ID: 968493279

View in Genome Browser
Species Human (GRCh38)
Location 4:901770-901792
Sequence AGGATGCCCTGTGCTGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968493279_968493282 -3 Left 968493279 4:901770-901792 CCAAGGACAGCACAGGGCATCCT 0: 1
1: 0
2: 1
3: 33
4: 285
Right 968493282 4:901790-901812 CCTCCACAAGCCGTGGCCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 145
968493279_968493286 18 Left 968493279 4:901770-901792 CCAAGGACAGCACAGGGCATCCT 0: 1
1: 0
2: 1
3: 33
4: 285
Right 968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 19
968493279_968493280 -10 Left 968493279 4:901770-901792 CCAAGGACAGCACAGGGCATCCT 0: 1
1: 0
2: 1
3: 33
4: 285
Right 968493280 4:901783-901805 AGGGCATCCTCCACAAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968493279 Original CRISPR AGGATGCCCTGTGCTGTCCT TGG (reversed) Intronic
900670460 1:3850625-3850647 AGGGTGCCTTGTACTGTCATTGG + Intronic
901357367 1:8662754-8662776 AGTATCCCCAGTTCTGTCCTGGG - Intronic
904334306 1:29787077-29787099 AGGGTGCCAGGTGCTGTCCAGGG - Intergenic
904604621 1:31691771-31691793 AGGTTGACATGTGCTGACCTTGG - Intronic
904884597 1:33726594-33726616 AGGATGCCTTGAGCTGTGCCTGG - Exonic
905485325 1:38292127-38292149 AGGAAGCCGTGGGCTCTCCTCGG - Intergenic
909882354 1:80895688-80895710 ATGATGCTTTGTTCTGTCCTGGG - Intergenic
913498615 1:119450365-119450387 AGAATGCCGTGTACTGGCCTGGG - Intergenic
913551381 1:119920211-119920233 AAGAGGCCCGGTGCTGACCTGGG + Exonic
916191929 1:162187850-162187872 ATGATGCCATGTGATGTGCTGGG + Intronic
917594586 1:176516228-176516250 AAGATTCCCTTTTCTGTCCTCGG + Intronic
918217413 1:182404494-182404516 TTGATGCCCTGTGCTGTCTCAGG + Intergenic
919317858 1:195998386-195998408 AGGATGCAAAGTGTTGTCCTGGG + Intergenic
919718788 1:200809884-200809906 ATGATGCCCTGTGCTGCCTCAGG - Intronic
919742899 1:200991246-200991268 AGGCTGCTCTGTGCTGGCCTGGG + Intronic
920195233 1:204222306-204222328 ATGATGACAAGTGCTGTCCTTGG + Exonic
920977499 1:210799880-210799902 AGGTGCCCCTGTGCTCTCCTTGG + Intronic
922269545 1:224019310-224019332 AGGAAGCCCTTTGCTGTCAGTGG + Intergenic
922370567 1:224906724-224906746 AGGATGCCCTGTCATGAACTAGG + Intronic
922741483 1:228016514-228016536 AGGAAGCCCTATGATGTCTTGGG + Intronic
923270284 1:232349081-232349103 AGTATGACCAGTGCTGGCCTTGG - Intergenic
923615148 1:235531136-235531158 ATGATGCCCTGAGCTGTCTCAGG + Intergenic
924270172 1:242324484-242324506 AAGCTGCCCTGTTCTTTCCTGGG + Intronic
1062902273 10:1155555-1155577 AGGAAGGCCTGAGCTGTCTTTGG + Intergenic
1063122593 10:3115237-3115259 AGCATCCCCAGTCCTGTCCTCGG - Intronic
1063668471 10:8080813-8080835 AGCAGTCCCTGTGCTATCCTTGG - Intergenic
1065966914 10:30778183-30778205 GGGATGCCCTGTGCTGCCTTGGG + Intergenic
1066714738 10:38274276-38274298 AAGCTGCCCTGTTCTTTCCTGGG - Intergenic
1066783334 10:38976433-38976455 AAGCTGCCCTGTTCTTTCCTGGG + Intergenic
1066974996 10:42359693-42359715 AGGATGTCCTGTGCAGACTTGGG - Intergenic
1067027792 10:42859098-42859120 GGGCTGCCCTGTGCTGTAATTGG - Intergenic
1067790890 10:49286883-49286905 AGGAGGCCCTGGGCTGTGCCTGG + Intergenic
1069639456 10:69945415-69945437 AGAATGACCCGTGGTGTCCTGGG - Intronic
1072469332 10:95697662-95697684 GTGATGCCCTGTGCTGCCTTGGG + Intergenic
1072991458 10:100199249-100199271 GGGAAGGCCTGTGCTGTTCTAGG - Intronic
1073043760 10:100624146-100624168 AGCATGCCAGGTGCTGTGCTAGG + Intergenic
1074055864 10:109922813-109922835 AGCCTGCCCTGGGCTCTCCTTGG - Intronic
1074654073 10:115562279-115562301 CGGTTGCCTTGTGCTGTGCTTGG + Intronic
1075699512 10:124460095-124460117 AGGATGACCTCTGCAGGCCTAGG - Intergenic
1076169492 10:128307694-128307716 AGGATTCCCACTGCTTTCCTGGG + Intergenic
1076224871 10:128765945-128765967 CGGATGCACTGTGCTCTCCCTGG + Intergenic
1076343623 10:129766135-129766157 AGGATGCCCTGTGCTGATAGGGG - Intronic
1076423648 10:130351904-130351926 AGGTTGCTTTGTGCTTTCCTGGG + Intergenic
1076543714 10:131230183-131230205 AGGAGGGCGTCTGCTGTCCTGGG - Intronic
1076688107 10:132207258-132207280 ACGGTGCACGGTGCTGTCCTGGG + Intergenic
1076698004 10:132256377-132256399 AGGATCCACAGTGCTGGCCTGGG - Intronic
1076771680 10:132669522-132669544 AGGAGGCCCCGTGTTCTCCTGGG + Intronic
1077475682 11:2789215-2789237 ATGATACCCTGTGCTGGCATGGG + Intronic
1077543663 11:3159580-3159602 AGGCTGCCCTGAGCTGTCTCAGG - Intronic
1077553679 11:3215679-3215701 AGGTTGCCCTGGGCTGGTCTGGG - Intergenic
1078064737 11:8071047-8071069 TGTATGCCTTGGGCTGTCCTGGG - Intronic
1078317671 11:10306102-10306124 ACTACGCCCTGTGCTGTCCAGGG + Intronic
1078540066 11:12206229-12206251 AGGATGCCTTGTGGGGCCCTGGG + Intronic
1078873085 11:15367173-15367195 AAGATGCCTTGGGCTGGCCTTGG + Intergenic
1079211361 11:18463331-18463353 GTGATGCCCTGTGCTGCCTTGGG + Intronic
1083209364 11:61173361-61173383 AGGATGCCCAATGCTGCCTTAGG - Intergenic
1084424234 11:69076094-69076116 AGGAAACCATGTGGTGTCCTTGG + Intronic
1084563123 11:69915109-69915131 AGGATGCCCTGTTCTGCTTTGGG - Intergenic
1085533755 11:77206234-77206256 AGGAAGCCCGGCCCTGTCCTGGG - Intronic
1087485661 11:98757099-98757121 AGCTTCCCCTGTGCTGTTCTTGG + Intergenic
1088850613 11:113700337-113700359 AGGCTCCCCTGTGCCCTCCTGGG + Intronic
1089035562 11:115386546-115386568 GTGATGCCCTGAGCCGTCCTGGG - Intronic
1089074974 11:115730926-115730948 AGGCTGGCCTCTGCTGCCCTGGG - Intergenic
1089679127 11:120109758-120109780 AGGAGGCCCAGGGCTGTGCTGGG - Intergenic
1090239503 11:125172112-125172134 ATGGTGCTCTGCGCTGTCCTGGG + Intronic
1091125417 11:133091313-133091335 AGGATGCTCTGTGATGGCCCTGG - Intronic
1091283101 11:134393305-134393327 AGCATGCATTGTGCAGTCCTGGG - Intronic
1091315812 11:134613315-134613337 AGGATGCTCTGGCCTGTCCCAGG - Intergenic
1096623077 12:52876607-52876629 AGCTTGCCCTGTGCTGAGCTGGG - Intergenic
1101648709 12:106655271-106655293 AGGATGCTCTGTGATGACTTGGG + Intronic
1104058804 12:125250646-125250668 AGCATCCCCTTTGCTTTCCTTGG + Intronic
1104784673 12:131441854-131441876 AGGCTGCCCAGTGCTGTTCAGGG - Intergenic
1105005449 12:132718347-132718369 AGGGACCCCTGTGGTGTCCTGGG + Intronic
1105357186 13:19669410-19669432 ACGATGCCCTGAGCTGGCCCTGG + Intronic
1105403322 13:20114241-20114263 AGGTTGCTCTGAGCTGGCCTTGG - Intergenic
1106021308 13:25918512-25918534 AGGGTTCCCTTTGGTGTCCTGGG - Intronic
1110731677 13:78885734-78885756 AGCATGCCCTATGCTTTCTTAGG - Intergenic
1113231267 13:108215891-108215913 AGGATGTCCTGTTCTCTCTTGGG - Intronic
1113573812 13:111380626-111380648 CGGCTGCCCTCGGCTGTCCTCGG + Intergenic
1114410831 14:22498707-22498729 GGGAGGCCCTCTGCAGTCCTGGG - Intergenic
1114755668 14:25256745-25256767 ATGGTGCCTTGTGCTGTCCTTGG + Intergenic
1116687088 14:48053444-48053466 AGGACCCCCTGTCCTGTCATAGG + Intergenic
1117999690 14:61511364-61511386 AGGGTGCCCTTTGCCCTCCTAGG - Intronic
1119521873 14:75292400-75292422 AGTGTGCCCAGTGCTGGCCTGGG - Intergenic
1119851012 14:77866821-77866843 AGCATGCCCTGGGCTGGACTAGG + Intronic
1121472027 14:94163471-94163493 TGCATGCCCTGGGCTTTCCTAGG + Intronic
1121579782 14:95020533-95020555 AGGAGGCTCTTTGCTGTTCTTGG + Intergenic
1122022306 14:98848333-98848355 TGAATGCCCAGTGCTGTTCTGGG + Intergenic
1122172366 14:99887511-99887533 AGAATGCCCAGTCCTGTCCTAGG - Intronic
1122556902 14:102585427-102585449 AGGAGGCCCTCTCCTCTCCTGGG + Intergenic
1122952053 14:105050488-105050510 AGGCTGCCCTATGCCCTCCTGGG + Exonic
1123084754 14:105712269-105712291 GGGCTGCCCTGAGCTGCCCTGGG - Intergenic
1123427442 15:20183927-20183949 GGGCTGCCCTGTGCTGTAATTGG - Intergenic
1123536678 15:21190477-21190499 GGGCTGCCCTGTGCTGTAATTGG - Intergenic
1126663638 15:51055898-51055920 ATGATGCCCTGTGCACACCTGGG - Intergenic
1130835355 15:87644783-87644805 AGGATTCCTCATGCTGTCCTAGG - Intergenic
1131180404 15:90235197-90235219 AGAATACCCAGTGCTCTCCTTGG + Intronic
1131990789 15:98090920-98090942 AGGATGCCATGTTCTGTAATGGG - Intergenic
1132099337 15:99012334-99012356 AGGATGCCATGTTCTGTAATGGG + Intergenic
1132373311 15:101312243-101312265 AGGTTGCCCTGCCCTGTTCTGGG + Intronic
1132608388 16:802941-802963 AGCAGGTCCTGTGCTGACCTGGG + Intergenic
1133965741 16:10530501-10530523 AGGATGCTGGGGGCTGTCCTGGG - Exonic
1135138375 16:19901412-19901434 GGGATGCCCTGTGCTGCCTGGGG + Intergenic
1136856847 16:33665882-33665904 GGGCTGCCCTGTGCTGTAATTGG + Intergenic
1142340287 16:89517517-89517539 ACCATGCCCTTTGCTCTCCTGGG + Intronic
1142667646 17:1471775-1471797 CGGAGGCCCTGGGCTGCCCTTGG - Intronic
1143062672 17:4215517-4215539 AGAGTGCCCCCTGCTGTCCTTGG - Intronic
1143571875 17:7764329-7764351 GGGAGGCCCTTGGCTGTCCTCGG + Intronic
1143919211 17:10317588-10317610 AGGGTGCTCTGAGCTGTACTAGG - Intronic
1144224460 17:13131488-13131510 AGGATGGGATGTGCTGTCATTGG + Intergenic
1144599435 17:16599452-16599474 ATGATGCCCTGTGCTGTATCAGG + Intergenic
1145001872 17:19311023-19311045 AGGAATCCCTGTGCTGCCCCTGG - Intronic
1146926140 17:36747002-36747024 TAGATGCCATGTGCTGTACTTGG + Intergenic
1147460512 17:40565221-40565243 AGAATGCCCCCTGCTGTCCCAGG - Intronic
1147599634 17:41737933-41737955 TGTATGCCCTGTTCTGTGCTTGG - Intergenic
1147656177 17:42092497-42092519 AGGAGGCCCTTTGGGGTCCTAGG + Intergenic
1148135327 17:45288221-45288243 GGGATTCCTTCTGCTGTCCTGGG - Intronic
1148215175 17:45830323-45830345 GGTATGCCCTGTCCTGCCCTGGG + Intronic
1149539569 17:57458822-57458844 AGGGTGCCCTGTGCAGGCCGTGG + Intronic
1149662929 17:58345074-58345096 AGGGTGAGCTGTGCTGTGCTAGG - Intergenic
1150291178 17:63983312-63983334 CGGATGCCCGGTGCTGTCTTTGG - Intergenic
1152664282 17:81558335-81558357 AGGCTGCCCTGCGATGGCCTGGG - Exonic
1152860293 17:82692448-82692470 GGCATGCCCTGTGCTGGCCAGGG - Intronic
1154091997 18:11373790-11373812 GTGATGCCCTGTGCTGTCTCAGG - Intergenic
1154292380 18:13120957-13120979 AGAATGACCTGTGTTGACCTTGG + Intronic
1155239023 18:23847768-23847790 GGGGTGCCCTGTGTTGACCTCGG + Intronic
1156181648 18:34612117-34612139 AACATTCCCTGTGCTGGCCTGGG + Intronic
1156718405 18:40040454-40040476 AGCAAGCCCTTTCCTGTCCTAGG + Intergenic
1157632368 18:49111616-49111638 ATGATGCCTTGTGCTTTGCTGGG + Intronic
1159359475 18:67381734-67381756 AGGAAGAGCTGTGCTGTGCTGGG + Intergenic
1161234102 19:3189597-3189619 AGGATGCCCGGTGCCCTCCATGG + Intronic
1163296201 19:16414370-16414392 AGGCTGTCCTGGGCTGTCCAGGG - Intronic
1163364055 19:16866326-16866348 AGGATGCCCTGGCTTGTCCCTGG + Intronic
1163928072 19:20364096-20364118 AGGCTGCCCTGAGGTCTCCTGGG - Intergenic
1165825409 19:38702904-38702926 AGGGTCTCCTGTGGTGTCCTGGG + Intronic
1166441151 19:42816330-42816352 AGCATGCCCTGTACTCTCCAGGG - Intronic
1166460630 19:42984937-42984959 AGCATGCCCTGTACTCTCCAGGG - Intronic
1166477922 19:43144910-43144932 AGCATGCCCTGTACTCTCCAGGG - Intronic
1167359938 19:49024553-49024575 AGGATGCCCGGAGCTGTCCCCGG + Intronic
1167361145 19:49031218-49031240 AGGATGCCCGGAGCGGTCCCCGG - Intronic
1167362505 19:49037579-49037601 AGGATGCCCGGAGCGGTCCCCGG + Intergenic
1167363623 19:49043605-49043627 AGGATGCCCGGAGCGGTCCCCGG - Intergenic
1167364874 19:49049321-49049343 AGGATGCCCGGAGCTGTCCCCGG + Intergenic
1167366156 19:49055958-49055980 AGGATGCCCGGAGCGGTCCCCGG + Exonic
1168073493 19:53965524-53965546 TAGATGCCACGTGCTGTCCTAGG - Intronic
925111023 2:1337363-1337385 AGGATGGCCAGTACTCTCCTAGG - Intronic
925234310 2:2264674-2264696 AGCATGCACTGTGCTGTGCTGGG - Intronic
925357448 2:3252144-3252166 TGTCCGCCCTGTGCTGTCCTTGG + Intronic
927070795 2:19527310-19527332 AGGAAGCCCTGTGCTCGTCTTGG - Intergenic
928262217 2:29778197-29778219 AGGATGCGCTCTGCAGTCCTTGG + Intronic
928784768 2:34870089-34870111 AGCTTTCCCTGTTCTGTCCTGGG + Intergenic
929037787 2:37711339-37711361 AGGCTCCCCAGTGCTGTCTTTGG + Intronic
930030610 2:47056140-47056162 TGGATTCCCTGTGTTGGCCTGGG + Intronic
935322252 2:101900488-101900510 AGGATGCCGTGTCCTGTTCAGGG + Intergenic
937093506 2:119222181-119222203 CGGTTTCCTTGTGCTGTCCTTGG + Intergenic
937669126 2:124519830-124519852 AGGCTGCCCTGCGCTTTCCTAGG - Intronic
938816372 2:134908707-134908729 ATGATGCCCTGTACTATCTTGGG - Intergenic
940907775 2:159184399-159184421 GGGATGCCCTGTGCTCAGCTGGG + Intronic
941635011 2:167927044-167927066 GTGATGCTCTGTGCTGCCCTGGG - Intergenic
941757024 2:169197870-169197892 ATGATGCCCTTTGATTTCCTTGG + Intronic
944995577 2:205289836-205289858 GTGATGCCCTGTGCTGCCTTGGG + Intronic
945030009 2:205654752-205654774 GTGATGCCCTGTGCTGCCTTGGG + Intergenic
946121723 2:217521737-217521759 ATGATGCCCTGTGCCACCCTGGG - Intronic
946136182 2:217649075-217649097 GTGATGTCCTGTGCTGTCTTGGG + Intronic
946170185 2:217890645-217890667 AGGAAGGCATGTGCTGTTCTTGG - Intronic
946389684 2:219408113-219408135 ATGAGCCACTGTGCTGTCCTGGG + Intergenic
947826443 2:233108744-233108766 ACGGTGCCCCGTGCTGCCCTGGG - Intronic
947950926 2:234146658-234146680 TGGATGACCTTTGCTGACCTTGG - Intergenic
948758502 2:240174047-240174069 AGGATGCCCTGTGCTTCACGAGG + Intergenic
948838134 2:240636097-240636119 AGGAGGCCCTGTGCTCAACTGGG + Intergenic
948875678 2:240826349-240826371 AAGCTGCCCTGGGCTGCCCTGGG - Intergenic
1169207564 20:3748852-3748874 AGGATGACCATAGCTGTCCTTGG - Intronic
1169691012 20:8332137-8332159 ATAATGCCTTGTGCTGCCCTTGG + Intronic
1172094565 20:32454366-32454388 AGGGGCCACTGTGCTGTCCTGGG - Intronic
1172684750 20:36745580-36745602 AGGATGCCCTCTGCTGCTCTGGG + Intronic
1173437866 20:43048802-43048824 GAGAAGCCCTGTCCTGTCCTTGG + Intronic
1173453715 20:43188142-43188164 AGGATGCCCGGGGCAGTCCTGGG - Intronic
1173945956 20:46951146-46951168 AGGATGCCCTGTGCCCTGCGTGG - Intronic
1173988152 20:47278888-47278910 AGGGTCTCCAGTGCTGTCCTAGG + Intronic
1174854143 20:54026865-54026887 AAGATGCCAAGTGCTGTGCTGGG - Intronic
1175118815 20:56702843-56702865 AGGATGCCCTCAGTTCTCCTGGG - Intergenic
1175245909 20:57581789-57581811 AGGAAGCTCTGGGCTGGCCTTGG + Intergenic
1175360052 20:58402613-58402635 ACCATGCACTGTGCTGTGCTAGG - Intronic
1175974305 20:62702674-62702696 AGGCTGTGCTGGGCTGTCCTGGG - Intergenic
1176159232 20:63640244-63640266 TGGACGCCCAGTGCTGGCCTTGG - Exonic
1176204076 20:63878711-63878733 CAGATGCCCTGTGCTGCCCAGGG + Intronic
1177551392 21:22627027-22627049 GTGATGCCCTGTGCTGTCTTGGG - Intergenic
1178899729 21:36589242-36589264 AGGATGGCTGGTGCTGTCCTTGG - Intergenic
1179043121 21:37822424-37822446 AGGAGCCCCAGAGCTGTCCTGGG - Intronic
1180708668 22:17825092-17825114 AGGGTGCCCTGGGCTGTGCCTGG - Intronic
1181778738 22:25178192-25178214 TGAATGCCCAGTGCTGGCCTTGG - Intronic
1181943392 22:26496406-26496428 AGGAGGCCCTGTGCTCTCTGAGG + Intronic
1182063826 22:27416702-27416724 AGCAGGCCCCCTGCTGTCCTAGG - Intergenic
1183264345 22:36816377-36816399 AGGATGCCCCGTGCGGGCTTAGG + Intronic
1183978196 22:41525230-41525252 ATGCTGCCCGCTGCTGTCCTTGG - Exonic
1185186729 22:49405628-49405650 AGGCTTCCCTGTGGTGGCCTGGG - Intergenic
1185394117 22:50578168-50578190 AGGCTGCCCTTCGCCGTCCTTGG - Intronic
950849280 3:16047388-16047410 AGGTTGCTGTGTGCAGTCCTAGG - Intergenic
952253757 3:31678196-31678218 AGGAGGCCATGTGCTGTGCTGGG + Intronic
953034316 3:39198742-39198764 ATGATGCCCTGAGCTGCCTTGGG + Intergenic
953334042 3:42078834-42078856 AGGATTCCATATGCTGTCATTGG + Intronic
954624578 3:52015598-52015620 AGCATGCCCTGGGCTGTGCCGGG + Intergenic
955689029 3:61572607-61572629 AGCATGCCAGGTGCTGTTCTAGG + Intronic
959513565 3:107240868-107240890 AGGATGCTCTCTGCAGCCCTCGG - Intergenic
959540480 3:107531840-107531862 AGAATGCCCTGTGCTGACAAGGG - Intronic
959842079 3:110988969-110988991 AGGATGCCTTTGGCTTTCCTGGG - Intergenic
960506334 3:118499482-118499504 AGGATATCCTGAGCTGTCCTTGG + Intergenic
960544051 3:118891682-118891704 AGGATGCCTTTTGCTACCCTGGG - Intergenic
961212985 3:125140168-125140190 AGGTTGCCCTGTGGTGTCCTTGG - Intronic
961393542 3:126570621-126570643 AGGAGGCCCTGTGCTGTGTGAGG - Intergenic
963010022 3:140760247-140760269 AGAAATCCCTGTCCTGTCCTAGG + Intergenic
964145994 3:153464107-153464129 ATGATGCCCTGTACTATCTTGGG + Intergenic
964656590 3:159073619-159073641 AGGATGCACTGAGCAGTTCTTGG - Intronic
966647965 3:182268182-182268204 AGGATCCCCTGTGTTGCTCTCGG - Intergenic
968189155 3:196654892-196654914 AGGATGCCCTAGGCTGGTCTCGG - Intronic
968493279 4:901770-901792 AGGATGCCCTGTGCTGTCCTTGG - Intronic
968597626 4:1493489-1493511 AGGAAGTCCTGCGATGTCCTGGG + Intergenic
968621324 4:1604634-1604656 TGCAGTCCCTGTGCTGTCCTGGG - Intergenic
969254938 4:5995193-5995215 AGGGTGCCCTGGGCTGTGTTCGG - Intergenic
969453301 4:7287048-7287070 AGGGCTCCCTGTGCTGCCCTGGG + Intronic
971165227 4:24175880-24175902 AGGATGCCATGTGCTGCCCGTGG - Intergenic
971267604 4:25108817-25108839 AGGAGGCCTTGTGTTGCCCTGGG - Intergenic
973917976 4:55655906-55655928 AGCATGCTCTTTGCTGGCCTTGG + Intergenic
974255176 4:59443089-59443111 GGGATGCCCTGTGCTGCCTTGGG + Intergenic
977282685 4:95061670-95061692 AGGATCCCAAGTTCTGTCCTGGG - Intronic
977352573 4:95907114-95907136 AGGAAGACCTGTGCTTCCCTTGG + Intergenic
979612116 4:122700353-122700375 AGGACATCCTGTGCTGTCCGTGG - Intergenic
982404220 4:155002357-155002379 AGCATGTGCTGTGCTGTCCCAGG - Intergenic
984897368 4:184553564-184553586 AGGAGGCCTTGCTCTGTCCTAGG - Intergenic
985834899 5:2262980-2263002 GGGATGACCTGAGATGTCCTGGG - Intergenic
985834911 5:2263030-2263052 AGGTTGACCTGGGATGTCCTGGG - Intergenic
986075236 5:4329933-4329955 AGAATGCCCTGTGCAATACTTGG - Intergenic
986566309 5:9118717-9118739 AGGAACCTCTGTGCTGTGCTAGG - Intronic
994166581 5:96615526-96615548 AGGATTCTGTGGGCTGTCCTTGG + Intronic
995852434 5:116560040-116560062 AGGAGGCCCCTTGCTGTTCTGGG + Intronic
997001346 5:129765829-129765851 AGTATTCCCTCTGCTTTCCTAGG - Exonic
999303812 5:150507318-150507340 AGGTTGCCTTGTGCTCTCCTTGG + Intronic
999729391 5:154464742-154464764 AGCCTGCCCTGTTCTGCCCTGGG + Intergenic
1000845458 5:166274561-166274583 ATGATGCCCTGTGCTGCCTTGGG - Intergenic
1001017425 5:168153990-168154012 AGCCTGGCCTGTGCTTTCCTGGG - Intronic
1002020609 5:176361831-176361853 AGCATGCCCTGTGCTCCGCTGGG - Exonic
1003873441 6:10418661-10418683 TGGATGCCTTGTGGTGTCCGCGG + Intronic
1004326053 6:14674875-14674897 AGGATTCCCTGTAGTTTCCTCGG + Intergenic
1005887211 6:30106201-30106223 AGGCTGTCTTGTGCTGTCTTGGG - Intronic
1008602733 6:53111744-53111766 AGGCTGCCCAGTGCTGTGCTTGG - Intergenic
1011710062 6:90044035-90044057 ATGATGCCATGTACTGTTCTAGG + Intronic
1012522387 6:100136735-100136757 TGGGTGCCCTGTGCTGACCCAGG + Intergenic
1012605341 6:101151599-101151621 TGGATACCCTGTGCTCTGCTAGG + Intergenic
1014361546 6:120482581-120482603 AGAATGGCCAGTGCTTTCCTTGG - Intergenic
1014785332 6:125612035-125612057 AGGCTGCCCTGCCCTGTGCTTGG - Intergenic
1015851284 6:137575161-137575183 TAGATGCCCTGTTCTGGCCTTGG - Intergenic
1017227454 6:152038377-152038399 AGGATGCAAAGTGCTGTCCTTGG - Intronic
1017710648 6:157164356-157164378 CGGATGGACAGTGCTGTCCTGGG + Intronic
1019390477 7:783921-783943 GAGATGCCCTGTGCAGTCCTGGG - Intronic
1019946994 7:4337926-4337948 AGGATGACCTGTGCCTCCCTGGG - Intergenic
1020006127 7:4784563-4784585 AGGATCCCCGGTGCTGACCCTGG - Intronic
1020071969 7:5233083-5233105 GGGAAGCCCTGTGCTTGCCTGGG + Exonic
1020077768 7:5269775-5269797 GGGATGCCCTGTGCCTCCCTGGG - Intergenic
1022096834 7:27146555-27146577 GGGATTCCCTGTGGAGTCCTTGG + Intronic
1024055516 7:45657785-45657807 AGGGTCCTCTGTGGTGTCCTGGG + Exonic
1024638527 7:51310469-51310491 AGGATGCCCTGTCTGGCCCTCGG + Intronic
1025021894 7:55486824-55486846 TGCCTGCCCTGTGCTGCCCTGGG - Intronic
1025142254 7:56475877-56475899 ATGATGCCCTGTGCCCTCCTGGG - Intergenic
1025201119 7:56962396-56962418 GGGATGCCCTGTGCCTCCCTGGG + Intergenic
1025637481 7:63335502-63335524 TGGGTGCCCTGTCCTGTCCGTGG + Intergenic
1025645216 7:63412597-63412619 TGGGTGCCCTGTCCTGTCCGTGG - Intergenic
1025670825 7:63614536-63614558 GGGATGCCCTGTGCCTCCCTGGG - Intergenic
1025715766 7:63953794-63953816 AGGGTGCCCTGTCCTGTCCGTGG - Intergenic
1026186454 7:68085427-68085449 AGCAAACGCTGTGCTGTCCTTGG + Intergenic
1028462902 7:91116129-91116151 AGAATGCCCTGTGGTGTATTTGG - Intronic
1029468213 7:100739351-100739373 AATATGCCAGGTGCTGTCCTAGG + Intronic
1031184922 7:118464886-118464908 TGTTTGCCCTGTACTGTCCTTGG + Intergenic
1031707297 7:124996842-124996864 ATGATGCCCTGAGCTGTCTTAGG - Intergenic
1032622442 7:133549760-133549782 AAGATTTCTTGTGCTGTCCTTGG - Intronic
1033296584 7:140143359-140143381 AGGATGGCAGGTGGTGTCCTGGG + Intronic
1033296690 7:140144818-140144840 GGAATGTCTTGTGCTGTCCTAGG + Intronic
1035039929 7:155920139-155920161 AGGCTGCACTATGCTGTCCGCGG + Intergenic
1035541964 8:447179-447201 AGGAAGCCCTTTGCTGTCAGTGG - Intronic
1036578930 8:10054743-10054765 AGGAAGCCGTGGGCTGGCCTCGG + Intronic
1036584491 8:10110706-10110728 TGGCTGACCTGTGCTGTCTTTGG + Intronic
1036941710 8:13058405-13058427 ACGATGCCCCTTGCTGTCCTGGG + Intergenic
1037209893 8:16374606-16374628 ATGTTGCCCTGTTCTGGCCTTGG - Intronic
1039977033 8:42375696-42375718 GAGATGCCATGTGCTGCCCTGGG - Exonic
1040561931 8:48530300-48530322 TGGAGGCCCTGAGCTGCCCTGGG + Intergenic
1040691348 8:49942554-49942576 AAAATGTCCTGTGGTGTCCTGGG - Intronic
1043514706 8:80985277-80985299 TGGTTTCCCTGTGCTGTCCTGGG + Exonic
1044589325 8:93898526-93898548 AGGATACCCTTTGAGGTCCTCGG - Intronic
1047723981 8:127668803-127668825 AGGCTGCCCTGTCCTTCCCTGGG - Intergenic
1047756193 8:127920106-127920128 AGGATGACTTTTGCTGTCCTAGG - Intergenic
1047773835 8:128052368-128052390 ATGCTGCACTGTGCTGTCTTGGG + Intergenic
1048332230 8:133478710-133478732 AGGAAGCCCTGCCCTCTCCTGGG + Intronic
1049081281 8:140445283-140445305 AGCTTGCCATGTGCTGTGCTAGG - Intronic
1049560156 8:143306330-143306352 AGGATGCGCTGAGCAGTCCCGGG + Intronic
1049652030 8:143774471-143774493 AGTTTGACCTGGGCTGTCCTGGG - Intergenic
1050880009 9:10687945-10687967 ATGATGCCCTGAGCTCTCCCGGG - Intergenic
1051455144 9:17247112-17247134 AGTATTCCCTGTGCTGCCCTGGG + Intronic
1052860263 9:33433732-33433754 ACAATGCTCTGTGCTGTCCCAGG - Intergenic
1053198474 9:36137162-36137184 GGGATGCTCAGGGCTGTCCTCGG - Intronic
1059440109 9:114301843-114301865 GGGATGCCCTATACTCTCCTAGG - Intronic
1060268523 9:122126085-122126107 AGGCTGCTCTGAGCTGTACTTGG + Intergenic
1061048103 9:128178276-128178298 AGGAGGCCCTGAGGTGGCCTGGG + Intronic
1061385878 9:130289145-130289167 AAGATGCCCAGTGCTCTCCCAGG - Intronic
1061931486 9:133835333-133835355 TGGTTGGCCTGTGCTGGCCTGGG - Intronic
1062101914 9:134732934-134732956 AGGATGCCCTGTGATCAGCTGGG + Intronic
1062108365 9:134768008-134768030 AGGATGCCCTGCCCTGCCCTGGG + Intronic
1062283618 9:135763151-135763173 AGGTGGGCCTGTGCTGTCCCTGG + Intronic
1062293959 9:135813835-135813857 TGGATGCCCTGAGCTCTCCTTGG - Intronic
1062371769 9:136242939-136242961 AGGTTGCCCTGGGGTCTCCTTGG - Intronic
1185574685 X:1162105-1162127 AGGATGCATTGTGCGGTCATGGG + Intergenic
1185841414 X:3395104-3395126 ATTATGCCCTGTGCTGCCCCAGG + Intergenic
1188303909 X:28539148-28539170 AGGATGCTCTGTGAATTCCTGGG - Intergenic
1188966018 X:36552561-36552583 CTGATGACATGTGCTGTCCTTGG - Intergenic
1192341215 X:70264988-70265010 CAGATTTCCTGTGCTGTCCTAGG - Intergenic
1192770806 X:74187432-74187454 AGGATGCCATGTGCTTTCACTGG - Intergenic
1196710659 X:118758693-118758715 GTGATGCCCTGTGCTGTCTTGGG - Intronic
1199608116 X:149592799-149592821 AGGAAGTCCTGTGGTGTCCATGG + Exonic
1199631004 X:149776561-149776583 AGGAAGTCCTGTGGTGTCCATGG - Exonic
1200074961 X:153546306-153546328 AGGATGCCCTGAGCAGCCCCAGG - Intronic
1201863110 Y:18621233-18621255 AAAATGCACTGTGCTGTCATTGG - Intergenic
1201870213 Y:18699145-18699167 AAAATGCACTGTGCTGTCATTGG + Intergenic