781624 CAAGCAGCAGCAAGGGAAGAGGG - Intronic
1190726768 X:53195018-53195040 CAGACAGCACCAAGCGCAGCCGG - Exonic
1190801616 X:53794658-53794680 TAGGCTGCACATAAGGCAGAGGG + Intergenic
1192148824 X:68699259-68699281 CAGGCAGAGCTCAGGGCAGAAGG + Intronic
1192251735 X:69418936-69418958 CAGGCAGCACAGTGCACAGAGGG - Intergenic
1193359924 X:80569976-80569998 CTGGGAGCACAGAGGGGAGAGGG - Intergenic
1194195225 X:90883715-90883737 AAGGCAGCAAAAATGGCAGCTGG + Intergenic
1195210913 X:102651786-102651808 CAGGCCGGACCAAGGGCTGAGGG + Intronic
1195430039 X:104778940-104778962 CAGGCAGCTCAGGGGACAGATGG + Intronic
1195679492 X:107533568-107533590 CAGTCAGGAGGAAGGGCAGATGG - Intronic
1195810698 X:108825467-108825489 CAGGAAGCACAAGGGGTCGAGGG - Intergenic
1196060681 X:111404865-111404887 CAGGCAGCAGGAAGTGCAGGAGG - Intronic
1199714958 X:150501059-150501081 CAGGCAGAAAAAACTGCAGATGG - Intronic
1199778578 X:151037568-151037590 CAGGAAGCCCAGTGGGCAGAAGG + Intergenic
1200286972 X:154832326-154832348 AAGGCAGCATAAAGGGAAAATGG - Intronic
1201938673 Y:19435090-19435112 CAGGAAGCACAAAGGGTTGGGGG + Intergenic
1202111018 Y:21420713-21420735 CAGGCAGCTGAATGGGCAGTGGG + Intergenic