ID: 968493281

View in Genome Browser
Species Human (GRCh38)
Location 4:901790-901812
Sequence CCTCTGGCCACGGCTTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968493281_968493292 30 Left 968493281 4:901790-901812 CCTCCACAAGCCGTGGCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 968493292 4:901843-901865 AGCCACACTTTGGGAAAACCAGG 0: 1
1: 0
2: 0
3: 22
4: 230
968493281_968493290 20 Left 968493281 4:901790-901812 CCTCCACAAGCCGTGGCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 968493290 4:901833-901855 GTCTGAGAGAAGCCACACTTTGG 0: 1
1: 0
2: 0
3: 16
4: 146
968493281_968493286 -2 Left 968493281 4:901790-901812 CCTCCACAAGCCGTGGCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 19
968493281_968493291 21 Left 968493281 4:901790-901812 CCTCCACAAGCCGTGGCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 968493291 4:901834-901856 TCTGAGAGAAGCCACACTTTGGG 0: 1
1: 0
2: 0
3: 20
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968493281 Original CRISPR CCTCTGGCCACGGCTTGTGG AGG (reversed) Intronic
900422039 1:2559943-2559965 CCTCTGGCCCGGGCTGGAGGTGG - Exonic
900591366 1:3461722-3461744 CCTCTGGGCCCGGCTCCTGGAGG + Intronic
901532596 1:9862940-9862962 CCTCTTACCAGGGCTTGAGGGGG + Intronic
901639635 1:10686810-10686832 CTTCTGGCCACGGGTGGGGGAGG - Intronic
903161290 1:21490991-21491013 CCTCTGCCCTCTGCTGGTGGAGG + Intergenic
904498788 1:30902367-30902389 CCTCTGGCCATGGCGGGAGGGGG + Intronic
905242601 1:36590496-36590518 CCTCTGGCCAGGCCTTGAGTGGG - Intergenic
907450742 1:54544216-54544238 CCTCTGGGCAAGCCTTGTGCTGG + Intronic
912561781 1:110556279-110556301 CATTTGGCCCTGGCTTGTGGAGG - Intergenic
914361940 1:146943443-146943465 CCACTGTCCAGGGCTTCTGGTGG + Exonic
914489685 1:148143512-148143534 CCACTGTCCAGGGCTTCTGGTGG - Exonic
919850308 1:201667970-201667992 CCTATGGCCATGGCCTGTGATGG - Intronic
920034742 1:203058629-203058651 CCTCTGGCCACGAATTCTGAAGG + Intronic
1064317535 10:14272292-14272314 CTTCTGGCCAATGGTTGTGGGGG - Intronic
1075006742 10:118836035-118836057 ACTCTGGACAAGGCTTCTGGAGG - Intergenic
1076647261 10:131961766-131961788 CCTCTGGCCAGGGCAGGTGGTGG + Intergenic
1080452115 11:32386264-32386286 CCTGTGGCCCAGGCTTGAGGCGG - Intergenic
1083269417 11:61564090-61564112 CCTGTTGCCCCTGCTTGTGGGGG - Intronic
1083300333 11:61736725-61736747 CCACTGGCCACGGTCTGTGCAGG + Intronic
1084461741 11:69300032-69300054 CCTCTGGCCATGGCTGCTGCGGG + Intronic
1084684350 11:70685077-70685099 CCTCTGGCCACACCATCTGGGGG - Intronic
1092046339 12:5433704-5433726 CGTCTGGCCTCGGCCTCTGGCGG + Intronic
1093081919 12:14822088-14822110 CCTCTGGTCACGACTAGTTGGGG + Intronic
1094509017 12:31084949-31084971 CCTCTGGACAGGGGTAGTGGAGG - Exonic
1096603126 12:52744711-52744733 GCACTGGCCACTGCTGGTGGTGG + Intergenic
1097197186 12:57249537-57249559 CCTCTGACCACTGGGTGTGGGGG - Intronic
1099672913 12:85717756-85717778 CCTCAGGCCATGGCTTCTGATGG - Intergenic
1103176300 12:118866327-118866349 CCTCAGGACTCAGCTTGTGGGGG + Intergenic
1104360086 12:128124811-128124833 CCTCTGGCCTGGGCAGGTGGAGG - Intergenic
1105874733 13:24541546-24541568 CCTCTGGCCCCGGGCTGTGTGGG + Intergenic
1107595572 13:41960417-41960439 GTTCTAGCCAGGGCTTGTGGCGG - Intronic
1109526302 13:63580530-63580552 CCTCTGGCCATGGCTTCAGAGGG - Intergenic
1112261808 13:97884312-97884334 CTTCTGGCTAGGGGTTGTGGTGG - Intergenic
1114636204 14:24188357-24188379 CCGCTGGCGACGGCTGGCGGCGG - Exonic
1118144844 14:63124184-63124206 CCTCTCTCCTTGGCTTGTGGAGG + Intergenic
1118905185 14:70018549-70018571 CCTCTGGCCAGGGCTCCAGGAGG + Intronic
1122453681 14:101833234-101833256 CCTCTGGCCACGGCTGGCCGAGG - Intronic
1129051711 15:72786487-72786509 CCTTTGGGCATGGCCTGTGGTGG - Intergenic
1132675760 16:1120684-1120706 TCTCTGGCCAGGGCCTGCGGTGG - Intergenic
1132829328 16:1919723-1919745 CCTCTGGCCAGGGCTGCTGCTGG - Intergenic
1133040820 16:3059059-3059081 CCTCTTGCCCCTGCTGGTGGGGG + Exonic
1134070681 16:11257634-11257656 CATGTGGCCAGGGCTGGTGGTGG + Intronic
1138477473 16:57280326-57280348 CTTCTCCCCACGGCTTGGGGAGG + Intronic
1141696847 16:85624257-85624279 CCTCTGCCCAGGGCCTCTGGAGG + Intronic
1143503340 17:7351380-7351402 CCTCGGGTCACAGCGTGTGGAGG - Exonic
1144085552 17:11805330-11805352 ACTCTGGACACGGGTTTTGGTGG - Intronic
1146595265 17:34162890-34162912 CCTGTGGCCACTGCTTTGGGAGG - Intronic
1148204190 17:45769283-45769305 GCTGGGGCCACGTCTTGTGGCGG - Intergenic
1148851307 17:50556762-50556784 CATGGGGCCACTGCTTGTGGGGG + Intergenic
1152100298 17:78297596-78297618 CCTCTCCCCACTGCTTGTGGGGG - Intergenic
1152484592 17:80582041-80582063 GCTCTGGCCATGGCTTCTGAGGG + Intronic
1160992049 19:1863977-1863999 CCTCCCGCCCCGGCTTGAGGGGG - Intergenic
1161753429 19:6114130-6114152 CCTCTGGCCAGGGCTGGGAGCGG - Intronic
1161807987 19:6456160-6456182 CCTCTGGGGACAGCGTGTGGGGG - Intronic
1163248291 19:16110841-16110863 CTTCCGGGCACAGCTTGTGGCGG + Intergenic
1167650373 19:50725394-50725416 CCTCTGACGACGGCTCCTGGTGG + Exonic
925019232 2:555466-555488 CCTCTTGTCACAGCCTGTGGGGG + Intergenic
925829659 2:7882036-7882058 CCTGTGACCACTGCTGGTGGTGG - Intergenic
932700063 2:73985661-73985683 CCTCCAGCCAGGGCGTGTGGGGG + Intergenic
934917024 2:98308628-98308650 CCTCTGGCCAGGGCAGGGGGAGG + Intronic
937208730 2:120253329-120253351 CCTCCGGCCGCGGCTTGGGCAGG + Intronic
937307935 2:120883796-120883818 CCTCTGGCCCCTGGTGGTGGGGG + Intronic
943569456 2:189556036-189556058 GCTCTGGGCAGGGGTTGTGGTGG + Intergenic
945911967 2:215660084-215660106 CCTCGGGCCAGGGCCTGGGGAGG - Intergenic
946245973 2:218387691-218387713 CCTCTGGCCGCGGGCTGCGGGGG + Intronic
946534135 2:220608011-220608033 CCTCTGGCCATGGCTTCAGAGGG - Intergenic
946814523 2:223563164-223563186 CCTCTGGCCCTGACTTGAGGAGG - Intergenic
948615057 2:239193192-239193214 CCTCTGCCCAGCGCCTGTGGTGG - Intronic
948944412 2:241212223-241212245 CCTCTGGCCACAGCTTGTCCCGG + Intronic
1174521102 20:51131413-51131435 CCTCTGGCCAGTGCTACTGGAGG + Intergenic
1175188980 20:57198690-57198712 CATCTGGCCACGGGTGGTGGGGG - Intronic
1175582092 20:60107904-60107926 CCTTTGTCCACACCTTGTGGAGG + Intergenic
1178348318 21:31851122-31851144 CCTTTGGCCACAGCATGTGCTGG + Intergenic
1181941056 22:26477517-26477539 CCTCTGGCCACTCCGTATGGGGG - Intronic
1185089491 22:48757749-48757771 GCACTGGCCAGGGCTGGTGGAGG + Intronic
949549073 3:5097316-5097338 CCTGTGCCCATGGTTTGTGGGGG + Intergenic
950537143 3:13585202-13585224 CTGATGGCCACGGCTGGTGGGGG - Intronic
951627287 3:24679816-24679838 CCTCTCTCCTTGGCTTGTGGAGG + Intergenic
954635371 3:52068239-52068261 ACTCTGGCCCAGGCTTGGGGAGG - Intergenic
960554407 3:119011471-119011493 ACTGTGGCCACAGCATGTGGAGG + Intronic
960996537 3:123343955-123343977 CGTCTGCCCACGGCCAGTGGTGG + Intronic
961340271 3:126212958-126212980 CTTCAGGCCCCGGCCTGTGGAGG + Intergenic
964403199 3:156320722-156320744 CCACTGGACAGGCCTTGTGGAGG - Intronic
964987811 3:162766156-162766178 CCTCTGCCCTCTGCCTGTGGAGG - Intergenic
968493281 4:901790-901812 CCTCTGGCCACGGCTTGTGGAGG - Intronic
968932724 4:3590533-3590555 CCTCTGGGCACTGCTTCTGCAGG + Intronic
973530726 4:51834708-51834730 CCTCTGACCATGGCTCTTGGTGG - Intergenic
974323892 4:60389102-60389124 CCTCTCTCCTTGGCTTGTGGAGG - Intergenic
975576813 4:75871330-75871352 CCTCTGGCTGTGGCTTGTAGGGG + Intronic
977370342 4:96126530-96126552 GCTCTGGCCACAGTCTGTGGAGG - Intergenic
984830298 4:183966536-183966558 CCCCTGGGAACGGCTTCTGGGGG - Intronic
986293743 5:6420614-6420636 CCTCTGCCTTGGGCTTGTGGTGG - Intergenic
986733738 5:10653316-10653338 CCTCTTGCCTCGACCTGTGGGGG + Intergenic
997377500 5:133407736-133407758 TCCCTGGGCACGGCTTTTGGAGG + Intronic
998140597 5:139697525-139697547 CCTCTGGGCCTGGCTGGTGGGGG + Intergenic
1001944944 5:175770945-175770967 CCTCTGGCCACAGCTCTTGCAGG + Intergenic
1001980831 5:176036060-176036082 CCTCTGGCTGCGGTTGGTGGTGG - Intergenic
1002236631 5:177808005-177808027 CCTCTGGCTGCGGTTGGTGGTGG + Intergenic
1002466331 5:179410686-179410708 CCTCCTGCCAGGGCCTGTGGTGG - Intergenic
1002643215 5:180640389-180640411 CCTCTGCCCCCGGCCTTTGGAGG - Intronic
1002910451 6:1487357-1487379 CCTCTGGCCTGGACTTGTTGAGG + Intergenic
1003502323 6:6712821-6712843 GCTCTGTCCAGGGCTTGTCGAGG - Intergenic
1004786731 6:18976158-18976180 CCTCTGGCGGTGGTTTGTGGTGG + Intergenic
1006299212 6:33184991-33185013 CCTCTTGCCACCCCTTGAGGAGG - Exonic
1015295554 6:131587734-131587756 CCACTGTTCATGGCTTGTGGAGG + Exonic
1025263600 7:57438658-57438680 CCTCTGGCTCAGGCTTGTGGTGG + Intergenic
1025635640 7:63317477-63317499 CCTCTGGCTCAGGCTTGTGGCGG - Intergenic
1025647056 7:63430703-63430725 CCTCTGGCTCAGGCTTGTGGCGG + Intergenic
1027746578 7:82082198-82082220 CCTCTGCCCTCCGCTGGTGGAGG - Intronic
1034049204 7:147964189-147964211 CCTCTCTCCTTGGCTTGTGGAGG - Intronic
1034446536 7:151116686-151116708 CCTCTGGCCTGGGCTTGGGGAGG + Intronic
1035311927 7:157974983-157975005 CCTCTGGGCAGGGCTAGTGAGGG + Intronic
1035605409 8:926976-926998 CCTCTGGCCCCGGCTTTTCCTGG - Intergenic
1037121321 8:15290564-15290586 CCACTAGCCACAGCTGGTGGAGG - Intergenic
1037820751 8:22133540-22133562 CCTGTGGCAACGCCTGGTGGGGG + Intergenic
1037876843 8:22552581-22552603 CCTCTGACTACGGGTCGTGGGGG + Intronic
1040550492 8:48433601-48433623 CCTCTGGCTTGGGCTGGTGGAGG + Intergenic
1047277323 8:123416355-123416377 TCTCTGGCGGCGGCTTGGGGAGG - Intergenic
1047302044 8:123621867-123621889 CCTTTGGCCCTGGCTTGTGGTGG - Intergenic
1049347293 8:142145794-142145816 CCGCTGGGCCAGGCTTGTGGGGG - Intergenic
1049373742 8:142279535-142279557 CCGGTGGGCACGGCTTGAGGTGG + Intronic
1050231150 9:3526636-3526658 CCTGAGGGCACGACTTGTGGAGG + Intergenic
1053067187 9:35077012-35077034 CCTGTGTCCACGGCCTGTGTTGG - Exonic
1053523908 9:38809690-38809712 CCTCTTGTCACTGCTTCTGGTGG + Intergenic
1054196141 9:62034102-62034124 CCTCTTGTCACTGCTTCTGGTGG + Intergenic
1054457401 9:65441362-65441384 CCTCTGGGCACTGCTTCTGCAGG - Intergenic
1054642264 9:67554587-67554609 CCTCTTGTCACTGCTTCTGGTGG - Intergenic
1057936048 9:99239757-99239779 CCTCTGGCCACTGTTTGTCAAGG - Intergenic
1061163452 9:128909363-128909385 GGCCTGGCCAGGGCTTGTGGTGG + Intronic
1061481516 9:130899623-130899645 CCACTGGGCGCGGCTTGTGCAGG + Intergenic
1062151768 9:135023042-135023064 CCTCTCCCCACTGCTTCTGGGGG - Intergenic
1189619324 X:42818731-42818753 CCTCTGCCCTCTGCTGGTGGAGG - Intergenic
1193185545 X:78507804-78507826 TCCTTGGGCACGGCTTGTGGTGG - Intergenic
1200206215 X:154318175-154318197 CCTCTGGCCTCGGCCTCTTGAGG + Intronic