ID: 968489067

View in Genome Browser
Species Human (GRCh38)
Location 4:880526-880548
Sequence CTGGAAGGCACAGTCTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968489067_968489076 13 Left 968489067 4:880526-880548 CCCACAGAGACTGTGCCTTCCAG 0: 1
1: 0
2: 2
3: 27
4: 224
Right 968489076 4:880562-880584 TTCCAGTCCTGCAACCCTGAAGG 0: 1
1: 0
2: 0
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968489067 Original CRISPR CTGGAAGGCACAGTCTCTGT GGG (reversed) Intronic
900621821 1:3591048-3591070 CTGGGAGGCTCTGCCTCTGTGGG - Intronic
900739543 1:4322320-4322342 GTGGAAGACACAGTCTCTTTTGG + Intergenic
900752436 1:4407115-4407137 CTGGCAGCCAAAGTCTCTCTGGG - Intergenic
902722917 1:18316065-18316087 CTGGAAGGCAGAGCCCCTGATGG + Intronic
904661149 1:32086264-32086286 CTTCAAGGCAGAGTCTCTCTTGG + Intronic
905464368 1:38141544-38141566 CTGCAAGCCGAAGTCTCTGTCGG - Intergenic
906639736 1:47434494-47434516 CGGGAAGCCACAGGCTCTGCGGG - Intergenic
906680241 1:47721381-47721403 CTGGAATGGACATTCTCTTTGGG - Intergenic
906941300 1:50257818-50257840 CTGGATGGCATAGTGTATGTGGG + Intergenic
908067994 1:60428188-60428210 CTGTAATGCACAGTAACTGTAGG + Intergenic
908079899 1:60565471-60565493 CTGGCAGGCAAGGTCTCAGTGGG + Intergenic
911124032 1:94323530-94323552 CAGGAAGGCACCGTCACTGGTGG - Intergenic
914258315 1:145978178-145978200 CTGGGGGGCACTATCTCTGTTGG - Intronic
914504207 1:148274755-148274777 CAGGAAGGCCCAGTCTTTGGTGG - Intergenic
914806257 1:150994371-150994393 CAGGAAAGATCAGTCTCTGTGGG - Intronic
915553292 1:156647274-156647296 CTGGAAGGCGCAGCCTGGGTTGG + Intronic
920031233 1:203038603-203038625 CTGGAGGGCAGTGTGTCTGTGGG - Intronic
920699856 1:208209618-208209640 CTGGAGGGCACAGGCTGTCTGGG - Intronic
922794530 1:228333521-228333543 CTGGAGGGCACAGTGCCCGTGGG + Intronic
923234661 1:232020990-232021012 CAGGATGGCATAGTCTCTGCAGG - Intronic
924248593 1:242108579-242108601 CTGGAAGTGACAGTGTGTGTTGG - Intronic
924529088 1:244878222-244878244 AAGGAAGGCACAGTCTCATTAGG + Intergenic
1063229799 10:4053880-4053902 TTGGAAAGAACAGTTTCTGTGGG - Intergenic
1063668613 10:8081746-8081768 CTGGAAGCCACTGTTTCTGATGG - Intergenic
1067003351 10:42638286-42638308 CTCTAAGGCGCAGCCTCTGTAGG - Intronic
1067452997 10:46393770-46393792 CTGGATGGCAGGGTGTCTGTGGG + Intergenic
1067584235 10:47465990-47466012 CTGGATGGCAGGGTGTCTGTGGG - Intronic
1067759627 10:49035030-49035052 CAGGGAGGGACAGTCTCTGCAGG + Intronic
1070784258 10:79154014-79154036 CTGAAGGGCACAGGCACTGTCGG - Intronic
1072904976 10:99444774-99444796 CTGGAAGCCTCCCTCTCTGTCGG - Intergenic
1073123272 10:101134603-101134625 CTGGTTGGCACACTCTCTGCCGG + Intronic
1075687173 10:124372314-124372336 CATGAAGGCACAGTCACAGTGGG + Intergenic
1078492375 11:11781396-11781418 CTGAAAGTCACATTCTGTGTAGG + Intergenic
1078759137 11:14237718-14237740 CGGGAAGGCACAGGCTCCTTGGG - Intronic
1079602394 11:22325745-22325767 CTGGTTGCCACAGTATCTGTTGG - Intergenic
1081038514 11:38180482-38180504 CAGGAAGTCTCAGTCTCTGTTGG - Intergenic
1081606441 11:44530041-44530063 GAGGAAGGCTCAGTCTCTTTAGG + Intergenic
1081878638 11:46428873-46428895 ATGGCAGGCACAATCTCTGGGGG + Intronic
1083058903 11:59849099-59849121 CTGGAAGTCAGAGTCTCACTGGG - Intergenic
1083192979 11:61065931-61065953 CTGGAAGGTGCAGTGCCTGTCGG + Intergenic
1083342856 11:61969531-61969553 CTGGAAAGTACAGTTTATGTTGG + Intergenic
1083744161 11:64726041-64726063 CTCCAAAGCACAGTATCTGTGGG - Intergenic
1084190927 11:67498396-67498418 CTGGCAGGCCCTGGCTCTGTGGG + Intronic
1084455919 11:69268128-69268150 CTGGTGGGCACAGCCTCTCTGGG - Intergenic
1084483260 11:69434109-69434131 CTGGGGGGGACAGTCTCTGATGG + Intergenic
1085259410 11:75195739-75195761 CTGAAAGGCGCAGCCTCTCTGGG + Intronic
1085260872 11:75203981-75204003 GAGGAGGGCACAGTTTCTGTGGG + Intronic
1085482744 11:76836375-76836397 CTTAAAGCCACAGTCTCTGGAGG - Intergenic
1087841913 11:102929177-102929199 TTGGAAAGCACAGTCTCAGTAGG + Intergenic
1087850835 11:103027564-103027586 CTGGAGGGCCCTGTCTCTGTGGG + Intergenic
1089288312 11:117421658-117421680 GTGGGAGGCACAGGCTCCGTAGG + Intergenic
1090134730 11:124185547-124185569 CTGGCAGACACAGTCTTTGTAGG - Exonic
1090730487 11:129569430-129569452 CAGGACGGCAGAGTCTCAGTGGG + Intergenic
1090901371 11:131034846-131034868 CTTGAAGGCATTGTCTCTGATGG + Intergenic
1092658313 12:10711214-10711236 CTTGAAATCACAGTCTTTGTAGG - Intronic
1092708826 12:11312466-11312488 CGGAAAGGGACACTCTCTGTGGG + Intergenic
1094487764 12:30938560-30938582 GTGCAAGGCACAGTCTGTGCAGG - Intronic
1096262184 12:50099793-50099815 CAGGAAGGAACAGCCTCTGCTGG - Exonic
1096572150 12:52529711-52529733 CTAGAGGTCACAGTCTCTCTGGG - Intergenic
1098526756 12:71495196-71495218 CTGGAATGCGAAATCTCTGTTGG - Intronic
1100933191 12:99633863-99633885 AAGGAAGACACAGTGTCTGTTGG - Intronic
1101939337 12:109088398-109088420 CCGGAAGACAAAGTCTCTGCAGG + Exonic
1102389797 12:112540295-112540317 CTGAAAAGCCCAGTCTCTTTAGG - Intergenic
1103469110 12:121165827-121165849 ATGGAAGCCACAGTCTTTGGGGG + Intronic
1112158327 13:96842002-96842024 CTGGAAAGCACAGTCTGTGATGG - Intergenic
1113891105 13:113736014-113736036 CTGCCAGGCGCAGGCTCTGTTGG + Exonic
1114193264 14:20456685-20456707 CTTGAAGGCACAGTATATCTGGG - Exonic
1116271290 14:42771890-42771912 GTGGCAGTCTCAGTCTCTGTAGG - Intergenic
1116809511 14:49525642-49525664 CTGGAAGGCACAGTTTTCCTGGG + Intergenic
1121050721 14:90817140-90817162 GGGGAAGGCACAGTCACTGGTGG + Intergenic
1121123978 14:91394185-91394207 CTGGGAGGCTCAGTCCCTGGGGG - Intronic
1121313035 14:92945411-92945433 CTGCCAGGCACAGTCTCTGAAGG + Intronic
1121399630 14:93662091-93662113 CAGGAAGGCATAGTCTGTTTTGG - Intronic
1122072587 14:99214172-99214194 CTGGGAGGCAGGGTCTTTGTGGG - Intronic
1122611922 14:102990462-102990484 CTGGGAGTCACAGTTTCAGTAGG + Intronic
1123114531 14:105888668-105888690 CTGGAATGCACAGTCTCAGCAGG - Intergenic
1123116691 14:105898069-105898091 CTGGAATGCACAGTCTCAGCAGG - Intergenic
1123118744 14:105907323-105907345 CTGGAATGCACAGTCTCAGCAGG - Intergenic
1124480421 15:30074599-30074621 CTGGAAGACGCAGTCTCTCCAGG - Intergenic
1125263362 15:37852123-37852145 CTGAAGGCCACAGTCCCTGTAGG + Intergenic
1126503146 15:49369851-49369873 CTGGAAGGAAAAGACTCTGAAGG - Intronic
1128624276 15:69183471-69183493 CTGGAAGCCACATGCTGTGTGGG + Intronic
1128682522 15:69662180-69662202 CTGGAGGTCTCAGTTTCTGTGGG + Intergenic
1129372170 15:75104368-75104390 CAGGAAGTCACAGTCTCAATGGG - Intronic
1129393661 15:75233066-75233088 CTGGAAGCCACAGCCTCTCTGGG + Intergenic
1129827623 15:78644996-78645018 CTGGGAGGAACAGTCTCTCCAGG - Intronic
1130648649 15:85749812-85749834 ATGGAAGGCACAGGCTGTGCTGG - Intergenic
1131861102 15:96653900-96653922 ATGGAAGGCACAGTCTCTTCAGG + Intergenic
1133258891 16:4535859-4535881 CTCCAAGCCACAGTCTCTGTGGG - Intronic
1134467696 16:14494053-14494075 CTTGAAAACACAGTCTCTGAGGG + Intronic
1134884078 16:17774398-17774420 CTGCAAAGCCCATTCTCTGTGGG - Intergenic
1136991591 16:35154779-35154801 CCTGAAGGAACAGTCTCTCTGGG - Intergenic
1137535861 16:49324900-49324922 GTGGATGGCACAGGCTCTGCGGG + Intergenic
1137996791 16:53224458-53224480 CTGTTAGGCAAAGTCTTTGTAGG + Intronic
1139273453 16:65704893-65704915 TTGGAAGATACAGGCTCTGTGGG + Intergenic
1139868040 16:70079346-70079368 GTGGAAGGCACAGTCTCACGGGG + Intergenic
1140213032 16:72985798-72985820 AGGGAAGGCACAGGCTCTGCCGG + Intronic
1140387297 16:74552507-74552529 GTGGAAGGCACAGTCTCACGGGG - Intronic
1141100721 16:81195898-81195920 CTTGAAGGAACAGTCTGTGACGG + Intergenic
1143477349 17:7210544-7210566 GTGGAATGAACAGTCTCTGTTGG - Intronic
1143546000 17:7595995-7596017 CTGAAAGGAAAAGTCACTGTAGG + Intronic
1143746022 17:8994712-8994734 CTGGAAGGGACAGTCCCTCCAGG + Intergenic
1144811222 17:18000665-18000687 GTGGAAGGTACAGGTTCTGTAGG - Intronic
1144960214 17:19040426-19040448 CTGGAAGCTGCAGCCTCTGTGGG + Intronic
1144974946 17:19134098-19134120 CTGGAAGCTGCAGCCTCTGTGGG - Intronic
1146447089 17:32940864-32940886 CTGGATTGACCAGTCTCTGTCGG + Exonic
1149134174 17:53344952-53344974 CTGGATGACCCAGTCTCTGTGGG - Intergenic
1149315032 17:55431007-55431029 CTGGGAGTCCCAGTCTCTGCGGG + Intergenic
1149530244 17:57389330-57389352 CGGGAAGGCTGAATCTCTGTGGG - Intronic
1149979130 17:61295526-61295548 CAGGAAGGCACTGTCACTCTTGG - Intronic
1150939333 17:69673446-69673468 CTGGAAGGGAAGGTCTCAGTAGG - Intergenic
1152903386 17:82957761-82957783 CTGGAAGGCAGAATTTCTGTAGG + Intronic
1154331949 18:13437260-13437282 CGGGAAGACAGAGTCTCTGGAGG - Intronic
1155617153 18:27735463-27735485 CTGGAAGATTCAGTATCTGTTGG - Intergenic
1155661054 18:28248762-28248784 CTGGGAAGCACAGTCTCTGAAGG + Intergenic
1160052692 18:75450644-75450666 CTGGAAGGCAAAATCACTCTTGG - Intergenic
1160098743 18:75901074-75901096 CTGGAAGGCACAGATGCTGAGGG + Intergenic
1160236211 18:77088254-77088276 CTGGAAGGCACTGTCCCTGAGGG - Intronic
1161502109 19:4622071-4622093 GTGGCAGGCACACTCTCTGAGGG - Intergenic
1165184132 19:34002165-34002187 CTGGAAGGGGCAGTCTCTCCAGG + Intergenic
1166982009 19:46636414-46636436 CTAGAAAACACAGTCTCTCTAGG + Intergenic
1167269068 19:48497995-48498017 CTCCAAGGCCCAGTCTCTGGTGG + Exonic
924985872 2:269319-269341 GTGGAAACTACAGTCTCTGTGGG + Intronic
925029426 2:637609-637631 CTGGATGGCTCCGTCACTGTGGG + Intergenic
925917019 2:8614173-8614195 CTGGAAGGGACAACCCCTGTTGG + Intergenic
928986787 2:37189883-37189905 CTGGAAGGCAGATACTGTGTTGG + Intronic
930061536 2:47293837-47293859 CTGGGAGGAGCAGTCTCTTTAGG - Intergenic
932335033 2:70925768-70925790 CTGGAAGCCAAAGGCTCTTTTGG + Intronic
932906303 2:75756259-75756281 CCGGAAGGCACATTCTCTTATGG + Intergenic
935553157 2:104479605-104479627 CTGGTGGGCCTAGTCTCTGTTGG - Intergenic
937486818 2:122324062-122324084 CTGAAAGGCACACTTTCTGCGGG - Intergenic
937776489 2:125783001-125783023 CTGGAAGCCAAACCCTCTGTAGG - Intergenic
938264005 2:129913453-129913475 CTGGAAGCCACAAGCTCTCTGGG + Intergenic
938577159 2:132615481-132615503 CAATAAAGCACAGTCTCTGTTGG - Intronic
939020811 2:136956300-136956322 CTGGAAGACTCATTCTCTCTTGG - Intronic
940735827 2:157451076-157451098 CTGCAAGTCAAAATCTCTGTAGG + Intronic
940845700 2:158639791-158639813 TTGGAGGGCACAGACTCTGAAGG + Intronic
941279387 2:163531365-163531387 TTGGGGGCCACAGTCTCTGTTGG - Intergenic
942395323 2:175541117-175541139 CTGGAGGTCACAGTAGCTGTGGG + Intergenic
943564048 2:189496633-189496655 ATTGAAGGCACAGTCCCTGGAGG + Intergenic
944898682 2:204192130-204192152 CTGGGAGGCACAGTCGCTCCAGG - Intergenic
945406152 2:209451428-209451450 CTGGGAGGCACAGACACTGTGGG - Intronic
947767312 2:232645994-232646016 TTGGCTGGCACAGTCTCTGCAGG + Intronic
948116852 2:235499678-235499700 CTGCGAGGCTCGGTCTCTGTTGG + Intronic
1171933980 20:31256325-31256347 CTGAAAGGCATGTTCTCTGTAGG - Intergenic
1173108205 20:40158595-40158617 CTGGAATGCACAGTCTTTGCAGG - Intergenic
1173939260 20:46895465-46895487 CTAGAAGGCAAAGTCTCAGCGGG - Intronic
1174419114 20:50388050-50388072 CAGGAAGGCACAGCCTCGGCGGG + Intergenic
1174713112 20:52728192-52728214 CTGGTAGGCACAGGCTCAGCGGG - Intergenic
1175093812 20:56525874-56525896 ATTGAATGCACAGTCTTTGTTGG - Exonic
1175227129 20:57451210-57451232 GTGGAAGGTACAGTCCCTATGGG + Intergenic
1175828407 20:61949545-61949567 CTGGATGGCACCATCTGTGTGGG - Intergenic
1181601333 22:23953544-23953566 CTGGAAGGCTCTGTCCCTGCTGG + Intergenic
1181929849 22:26391967-26391989 CAGGAAGGCACAGTCACCATAGG + Intergenic
1182084936 22:27554976-27554998 CAGGAGGGCACAGTATGTGTAGG + Intergenic
1184187009 22:42871727-42871749 CTGGATGCCGCAGTCTCAGTGGG - Intronic
1184341881 22:43890791-43890813 CTGGAAAGAGCAGTCCCTGTGGG + Intronic
1184563290 22:45275854-45275876 GTGGCAGGCACAGTCTCAGGGGG - Intergenic
1185212339 22:49577378-49577400 CAGGCAGGCACAGGCTCCGTGGG - Intronic
950132608 3:10557619-10557641 CTGCAGGGCACAGTCACTGAGGG + Intronic
950305791 3:11914791-11914813 CTGGAAGGGGCTTTCTCTGTGGG - Intergenic
954814962 3:53273213-53273235 CTGGAAGGGGCAGACTCTGAGGG + Intergenic
957036566 3:75298720-75298742 CTCAAAGGCACAGACCCTGTTGG - Intergenic
958837455 3:99162555-99162577 GTGGGAGGCACAATCTCTGGAGG - Intergenic
960038816 3:113128586-113128608 CAGGAAGTCACAGTCTATGACGG + Intergenic
962399050 3:135041328-135041350 CTGGGAGGCACAGTGTCTGGGGG + Intronic
965192529 3:165549802-165549824 CTGGCAGCCACAGTCCCTGCAGG - Intergenic
966977684 3:185100069-185100091 GTGGAAGTCTCAGTCTCTTTAGG - Intronic
967222006 3:187255235-187255257 ATGGAAGGGACTGTCTCTGATGG + Intronic
968489067 4:880526-880548 CTGGAAGGCACAGTCTCTGTGGG - Intronic
968709087 4:2099573-2099595 CTTTTAGTCACAGTCTCTGTAGG - Intronic
969368484 4:6715088-6715110 CTGGATGGCAGAGTTACTGTGGG - Intergenic
969692262 4:8710229-8710251 CTGGAGGGCCAAGTCTCTGGGGG - Intergenic
970253865 4:14146521-14146543 CTGGAATGGACAGTCCCTGTGGG - Intergenic
971372062 4:26027760-26027782 CTGGAAGGCAGAGTCTGGTTGGG + Intergenic
973901841 4:55483224-55483246 GTGAAAGACACAGTCCCTGTAGG + Intronic
976504625 4:85832425-85832447 CTGGAAGGGGCAGTCTCTTCAGG + Intronic
978012983 4:103710023-103710045 GTGGGAGTCAAAGTCTCTGTAGG - Intronic
978184132 4:105837133-105837155 CTGGGAGGAACAGTCTCTCCAGG - Intronic
982635198 4:157887167-157887189 CTGGCAGGGACAGGCTCTGGGGG - Intergenic
984615377 4:181891045-181891067 TTTGAAGGCATACTCTCTGTGGG + Intergenic
986772704 5:10988283-10988305 GTGGAAGGCACACACGCTGTGGG - Intronic
990879221 5:60520893-60520915 CAGGCAGCCAGAGTCTCTGTGGG + Intronic
991397822 5:66223076-66223098 CTGGAATGCACAGTCCCTCATGG + Intergenic
992358541 5:76011181-76011203 ATAGAAGCCAGAGTCTCTGTGGG - Intergenic
996451568 5:123631252-123631274 GTGGAAGGCTAGGTCTCTGTAGG - Intergenic
997386952 5:133481036-133481058 CTGGAAGGGACCGTGGCTGTTGG + Intronic
997658801 5:135574779-135574801 CAGGAAGCCACAGTCTCTCAGGG - Intronic
998648029 5:144085595-144085617 CTGGAATGCAAAGTCTCTGTGGG + Intergenic
998878064 5:146620133-146620155 TTGGAAGGCTCATTATCTGTGGG + Intronic
1000164010 5:158629505-158629527 CTTGAAGGCACAGCCTCTGTAGG + Intergenic
1001029434 5:168251103-168251125 CTGGAAGGGACATTCTGTGTGGG - Intronic
1001863990 5:175086923-175086945 CAGGAAAGCACAGCCTCTCTGGG - Intergenic
1002079336 5:176728194-176728216 CTGGAAAGCACAGGCTCTGAGGG - Intergenic
1004871139 6:19905431-19905453 CTGGCAGGGACAGCTTCTGTGGG - Intergenic
1005475329 6:26202411-26202433 GTGGCAGGCACAATCTCTGTGGG - Intergenic
1006275745 6:33004514-33004536 CTAGGAGACACAGCCTCTGTGGG + Exonic
1006453106 6:34116571-34116593 CAAGAAGGTACAGTCTCTTTGGG + Intronic
1006604465 6:35246052-35246074 CTGGAAGCCACGGGCGCTGTTGG - Exonic
1006639003 6:35479464-35479486 CTGGCAGGCACTCCCTCTGTGGG - Intronic
1008355554 6:50548315-50548337 CTGAAAGGAACAGTCCCTCTTGG - Intergenic
1009645864 6:66400318-66400340 CTGGAAGGAACAGTTTCTAATGG + Intergenic
1013633439 6:112007017-112007039 CAGCAAGGCACAGGCTCTGGAGG + Intergenic
1014108624 6:117595260-117595282 CTGGAAGCCACCTTCTATGTAGG - Intronic
1016652127 6:146474286-146474308 CTGCAAGGCAAAGTCTGAGTAGG + Intergenic
1019574572 7:1730284-1730306 CTGGAAGCCCCTGGCTCTGTAGG - Intronic
1020656851 7:10938738-10938760 TTAGGAGCCACAGTCTCTGTAGG - Intronic
1022190087 7:28009098-28009120 ATGGAAGGCAGAGACTCTGATGG + Intronic
1022935282 7:35169242-35169264 ATGCACCGCACAGTCTCTGTAGG - Intergenic
1023598152 7:41854160-41854182 CTGGAAGGCACAGGGGCAGTGGG - Intergenic
1024352428 7:48380760-48380782 CTGGAAGGAACAGTCCCTCTAGG - Intronic
1024638296 7:51308929-51308951 CTGGAAAGCATAGGCTTTGTAGG + Intronic
1024864858 7:53893904-53893926 CTGGAAGGCAGAGAGTTTGTTGG - Intergenic
1028389515 7:90298337-90298359 CTAGATGGCACTGTCTCTATTGG - Intronic
1028737485 7:94233693-94233715 CTGTAGGGCACAGTCTTTCTGGG - Intergenic
1029603236 7:101582267-101582289 CTGGAAGGAGCAGTCTCTCCAGG + Intergenic
1030281644 7:107782188-107782210 CTGGAAAGCAAAGGCTCTCTAGG - Intronic
1033314168 7:140283857-140283879 CTGGGAAACACAGTCTCTATGGG - Intergenic
1033953956 7:146820791-146820813 GTGGGAGTCTCAGTCTCTGTAGG + Intronic
1034353223 7:150430682-150430704 GGGGAAGGCACGGTCTCTGCAGG - Intergenic
1035390377 7:158500489-158500511 CTGGAGGGCACAGGTGCTGTGGG + Intronic
1035866286 8:3085897-3085919 CTGGAGAGCACACTCTCTTTAGG + Intronic
1037122525 8:15306054-15306076 CTGGAAGGAACAGGCTCAGGAGG - Intergenic
1038246608 8:25862763-25862785 CTGGAAGCCATAGTCTATGGTGG + Exonic
1038611712 8:29065179-29065201 CCGGAAGGCACAGCCTCTCCTGG - Intergenic
1040002647 8:42592250-42592272 CTGGAAGAGAGAGTCACTGTTGG - Intergenic
1041615948 8:59907082-59907104 CTGGGAGTCACAGTCCTTGTGGG - Intergenic
1044729105 8:95216046-95216068 TTGCAAAGCACAGTCTTTGTCGG + Intergenic
1045611434 8:103847422-103847444 CTGGATGGCACAGTATGTGTTGG + Intronic
1049253943 8:141604109-141604131 CTGGAAGGAGCAGCCTCTGCTGG + Intergenic
1049520875 8:143089666-143089688 GTGGAAGCCACAGCCTCTGCAGG + Intergenic
1049714700 8:144084356-144084378 CTGAAGGGCACAGGGTCTGTGGG + Intronic
1055339034 9:75262148-75262170 CTGGATGGCACAGTCCCTCATGG + Intergenic
1055960578 9:81816868-81816890 CTGGAACTCACAGTCTGTGAAGG + Intergenic
1056597100 9:88016555-88016577 GTGGCAGGCACAATCTCTGGGGG - Intergenic
1057026043 9:91734352-91734374 CTGGAGGACACAGCCTCTGCTGG - Intronic
1057053997 9:91948239-91948261 CTGCAAGGCAGAGTTTTTGTAGG + Intronic
1057487047 9:95493986-95494008 CATGAAGGCACATTCTCTTTGGG - Intronic
1057732834 9:97625522-97625544 CTGGAACACCCAGTCACTGTTGG - Intronic
1059834028 9:118129662-118129684 CTGGAAGGCACTCCTTCTGTGGG - Intergenic
1060527495 9:124328670-124328692 CTGGAAGTCACAGTGTCTTGTGG + Intronic
1061183775 9:129040255-129040277 CTGGTAGGCAGAGGGTCTGTGGG + Intronic
1062059734 9:134488701-134488723 CTCCGAGGCACAGTCACTGTGGG - Intergenic
1062229871 9:135476056-135476078 CAGGAGGACACAGTGTCTGTTGG - Intergenic
1062395631 9:136351533-136351555 CTAGAAAGCACAGCCTCTGAGGG + Intronic
1062454384 9:136628856-136628878 CTGGAAGACACAGTGATTGTGGG - Intergenic
1189370735 X:40427117-40427139 CTCGAAGACTCAGTTTCTGTTGG - Intergenic
1193381894 X:80825808-80825830 GTGGGAGTCTCAGTCTCTGTAGG + Intergenic
1195004175 X:100670286-100670308 CTCTAGGGCACAGTCTCAGTGGG + Intronic
1195540870 X:106061178-106061200 CTGGTAGGCCCAGTATCTCTTGG + Intergenic
1195844343 X:109209787-109209809 CTGGATAGCACAGTCTCTCATGG + Intergenic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1196652104 X:118178493-118178515 CTTGAAGGCGCAGTTTCTCTAGG - Intergenic
1199241634 X:145554223-145554245 CTGTAATGGACAGTGTCTGTTGG - Intergenic