ID: 968489308

View in Genome Browser
Species Human (GRCh38)
Location 4:881563-881585
Sequence CTCCACACGGCACCTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968489305_968489308 22 Left 968489305 4:881518-881540 CCTAAACACGCTGTGACTGTACT 0: 1
1: 0
2: 0
3: 10
4: 90
Right 968489308 4:881563-881585 CTCCACACGGCACCTGTGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 109
968489304_968489308 23 Left 968489304 4:881517-881539 CCCTAAACACGCTGTGACTGTAC 0: 1
1: 0
2: 1
3: 6
4: 61
Right 968489308 4:881563-881585 CTCCACACGGCACCTGTGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968489308 Original CRISPR CTCCACACGGCACCTGTGTC AGG Intronic
901774910 1:11553869-11553891 ATCCCCAAGGCACCTGTGGCTGG - Intergenic
905890921 1:41517895-41517917 CTCCAAAAGGCCCATGTGTCAGG + Intronic
906742766 1:48198533-48198555 CTCCACCCTGCACCTATATCTGG - Intergenic
910712165 1:90193322-90193344 CTCCATATGGCCCCTCTGTCAGG - Intergenic
912971420 1:114287218-114287240 TTCCACACTGCACCTGTTTTAGG + Intergenic
913331547 1:117672060-117672082 CTCCACCCTGCCTCTGTGTCTGG + Intergenic
917476660 1:175374756-175374778 CTCCACAGGGCACCTGCCTTAGG - Intronic
919857117 1:201713525-201713547 CTTCCCACGGCACCTCTCTCTGG + Intronic
920058848 1:203213777-203213799 CTACACGAGGCACCTGTGCCAGG + Intronic
921801713 1:219410387-219410409 CTGCACGCAGCACCTGTTTCAGG + Intergenic
1063482104 10:6385113-6385135 ATCCACACTTCACCTGAGTCGGG - Intergenic
1067103645 10:43350842-43350864 CTCCAAACGGCCGCTGTGCCCGG + Intergenic
1069859829 10:71463496-71463518 CTCCAGAAGGCACCTTTCTCAGG + Intronic
1074104893 10:110381955-110381977 CTCCACATAGCCCCTGTCTCAGG + Intergenic
1075375405 10:121974774-121974796 CTCCGCCCGGCACCTGCCTCCGG + Intronic
1076539611 10:131205906-131205928 CTCCACCTGGCTCCTGTGCCAGG + Intronic
1076762990 10:132614923-132614945 CTCCACAGGGCACCTGAAGCTGG - Intronic
1076785615 10:132748480-132748502 GCCCACAAGGCCCCTGTGTCGGG + Intronic
1078521973 11:12070775-12070797 CTGCACACGCCACGAGTGTCAGG - Intergenic
1085716741 11:78879568-78879590 CTCCACACGGCCGCCCTGTCTGG + Intronic
1089384573 11:118059371-118059393 CTCCTCTCAGCACCTGTGTGAGG - Intergenic
1090670176 11:128940464-128940486 CTCCACACAGCACCTACATCAGG - Intronic
1090750634 11:129743721-129743743 CTCCCCACGGACCCCGTGTCGGG + Intergenic
1090896382 11:130979684-130979706 GTCCACACAGCTCCTGTCTCTGG + Intergenic
1091221973 11:133935166-133935188 TTCCACACCGCGTCTGTGTCGGG - Intronic
1092102028 12:5891414-5891436 CCCAAAACTGCACCTGTGTCTGG - Intronic
1094153939 12:27317613-27317635 CTCCCCACGGATCCTGTTTCAGG + Intronic
1094848028 12:34369941-34369963 CTCCCCACCGCACCTGCGTGGGG - Intergenic
1103598724 12:122040621-122040643 GTCAACAGGGCACCTGTGTCTGG - Intronic
1108250757 13:48565403-48565425 CACCAAACTGCACCTGAGTCGGG + Intergenic
1108256853 13:48619306-48619328 CCCCATACTGCACATGTGTCGGG - Intergenic
1108331301 13:49387289-49387311 CCCCACAAGGCACCATTGTCAGG - Intronic
1108436152 13:50403434-50403456 GTCCACATGTCACCTGTCTCTGG - Intronic
1111277287 13:85966862-85966884 CTCCACTGGGCACTGGTGTCTGG + Intergenic
1112450372 13:99502045-99502067 CTCCACACGGTCCCTGTTCCAGG - Intronic
1113481561 13:110625608-110625630 CTGCACTCGGCACATATGTCTGG + Intronic
1116514117 14:45785549-45785571 CTCCTTACTGCACCTGTGTTAGG - Intergenic
1121558472 14:94856538-94856560 CTCCACCCCGGACCTGTGTTTGG + Intergenic
1123834627 15:24176851-24176873 CTACACAGGGCACCTGCTTCAGG + Intergenic
1123854327 15:24392523-24392545 CTACACAGGGCACCTGCTTCAGG + Intergenic
1123870345 15:24565700-24565722 CTACACAGGGCACCTGCTTCAGG + Intergenic
1124399850 15:29338586-29338608 CTCCATAGGGCACTGGTGTCTGG + Intronic
1125756214 15:42066796-42066818 CTTCACAGAGCACCTGTGTCAGG - Intergenic
1129232518 15:74204591-74204613 CTCTACAAGGCAGCAGTGTCAGG + Intronic
1132998486 16:2836732-2836754 CTACAAACAGCACCTGTGTGAGG + Intronic
1133116629 16:3581306-3581328 CTCCACACTGCTCCTGAGGCTGG + Exonic
1135990107 16:27213502-27213524 TTCCACCAGGAACCTGTGTCAGG - Intronic
1136010994 16:27363371-27363393 CTCCCCAGAGCACCTGGGTCTGG + Exonic
1137577011 16:49606696-49606718 TTCACCAAGGCACCTGTGTCAGG - Intronic
1140112144 16:72013562-72013584 CTCCACCCTTCACCTATGTCAGG + Intronic
1147721695 17:42543468-42543490 CTCCACGCTGCCCCTGCGTCCGG - Exonic
1148743567 17:49906518-49906540 TTCCTCAGGGCAGCTGTGTCTGG + Intergenic
1157546475 18:48550191-48550213 CTCCACCTGGCCCCAGTGTCGGG - Intronic
1160785141 19:896798-896820 TCCCCCACGCCACCTGTGTCGGG - Exonic
1162113340 19:8413303-8413325 CTCCGGCCGGCACCTGCGTCCGG - Intronic
1164593888 19:29520958-29520980 ATTCACACGCCACCAGTGTCAGG - Intergenic
1165638538 19:37364325-37364347 CTCCTCACTGCAGCTGAGTCTGG - Exonic
925149896 2:1607696-1607718 CTACACACTGCACCTGCATCTGG - Intergenic
927516677 2:23675591-23675613 CTCCAGGCTGCACCTGTGTTTGG + Intronic
928268545 2:29833273-29833295 CCCCTCACGGCACCTGTGCAAGG + Intronic
935597979 2:104894600-104894622 CTCCATGGGGCACCTGGGTCAGG - Intergenic
940787018 2:157992290-157992312 CTCCACACCCCACCTATCTCCGG - Intronic
948439580 2:237978163-237978185 CTCCACACCACACCTGTCCCAGG - Intronic
1172343565 20:34178868-34178890 CTGCACACGGCACTTATTTCAGG - Intergenic
1172595683 20:36149580-36149602 CACCACAGGGCAGCTGTGTCTGG - Intronic
1173681808 20:44887041-44887063 CTACAAACTGCATCTGTGTCTGG - Intronic
1173873863 20:46357663-46357685 CACCACACGGGCCCTGTGGCTGG + Exonic
1175094895 20:56533437-56533459 CTCCACACGGCACCTTCCCCTGG - Exonic
1178496267 21:33089040-33089062 CTCCTCAGGCCACCTGTGGCGGG + Intergenic
1180175448 21:46084965-46084987 CTCTTCACTGCACCTGGGTCGGG - Intergenic
1180743644 22:18071854-18071876 CCCCACTCGGCATCTGTTTCCGG - Intergenic
1181103275 22:20555625-20555647 CTCCACACGGCTGCTGTGGTGGG + Intronic
1182269389 22:29144113-29144135 CTCCACAAGGCACTTGGGCCTGG + Intronic
1182465634 22:30514566-30514588 CTGCCCCGGGCACCTGTGTCAGG - Intergenic
1185218427 22:49616740-49616762 CTCCCGACGGCGCCTGTGCCTGG - Intronic
949104229 3:183926-183948 CTCCACAGGACACCTCTGTTAGG + Intergenic
949554218 3:5138896-5138918 CTCCACACTGCAGCTCTCTCTGG - Intronic
951764821 3:26185983-26186005 TGCCACAGGGCACCTGTTTCAGG + Intergenic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
956757945 3:72408033-72408055 CTCCGTATGGCATCTGTGTCAGG - Intronic
961060221 3:123822395-123822417 ATCCAGATGGTACCTGTGTCTGG - Intronic
968489308 4:881563-881585 CTCCACACGGCACCTGTGTCAGG + Intronic
968510879 4:995424-995446 CTGCACGGGGCACCTGTGGCCGG + Intronic
968549338 4:1214258-1214280 CTCCAGACGGCGCCTCTGCCAGG - Intronic
971207350 4:24583882-24583904 CTCCCCACGGCCCCTCTGGCTGG + Intronic
972642504 4:40938381-40938403 CACCACACGGAAGCTGTGTGAGG + Intronic
975711819 4:77168509-77168531 CTGAACACTGCACCTGTCTCTGG + Exonic
986068086 5:4255579-4255601 CACCCCACGCCTCCTGTGTCGGG - Intergenic
986177791 5:5366638-5366660 CTCCCCAGGGCACGTGTGTGGGG - Intergenic
993164431 5:84334038-84334060 TTCCACATGGCCCCTGTGTAAGG - Intronic
996412201 5:123170454-123170476 CACCACACTGCACCTATGCCTGG - Intronic
996418483 5:123236029-123236051 CTCCACACGGCAGCAGCCTCGGG - Intergenic
997342053 5:133152652-133152674 CTCCACACAGCACCTGCCTCTGG - Intergenic
1000254883 5:159528015-159528037 CTCCGCACGGCAACTCTGTGAGG + Intergenic
1004641383 6:17519233-17519255 CTCCAGACCGCAGCTGTGTCAGG + Intronic
1005423182 6:25673753-25673775 CTCCAGATGGCCCCTGTGTTAGG + Intronic
1007367998 6:41408052-41408074 CTCCACACTGCACCAGTGTCAGG + Intergenic
1008125629 6:47665296-47665318 GTGCAGACGGCAGCTGTGTCAGG - Intronic
1010911031 6:81556728-81556750 CTCCAGACTGAAACTGTGTCAGG - Intronic
1017949186 6:159121407-159121429 CTTCTCAGGGCACCTCTGTCTGG - Intergenic
1019698609 7:2461370-2461392 CTCCACACCACACCTGGGGCAGG - Intergenic
1020210489 7:6154619-6154641 CTCCACCCCGCTCCGGTGTCGGG - Exonic
1024512100 7:50212427-50212449 ATCCACACAGGACCTGTGGCAGG - Intergenic
1024526513 7:50354190-50354212 CTGCTCACAGCACCTGTGTTGGG - Intronic
1027266129 7:76496209-76496231 CTCAACCCGGCACATGTGCCTGG - Intronic
1027317506 7:76994327-76994349 CTCAACCCGGCACATGTGCCTGG - Intergenic
1027718693 7:81710027-81710049 CTCCACAGGGCACCTGGGTGAGG - Intronic
1034520429 7:151615015-151615037 ATCCACACGGCTTCTGTCTCGGG - Intronic
1035611208 8:965591-965613 CCTCACACGGCTCCTGAGTCTGG + Intergenic
1037410136 8:18587202-18587224 CTCCTCACAGGACCTGTGTGGGG - Intronic
1042932066 8:74023373-74023395 CTCCACACACTACCTGTTTCGGG - Intronic
1048847940 8:138617304-138617326 CTCTGCACGGCTCCTGAGTCAGG + Intronic
1049607624 8:143536984-143537006 CTCAACACGGCACCTATCTGGGG + Intronic
1058875414 9:109239898-109239920 CTCTACTCAGCACCTGTGACAGG + Intronic
1061419318 9:130464610-130464632 CTCCCCAGGCCACCTGTGCCTGG + Intronic
1062582687 9:137235486-137235508 CTCCAGACTGCACCTGTGTGTGG + Intronic
1062587676 9:137256693-137256715 CCCCACAGGGCACCTATGACTGG - Intronic
1195926343 X:110029453-110029475 CTCCACACCTCACTTCTGTCAGG - Intronic